1. culture-independent techniques applied to food industry water

7/30/2019 1. Culture-Independent Techniques Applied to Food Industry Water

1/9

Culture-independent techniques applied to food industry watersurveillance A case study

Jessica Varela Villarreal, Thomas Schwartz, Ursula Obst

Karlsruhe Institute of Technology (former: Forschungszentrum Karlsruhe), Institute of Functional Interfaces (IFG), Microbiology of Natural and Technical Interfaces Department,

P.O. Box 3640, 76021 Karlsruhe, Germany

a b s t r a c ta r t i c l e i n f o

Keywords:

Drinking water

Food industry

Monitoring

Pathogen

PCR-DGGE

Real-time PCR

Culture-independent techniques were used for the detection of pathogenic bacteria in drinking water at

potentially critical control points along the production lines at a German dairy company and a Spanish dry

cured ham company. Denaturing gradient gel electrophoresis (DGGE) was used to describe bacterial

population shifts indicating biological instability in the drinking water samples. Autochthonous bacteria were

identified by sequencingthe excisedDGGE DNAbands. More specifically, real-timePCR wasapplied to detecta

number of pathogenic bacteria, i.e. Listeria monocytogenes, Mycobacterium avium subsp. paratuberculosis,

Campylobacter jejuni, Enterococcus spp., Salmonella spp, Escherichia coli, and Pseudomonas aeruginosa.

Dueto thedetectionlimits ofthe real-timePCR method, a specific protocol wasestablishedin order tomeet the

technical detection requirements and to avoid unwanted polymerase inhibitions. Autochthonous bacterial

populations were found to be highly stable at most of the sampling points. Only one sampling point exhibited

population shifts at the German dairy company. Enterococci and P. aeruginosa were detected in some water

samples from these companies by molecular biology detection methods, but not by conventional culturing

methods. Some opportunistic bacteria as Enterobactersp.,Acinetobacter, Sphingomonas sp. and non-pathogenic

Bacillus, were also detected after DNA sequencing of DGGE bands.

2010 Elsevier B.V. All rights reserved.

1. Introduction

Drinking water coming from public suppliers is not sterile, but

contains a number of autochthonous and mostly harmless bacteria

(Szewzyk et al., 2000; WHO, 2004a). Drinking water distribution

systems are an enormous heterogeneous reactor in which the different

zones behave almost independently, especially regarding the density

and diversity of bacterial populations (Leclerc, 2003). Pathogenic or

opportunistic bacteria may enter drinking water facilities under

irregular operating conditions. In this case, some of these bacteria are

able to persist and distribute across the production lines at food

industries (Allen et al., 2004; USEPA, 1992). Besides pathogens, also

opportunistic bacteria may cause diseases in immunocompromised

people. In this case, the dose response is an important issue. It will vary

depending on the pathogen and the host as well as on many other

factors (Szewzyk et al., 2000; Leclerc et al., 2002). Pathogenic bacteria

maylose their viabilityand pathogenicity after leavingtheirnatural host

or enter a physiological state called viable but not culturable (VBNC)

(Oliver, 2000,2005). VBNC bacteria enter this state in response to oneor

more natural stresses, i.e. nutrient deprivation, shift in the optimal

growth temperature, oxygen concentration, elevated osmotic concen-

trations,and exposure to white light. They maybe reanimated when the

stress factor that induced this state is removed (Oliver, 2005). Most of

thepathogenic bacteria arenot expected to stay infectiousin water over

a long term and some will disappear with time, since they are unable to

multiply under these conditions. Some species, such as Pseudomonas,Aeromonas, and Mycobacterium avium, however, may even multiply in

drinking water (Legnani et al., 1999; Grobe et al., 2001; Leclerc et al.,

2002). It is important to notethat somewaterborne bacteria arecapable

of multiplyingrapidly whencontained in foodstuff. Thiscan enormously

increase their inoculum's potential andmake even initially lowand non-

infectious doses of bacterial pathogens a hazard in food production. If

pathogens find their optimal growth conditions (e.g., nutrient,

humidity, and temperature), a proliferation in food and subsequent

transfer to humans becomes a threat. Drinking water is used in food

industry for many purposes. It can be in direct contact with foodstuff or

in indirect contact with the food product during cleaning and rinsing

processes (Casani and Knochel, 2002). According to the Drinking Water

Directive 98/83/EC (EU, 1998), water for human consumption should

fulfil the highest drinking water standards imposed by the local

authorities. Consequently, public drinking water is controlled by the

local municipal suppliers, but surveillanceby the suppliers ceases when

the water enters food production facilities. Various scenarios may

influence the microbial drinking water quality, e.g. rupture of pipelines,

water stagnation, pipeline material, etc. Culture-independent methods

were applied to identify potential water-derived critical points

International Journal of Food Microbiology 141 (2010) S147S155

Corresponding author. Tel.: +49 7247 825148; fax: +49 7247 826858.

E-mail address: [email protected] (J. Varela Villarreal).

0168-1605/$ see front matter 2010 Elsevier B.V. All rights reserved.

doi:10.1016/j.ijfoodmicro.2010.03.001

Contents lists available at ScienceDirect

International Journal of Food Microbiology

j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / i j f o o d m i c r o
mailto:[email protected]://dx.doi.org/10.1016/j.ijfoodmicro.2010.03.001http://www.sciencedirect.com/science/journal/01681605http://www.sciencedirect.com/science/journal/01681605http://dx.doi.org/10.1016/j.ijfoodmicro.2010.03.001mailto:[email protected]


2/9

according to the HACCP concept (EU, 2005; FAO/WHO, 2006). Water

samples taken at different points of the production lines of a German

dairy companyand a Spanish drycuredham company were subjectedto

an integral evaluation. The denaturing gradient gel electrophoresis

(DGGE) technique has been applied in this work to compare the

autochthonousbacterialpopulationof drinking waterat different points

at food industriesin order to analysethe stabilityof thewaterwithinthe

industry. Real-time PCR, and DNA sequencing were used as additional

tools for the identifi

cation of Listeria monocytogenes, Mycobacteriumavium subsp. paratuberculosis, Campylobacter jejuni, Enterococcus spp,

Salmonella spp, Escherichia coli, and Pseudomonas aeruginosa in the

water samples. Cultivation experiments complemented the DNA-based

experimental techniques.

2. Materials and methods

2.1. Cultivation methods and extraction of genomic DNA

Genomic DNA was extracted in order to carry out standard curves

and to determine the detection limits of the real-time PCR assays.

DNA of L. monocytogenes ATCC 19112 (American Type Culture

Collection, Rockville, MD.USA) was provided by the Max Rubner

Institute in Karlsruhe, Germany. M. avium subsp. paratuberculosis DSM

44133 (German Collection of Microorganisms and Cell Cultures,

Braunschweig, Germany) was grown in two different media:

Middlebrook 7H10 agar (DifcoTM, BD, Le Pont de Claix, France) with

Middlebrook OADC growth supplement (BBLTM, BD, Maryland, USA)

and Mycobactine J (Synbiotics Europe, Lyon, France), and Harrold's

egg yolkagarslants with Mycobactine J and ANV (BD, Le Pontde Claix,

France) at 37 C for 1 month. C. jejuni DSM 4688 was plated on

Campylosel agar (bioMrieux, Nrtingen, Germany) and Columbia

agar (bioMrieux) and incubated at 37 C for 48 h. Enterococcus

faecium DSM 20477 and Enterococcus faecalis DSM 2981 were plated

on Chromocult Enterococci agar (Merck, Darmstadt, Germany) and

Slanletz-Bartley agar (Oxoid, Hampshire, England) and incubated at

37 C for 48 h. E. coli DSM 1103 and P. aeruginosa DSM 1117 were

grown in tripticase soya broth and nutrient broth at 37 C for 24 h.

Salmonella enterica subsp. enterica DSMZ 9274 was grown in selectiveagar Salmonella (Merck) at 37 C for 48 h. Single colonies of each

strain were transferred to rich nutrient media, i.e. tripticase soya

broth, TGA-medium or brain heart infusion. Cells were harvested by

centrifugation at 5000 rpm for 5 min and supernatant decant off.

Reference strains were stored in 25% glycerine at 80 C until use.

Total genomic DNA was purified from each bacterium starting

with a colony or a cell suspension of the isolate. DNA was purified

using PrepMan Ultra Sample preparation (Applied Biosystems,

Darmstadt, Germany) in accordance with the manufacturer's guide-

lines. Concentration of each purified DNA template was determined

by spectrophotometry (NanoDrop 1000, peqlab, Erlangen, Germany).

Genomic DNA aliquots were stored at 20 C until use.

The number of viable culturable bacteria in the water samples was

quantified by plating methods. 100 ml water sample was filtered, asindicated by most of the drinking water guidelines, placed on each

specific agar, and subjected to the required cultivation conditions.

Enterococci, C. jejuni, and Salmonella sp. were cultured using the same

agar media as described above. E. coli were grown in two different

media, Mac Conkey agar (Merck) and Lactose TTC agar (Merck), at

37 C for 48 h. P. aeruginosa were grown on Cetrimide agar (Merck,

Darmstadt, Germany) at 37 C for 48 h.

2.2. Water samples and extraction of total DNA

Five and six sampling points were selected at the German and

Spanish food companies, respectively. Thefirst sampling point at both

companies was the entry of conditioned public drinking water at the

plants. Downstream sampling points differed from one company to

another depending on the production processes with drinking water

(Table 1).

Planktonic bacteria from water samples were concentrated by

filtration using 0.2 m mixed cellulose ester membrane filters

(Whatman, Dassel, Germany). A volume of 2000 ml water from

each sampling point at the German company was reduced to 1 ml by

filtration.In this way, the bacterialconcentration in thewater samples

was increased by a factor of 2000 for the first sampling period. For the

second sampling period at the German company, the bacterialconcentration of each water sample was increased by a factor of

10000. The water samples were taken at the same sampling points as

in the first sampling period. At the Spanish company, 5000 ml water

was filtered and then resuspended in 1.5 ml water, increasing the

bacterial concentration of every water sample by a factor of 3700.

These samples were transported frozen to Germany. The bacteria on

the filter were resuspended by thorough vortexing in sterile water,

and the filter was thrown away. Due to the low number of bacteria

expected in drinking water samples, cells in the suspension were

disrupted by the commonly used freezingthaw method (Muldrew

and McGann, 1994) and kept at 20 C until use.

2.3. Detection of PCR inhibitors and prevention of PCR inhibition

Due tothefiltrationof the water samplesand to the different origins

of the water (groundwater and surface water), the presence of PCR

inhibitors was examined by a PCR efficiency assay. This step was

required to avoid false negative results. Eubacterial ribosomal primer

systems targeting 16S rDNA were applied to perform the PCR. Forward

primers were modified by adding a GC clamp at the 5 end for

subsequent DGGE analysis. The primer GC27F 5-CAGAGTTT-

GATCCTGGCTCAG-3 with 517R 5-ATTACCGCGGCTGCTGG-3 (Muyzer

et al., 1993; Emtiazi et al., 2004) and the primer GC341F 5-

CTACGGGAGGCAGCAG-3 with 907R 5-CCGTCAATTCTTTGAGTTT-3

(Green and Minz, 2005) were used to obtain 490 bp and 566 bp PCR

products, respectively. 25 l PCRfinal reaction mixture contained 2.5 U

HotStar Taq-DNA polymerase (Qiagen, Hilden, Germany), 10 pmol of

each primer, 10 PCR buffer, 200 mmol/l dNTPs, and 10 l template. A

GeneAmp PCR System 9700 (Applied Biosystems) was used for theamplification.To controlPCR efficiency, 9 l of each template wasspiked

with1 l enterococcalDNA (10 ng/l). In parallel,the standard DNAwas

used exclusively. The temperature profile consisted in a treatment of

15 min at 95 C, followed by 35 cycles of 0:30 min at 94 C, 0:30 min at

54 Cand1:30 min at72 C,and afinal stepof 7 minat 72 C. Aliquotsof

10 l PCR products were subjected to electrophoresis on 1% agarose gel

to verify their sizes and estimated amounts.

If PCR inhibitors were present, 0.5 l sterile bovine serum albumin

(BSA) (Sigma, Munich, Germany) solution (5 mg/ml) was added to

the PCR reaction mix according to Kreader (1996). In case of stronger

inhibitions, a polyvinylpolypyrrolidone (PVPP) (Sigma) treatment of

the samples was performed according to Sutlovic et al. (2007).

2.4. Denaturing gradient gel electrophoresis and sequencing

The above described eubacterial ribosomal primer systems

targeting 16S rDNA were subsequently used for the DGGE analyses.

Table 1

Sampling points at food companies.

Germa n d airy compa ny Spa nish d ry c ur ed ham c omp any

1. Entry of public conditioned

drinking water

1. Entry of public conditioned

drinking water

2. Lactic acid tank 2. Hygienic sluice

3. Portioner 3. Salt wash-off

4. Hand washbasin 4. Hand washbasin of deboning room

5. Maturation roo m 5. Hand washbasin of packagin g roo m

6. Feta packaging

S148 J. Varela Villarreal et al. / International Journal of Food Microbiology 141 (2010) S147S155


3/9

10 l of the filtered sample was used as template for the PCR. DGGE

analysis of PCR products was performed by means of the D-Code-

System (BioRad Laboratories GmbH, Munich, Germany) using

polyacrylamide gels containing a 4070% denaturing gradient of

formamide-urea. DGGE gels were run in 1 TAE buffer (40 mmol/l Tris,

20 mmol/l acetate, 1 mmol/l EDTA) at 70 V and 60 C for 16 h. The gels

were stained with SYBR Gold (Invitrogen, Karlsruhe, Germany). The

stained gels were immediately analysed using the Lumi-Imager

Working Station (Roche Diagnostics, Mannheim, Germany).DGGE fingerprints were scored manually by the presence or

absence of DNA bands. Pattern similarities were calculated using the

Dice coefficient Cs=2j(a + b)1, where j is the number of bands

common to samples A and B, and a and b are the total numbers of

bands in samples A and B, respectively. This index ranges from 0 (no

common bands)to 1 (100% similarity of band patterns)(Murrayet al.,

1996). In all experiments the main entrance point of public drinking

water at the food company facilities was used as reference for

population shifts within the downstream drinking water facilities.

Intensively stained bands were excised from DGGE and the gel slices

were equilibrated in 15 l sterile water over night at room

temperature. The DNA extract was re-amplified by PCR and subjected

to a DGGE again to verify the purity of the PCR re-amplification

product. PCR products were purified with the ExoSap kit (usb,

Staufen, Germany), the sequence reaction wasdone with theBigDye

Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems), and the

sequence detectionwas accomplished using the ABI Prism 310 genetic

analyser (Applied Biosystems) according to the manufacturer's

protocol. Bacteria identification was achieved by comparing the

nucleic acid sequences with GenBank sequences using the BLAST

program (http://www.ncbi.nlm.nih.gov).

2.5. Real-time PCR for specific pathogen detection

TaqMan primers and FAM/TAMRA probes were provided by Sigma

Aldrich Chemie (Taufkirchen, Germany) and Biomers.net (Ulm,

Germany). Sequences are listed in Table 2. Quantitative real-time

PCR was accomplished by amplifying aliquots of 10 l template in

25 l reaction volumes containing 300 nM of each primer, 200 nMFAM/TAMRA-labelled probe, and 12.5 l TaqMan Universal Master

Mix (Applied Biosystems). Duplicates or triplicates of each sample

were run. Sterile water was used as No Template Control (NTC). The

temperature profile was standardised for all detection systems and

comprised 2 min at 50 C, 10 min at 95 C, 45 cycles of 15 s at 95 C

and 1 min at 60 C. Results were analysed with the ABI Prism 7000

SDS software 1.1 (Applied Biosystems).

To determine the sensitivity of the different specific detection

systems, serial dilutions of the DNA from the reference strains were

applied. Average Ct valueswere calculatedfromtriplicatesor duplicates.

The amounts of bacteria used for measuring standard parameters were

calculated from their genome sizes (Suess et al., 2006). To calculate thefinal amounts of bacteria in the samples, the initial volume of each

sample was considered. This calculation is based on the assumption of

the average weight of a base pair (bp) being 650 Da. This means that

1 mol of a bpweighs650 g and that the molecular weightof any double-

stranded DNA template can be estimated by multiplying its length (in

bp) by 650. The inverse of the molecular weight is the number of moles

of template present in 1 g of material. Using the Avogadro number

6.0021023 molecules/mol, the number of molecules of the template

per gram can be calculated as:

mol=g molecules=mol = molecules=g:

Finally, the number of bacteria or number of copies of template in

the sample can be estimated by multiplying by 1109 for conversion

to ng and then multiplying by the amount of template (in ng). The

genome sizes are listed in Fogel et al. (1999).

3. Results

3.1. Protocol developed for drinking water surveillance

The strategy developed for the molecular biology detection of

pathogens in drinking water and subsequent identification of poten-

tially critical control points at the food companies is shown in Fig. 1.

Selection of the sampling points together with the person responsible

for quality control at the food company was of great importance. Water

samples have to be taken strategically at those points, where the water

might endanger food hygiene. Due to the low amounts of bacteria

expected to be present in drinking water, the samples had to besubjected to filtration. During filtration, PCR inhibitors might be

enriched and subsequently interfere with the PCR methods. When no

DNA amplification was observed after the eubacterial 16S rDNA PCR

Table 2

TaqMan primers and FAM/TAMRA probes used for real-time PCR assays.

Primers and

probes

Sequences

(53)

Microorganism Gene Gene function Product size

(bp)

Literature

source

hlyQF CATGGCACCACCAGCATCT Listeria monocytogenes hly Hemolysin 64 Rodrguez-Lzaro

et al. (2004)hlyQR ATCCGCGTGTTTCTTTTCGA

hlyQP FAM-CGCCTGCAAGTCCTAAGACGCCA-TAMRA

Ecst784F AGAAATTCCAAACGAACTTG Enterococcus sp. 23S rDNA 92 Frahm et al. (1998)

Enc854R CAGTGCTCTACCTCCATCATTGpl813TQ FAM- TGGTTCTCTCCGAAATAGCTTTAGGGCTA-TAMRA

Pa23F TCCAAGTTTAAGGTGGTAGGCTG Pseudomonas aeruginosa 23S rDNA 93 Volkmann et al. (2007)

Pa23Rb ACCACTTCGTCATCTAAAAGACGAC

Pa23P FAM-AGGTAAATCCGGGGTTTCAAGGCC-TAMRA

VS1F ATTAGGTCTTAATACTAAAGATCAGCAAGGT Campylobacter jejuni VS Variable sequence 115 This worka

VS1R CGTCCTTTGTCTTATGGTTTGAATT

VS1P FAM-TGGCGTATTTGATGAATGTTT-TAMRA

mycF2 AATGACGGTTACGGAGGTGGT Mycobacterium avium

subsp paratuberculosis

IS90 0 Insert ion

sequenceIS900-like

transposase

76 Cook and Britt (2007)

mycR2 GCAGTAATGGTCGGCCTTACC

mycP FAM-TCCACGCCCGCCCAGACAGGTTG-TAMRA

InvA139 F GTGAAATAATCGCCACGTCGGGCAA Salmonella spp. invA Membrane

spanning protein

284 Malorny et al. (2001)

and Hein et al. (2006)InvA141 R TCATCGCACCGTCAAAGGAACC

InvAP FAM-TTATTGGCGATAGCCTGGCGGTGGGTTTTGT TG-TAMRA

ECOuidAF GTGTGATATCTACCCGCTTCGC Escherichia coli uidA Gl ucuronidase 87 Frahm and Obst

(2003)ECOuidAR AGAACGGTTTGTGGTTAATCAGGA

ECOuidAP FAM-TCGGCATCCGGTCAGTGGCAGT-TAMRA

a

Designed by Dr. H. Volkmann.

S149J. Varela Villarreal et al. / International Journal of Food Microbiology 141 (2010) S147S155
http://www.ncbi.nlm.nih.gov/http://www.ncbi.nlm.nih.gov/


4/9

(Fig. 2, panel A), a PCR efficiency assay was carried out. A known

quantity of enterococcal genomic DNAwas added to the samples before

this PCR. An inhibition was indicated clearly by the absence of an

amplificationproduct (Fig. 2, panel B). PCRinhibitors were notremoved

from the samples with BSA only (results not shown). When the samples

were treated with PVPP, weak PCR products were observed ( Fig. 2,

panel C). To confirm that the intensity of these bands corresponded to a

low DNA concentration in the samples and not to the presence of PCR

inhibitors, a PCR effi

ciency assay was performed again. The bandsobserved after this PCR efficiency assay (Fig. 2, panel D) exhibited the

same or even higher intensities than the added genomic DNA ( Fig. 2,

lane P), indicating that no PCR inhibitors were present in the water

samples after the PVPP treatment.

3.2. Detection of pathogens using real-time PCR assays

Real-time PCR assays were developed or optimised to detect

bacteria in drinking water, which are hygienically relevant to food

industry. Real-time PCR primers and probes that target specific

virulence or taxon-specific genes are listed in Table 2. Genomic DNA

dilutions were used instead of bacterial suspensions for sensitivity

assays due to the retarded growth of some bacterial species, such as

M. avium subsp.paratuberculosis. Thesensitivities of the real-timePCR

assays shown in Table 3 were obtained when the standard curves

were done, after amplifying genomic DNA serial dilutions of each

target bacteria. Average Ct values were calculated from triple

reactions. Considering that the DNA of the samples would be detected

by real-time PCR in a volume of 10 l template and that the bacteria

present in this template would be concentrated 10000 times by

filtration of the original water sample, the detection limits calculated

Fig. 1. Final protocol used for molecular biology detection of pathogens in drinking water.

Fig. 2. PCR efficiency assay. Lanes 15 correspond to the Spanish dry cured ham

company's water sampling points. 10 l of the respective 16S rDNA amplicons was

separated in 1% agarose gel (amplicon size: 566 bp). Panel A, original water templates;

panel B, original water templates spiked with enterococcal genomic DNA; panel C,

original water templates afterPVPP treatment;panel D, original watertemplates spiked

with enterococcal genomic DNA after PVPP treatment. N: negative template control,

P: positive control, and M: 100 bp DNA marker.



5/9

for E. faecium, S. enterica, and P. aeruginosa were similar to those of the

standard plating methods (1 cell/100 ml). The real-time PCR detec-

tion limits calculated for C. jejuni, L. monocytogenes, and E. coli were 2

to 4 cells/100 ml. In the case of M. avium subsp. paratuberculosis, the

real-time PCR detection limit was 1090 cell/100 ml.

The equations of the standard curve of each pathogen given in

Fig. 3 were estimated by linear regression. These equations were

used to determine the bacterial concentration present in the water

samples from their genome sizes, as described previously. High PCR

efficiencies were obtained for these assays (Fig. 3) The correlation

coefficients (between 0.9958 and 0.9995) showed a high precision of

the assays and a strong correlation between template DNA concen-

trations andCt values. Theseparameters indicatedthat they areuseful

for quantitative measurements. In the case of M. avium subsp.

paratuberculosis, the standard curve reflected a high correlation

coefficient, but the calculated detection limit minimised the applica-

tion of this assay.

False-positive results were obtained by real-time PCR using the

uidA gene targeting E. coli. The commonly used polymerase appeared

to be a contamination source ofE. coli DNA, because this enzyme was

expressed as a recombinant protein in E. coli (Shannon et al., 2007).In

order to avoid this, the real-time PCR used for the detection ofE. coli

was done with the TaqMan Gene Expression Master Mix (Applied

Biosystems). This kit uses the AmpliTaq Gold DNA Polymerase Ultra

Pure enzyme that is identicalto theAmpliTaqGold DNAPolymerase,but further purified to reduce bacterial DNA introduced from the host

organism. The purification process ensures that non-specific, false-

positive DNA products due to bacterial DNA contamination are

minimised during PCR (protocol AmpliTaq Gold DNA Polymerase

Ultra Pure enzyme, Applied Biosystems).

3.3. German dairy company

The German dairy company was supplied with conditioned

groundwater exclusively and no further disinfection was performed

onsite. Thepipelinesystemwas made of stainlesssteel,hoseswere used

at sampling points 3 (portioner) and 2 (lactic acid tank), and warm

water was used at points 2 (lactic acid tank) and 4 (hand washbasin).

The drinking water at the entrance point met all requirements of theGerman drinking water regulations. None of the indicated pathogenic

bacteria was detected after filtering 100 ml of each water sample and

carrying out the plating methods on the specific selective media. In

somecases, unspecific bacterialgrowthwas observed on agar plates,but

these colonies were identified as false-positive isolates after sequencing

of 16S ribosomal DNA.

No PCR inhibition wasdetected after performing thePCR efficiency

assay, as already described above. Real-time PCR results of the first

sampling period are shown in Table 4. The sample from point 2 (lactic

acid tank), where hoses were involved in the process, was the only

sample that exhibited positive results for P. aeruginosa and entero-

cocci after real-time PCR analysis. An average Ct value of 33.21 was

foundfor P. aeruginosa. By transpolatingthis value to thestandard curve,

a value of 2.45 fg P. aeruginosa DNA per l was obtained. Knowing that

one P. aeruginosa bacterial cell DNA weighs 3.99 fg, that 10 l template

was used for the real-time PCR, and that the bacteria present in the

sample were concentrated by a factor of 2000 by filtration, the

calculated number ofP. aeruginosa for this sample was 31 cells/100 ml

water sample. Enterococci-specific positive signals at this point were

also detected, but the values were lower as the calculated detection

limits and reached an average Ct value of 37.91. Noneof theother water

samples taken at this company exhibited positive real-time PCR results

for any of the specifi

c targeted pathogens (Table 4).Some hygienic recommendations, such as a more frequent

exchange of hoses, were made before the second sampling period.

During this period, higher volumes were filtered in order to achieve

detection limits similar to those of the standard plating techniques.

Monitoring of pathogens during the second sampling period did not

produce any positive results, no matter whether traditional plating

methods or culture-independent methods were applied.

Analysis of the autochthonous bacterial population of water

samples during the first sampling period (Fig. 4) revealed a total

number of 9 DGGE DNA bands in the reference sample (Fig. 4, lane 1).

Each DNA band was assumed to represent one bacteria species. In the

subsequent samples the number of bands did not differ or increased

only slightly by 1 to 3 bands when compared to the reference sample.

Using the above Dice coefficients, only sampling point 6 (feta

packaging) was found to exhibit a decreased similarity value of 30%.

All the other points presented high bacterial population similarities

ranging from 44 to 60%. Consequently, point 6 was considered a

potentially critical point.

A total number of 13 bands were sliced from the DGGE gel for

sequencing. Most of these bacteria were - or -Proteobacteria. None

of the targeted pathogens were identified by sequencing, but some

opportunistic bacteria as Sphingomonas and Acinetobacter were

aligned (Table 5).

Although one potentially critical point was identified after analysing

the autochthonous bacterial population, no technical problems or

irregular operation during food production were encountered during

the evaluation. When the bacterial populations of the water samples

during the second sampling period were analysed, the similarity values

between the different sampling points and the reference point werebetween 53 and 86%. No sampling point presented a similarity value

below 40%.

3.4. Spanish dry cured ham company

The water supplied by theSpanish publicdistribution network was

chlorine-treated conditioned groundwater having a residual chlorine

content of 0.4 mg/l. No additional treatmentwas done at thecompany.

It wasnot possible to apply traditional plating methods due to thelack

of equipmentat thesampling place.The water samples werefiltered in

Spain and then transported to Germany, where culture-independent

methods exclusively were applied for their analysis. Initially, no DNA

amplification was observed but, as explained above, this changed

when the samples were treated with PVPP (Fig. 2).Real-time PCR results are shown in Table 4. Some weak positive

signals became obvious after P. aeruginosa-specific real-time PCR

analysis. At points 2 (salt wash-off), 3 (hand washbasin of bone

removal room), and 5 (handwashbasin of packagingroom), average Ct

values of 38.27, 37.21, and 39.05 were obtained. All these values were

close to the detectionlimit of the real-timePCR detectionsystem.None

of the other water samples of this company showed positive real-time

PCR results for any of the specific targeted pathogens (Table 4).

A total number of 7 DGGE DNA bands were observed in the

reference sample (point 1) when the autochthonous bacterial

population of the water samples was analysed. The downstream

water samples exhibited 5 to 9 bands. When comparing the bacterial

populations of the water sample and the incoming water using the

already described Dice coefficient, no significant difference was found.

Table 3

Detection limits of real-time PCR systems.

Bacteria Target gene Genome size

(kb)

Detection limit

(cell/100 ml)a

Enterococcus faecium 23S rDNA 555 1

Salmonella enterica invA 4746 1

Campylobacter jejuni VS1 765 4

M. avium subsp paratuberculosis IS900 5838 1090

Listeria monocytogenes hly 3150 3

Pseudomonas aeruginosa 23S rDNA 1637 1Escherichia coli uidA 4639 2

a Detection limits were calculated according to the final protocol.



6/9

The similarities of the samples with the reference sample were quite

high. They ranged between 63% and 77%, indicating a biological

stability of the analysed water samples.

11 DNAbandswere slicedfrom theDGGE gelfor sequencing. Most of

thesequenced DNAfragments belonged to the-Proteobacteria subclass

and were mostly aligned with uncultured bacteria. Non-pathogenic

Bacillus sp. and some opportunistic bacteria, as Sphingomonas sp.,

Enterobacter sp., and, Pseudomonas sp. were also identified after

sequencing the DNA of DGGE bands. Hence, the presence of Pseudomo-

nas found by the previous real-time PCR was confirmed.

Although some positive pathogenic bacteria results were seen

after the use of culture-independent methods, it was not possible to

distinguish DNA from live or dead cells.

4. Discussion

Molecular biology techniques have been used for several years for

the examination of water for multiple purposes (Frahm et al., 1998;

Frahm and Obst, 2003; Grobe et al., 2001; Schwartz et al., 1998, 2003).

The work reported here was focused on the testing and optimisation

Fig. 3. Real-time PCR standard analysis curves. Serial dilutions of reference strain genomic DNA were used as template. Cycle threshold values (Ct) are plotted against log 10 copies of

bacterial DNA. Linear regression, PCR efficiency (E) and regression coefficients (R2) for each bacterial detection system are shown. (A) Campylobacter jejuni, (B) Escherichia coli,(C) Enterococcus faecium, (D) Listeria monocytogenes, (E) Mycobacterium avium subsp. paratuberculosis, (F) Pseudomonas aeruginosa, and (G) Salmonella enterica subsp. enterica. In

parallel, sterile water was used for NTCs.



7/9

of culture-independent techniques to analyse the bacterial drinking

water quality at two food companies. According to theDrinkingWater

Directive 98/83/EC (EU, 1998) of the European Union, indicator

microorganisms should be routinely monitored in drinking water in

order to control microbial water quality of public distribution systems.

The German Drinking Water Ordinance (TrinkwV 2001) and the

Spanish Drinking Water Guidelines (Real Decreto 140/2003, 2003)

based on the above EU directive stipulate that no E. coli, enterococci,

and coliform bacteria should be present in 100 ml drinking water of

public distribution systems. The standard detection method described

in these guidelines is the conventional plating on defined media. It is

commonly accepted that culture-dependent methods do not reflect

the different physiological states of bacteria that influence their

culturability (Oliver, 2000). Consequently, culture-independent

methods were applied as an alternative approach to monitor the

most important food-borne pathogens in drinking water. DNA

fingerprinting was used to characterise the autochthonous bacterial

population of drinking water at the food companies. Nowadays, the

use of molecular biology methods in routine drinking water

surveillance is still limited, as these new methods have not yet been

accepted by the authorities. According to the EU guidelines (EU,

1998), such methods can be used for the monitoring of indicator

bacteria only when it can be demonstrated that the results obtained

are at least as reliable as those produced by the specified methods.

Hence, the detection limits of the assays play a critical role for

bacterial quantification in drinking water samples. The detection limits

of the real-time PCR systems were not always optimal to reach the

parameters established by the water authorities, especially those

obtained for the detection of M. avium subsp. paratuberculosis. Inorder to reach detection limits of at least 1 bacterium per 100 ml

without an additional enrichment step, a protocol with higher sample

filtration volumes was developed. In the case of M. avium subsp.

paratuberculosis, even higher bacterial concentration rates should be

achieved.

No pathogenic bacteria were cultivated from the water samples

using standard plating methods. However, some positive results were

obtained by using culture-independent techniques. This could be due

to the higher sensitivity of PCR that leads to a greater number of

Table 4

Conventional plating and real-time PCR results of water samples of the German dairy company ( first sampling period) and the Spanish dry cured ham company. Duplicates or

triplicates of each sample were run.

Sampling point German dairy company Spanish dry cured ham company

1 2 3 4 5 6 1 2 3 4 5

Plating methods Negative for all pathogens Not determined

Real-time PCR

Enterococcus spp. +a

Salmonella spp.

Campylobacter jejuni

M. avium subsp. paratuberculosis

Listeria monocytogenes

Pseudomonas aeruginosa +a +a +a +a

Escherichia coli

a Positive results are described in more detail in the text.

Fig. 4. DGGE DNAfingerprintsof 16SrDNA ampliconsfrom the German dairycompany's

water samples (first sampling period). Lanes 1 to 6 correspond to the sampling

points named in Table 1, the numbers on the gel correspond to the sequenced DNA

bands (see Table 5), andthe numbers at the bottomare the total DNA bands of the lane.

Table 5

Identification of bacteria in water samples from the German dairy company (first

sampling period) after sequencing the DNA bands excised from the DGGE gel shown in

Fig. 4. Numbers correspond to the respective DNA bands.

Bacterium Proteobacteria

subclass

Max. ident.

(%)

Accession

number

1. Rhodoferax sp. 100 AY788965.1

2. Acidovorax 99 DQ153906.1

3. Uncultured bacteria 99 DQ409991.1

4. Uncultured bacteria 98 DQ664220.1

5. Caulobacter crescentis 98 AE005673.1

6. Aquabacterium 98 EF651436.1


8. Sphingomonas 95 AY026948.1

9. Acinetobacter 98 EF570077.2


11. Meiothermus 94 AY845055.1





8/9

positive results in comparison to conventional plating methods,

which was also described by Sachse and Frey (2003). It is also well-

known that culture-independent techniques based on the analysis of

the DNA present in the samples cannot distinguish among viable,

viable but not culturable (VBNC), injured, and dead cells. VBNC or

injured bacteria fail to grow on the routine bacteriological media, but

arealiveand metabolicallyactive (Oliver, 2000). False negative results

might be obtained when traditional plating methods are used. About

60 bacterial species have been already described to enter the VBNCstate. Among these are some relevant food-borne pathogens, e.g.

enterococci, C. jejuni, Salmonella spp., Helicobacter pylori, Klebsiella

spp., L. monocytogenes, and E. coli (including EHEC) (Oliver, 2005).

Therefore, the detection of bacteria, including VBNC bacteria, in food

industry's drinking water is essential to ensure the microbiological

safety of food. Although positive DNA-based results do not reflect the

presence of exclusively live bacteria, they give hints of possible

irregular operations that might support the transfer of pathogen

targets.

New techniques based on the use of propidium monoazide (PMA)

(Nocker et al., 2007; Rieder et al., 2008), ethidium monoazide

(Delgado-Viscogliosi et al., 2009) or DNase I (Nogva et al., 2000) are

available and need to be optimised to distinguish the different

metabolic states of such bacteria in drinking water. Another critical

point that should be considered when using molecular biology

techniques is the possible presence of PCR inhibitors. Organic

substances like humic acids and other PCR inhibitors are often

present in surface waters(Wilson, 1997). Such substances were found

in the water samples taken at the Spanish dry cured ham company.

The use of PVPP as mentioned by Sutlovic et al. (2007) and Gusbeth

et al. (2009) successfully removed the PCR inhibitors in this work.

Characterisation of the bacterialpopulations of watersamples is an

innovative approach to demonstrate the biological stability of water

in an industrial process. Previous studies revealed that Dice

coefficients between 0.40 and 1 (i.e. between 40 and 100% similarity)

reflected a natural range of population diversity in a drinking water

distribution system (Emtiazi et al., 2004). Hence, similarities below

40% are discussed to indicate a population shift in the autochthonous

bacterial population of drinking water systems. Only one point (fetapackaging) during the German dairy company's first sampling period

had a lower similarity when compared to the reference point,

indicating that something was affecting the natural microbiological

population of water. The similarity values between the different

sampling points and the reference point observed during the second

sampling period after implementing the hygienic recommendations

were high, which demonstrated that the PCR-DGGE method was

adequate for the evaluation of drinking water bacterial stability in

food industry.

The quality of the supplied drinking water is of significant

importance for a good hygienic practice in downstream process lines.

Therefore, information from raw water quality is needed in concern of

potential contaminations with hygienically relevant bacteria (WHO,

2004b). Groundwater and surface water are frequently conditioned inGermany and many other countries. Usually, groundwater is supposed

to have a better biological quality than surface water, but some

waterborne diseases have also been transmitted by contaminated

groundwater (Craun, 1985; Scandura and Sobsey, 1997; Ritter et al.,

2002). Data about the drinking water conditioning at the waterworks is

essential for the estimation of the biological stability of the drinking

water during its distribution. Disinfection measures are mostly

important to inactivate microorganisms. Depending on the drinking

water character, sustainability of the disinfection measure is impaired.

Chemical (chlorine, chlorine dioxide, and ozone) disinfection and UV

irradiation are the most frequently used disinfection techniques at

European waterworks. It has been demonstrated that these treatments

have various disinfection efficiencies (WHO, 2004b). Some hygienically

relevant bacteria, such as Pseudomonas spp., are well-known to have a

high capability to survive in chlorinated water and to form biofilms

(Grobe et al., 2001; Leclerc et al., 2002). It was demonstrated recently

that a specific DNA dark repair mechanism ofP. aeruginosa was induced

at UV exposuresof 400 J/m2, which corresponds to theGerman standard

for UV disinfection (Jungfer et al., 2007).

Drinking watersuppliers control drinking water production and its

municipal distribution systems (WHO, 2004a), but not the drinking

water distributionin food industry.However,it is importantto control

drinking water facilities in food industry to avoid irregular operations(inadequate pipeline or connection materials, water stagnation,

softening, pipe corrosion, etc.) that might influence bacterial growth

or re-growth (WHO, 2004b, 2006, 2008). Furthermore, irregular

operations may result in an increased biofilm formation. Biofilms are

potential habitats of all kinds of bacteria, including pathogens(Emtiazi

et al., 2004; Lehtola et al., 2004; Schwartz et al., 1998, 2003 ) and may

be responsible for contaminations of bulk water systems. Old pipes in

combination with increased water hardness values may result in pipe

incrustations that are also known to support undesired biofilm

formation (WHO, 2004b, 2006). This might be the reason for the

presence ofP. aeruginosa at the Spanish company, where the pipelines

were 20 years old. The useof accessoryfacilities like hoses forcleaning

processes could be responsible for cross-contaminations during food

production. Such hoses should be exchanged regularly, especially

when warm water is used, since warm water systems support the

growth of hygienically relevant bacteria, such as E. coli, P. aeruginosa,

Aeromonas sp, Legionella spp.(Legnani et al., 1999; Leclerc et al., 2002).

Our extended investigations of the two food companies demon-

strated that they met the drinking water standards. The culture-

independent techniques used cannot distinguish among viable, viable

but notculturable,injured,and dead cells. Still,such techniques canbe

used to identify critical control points in all stages of food production

where water is involved.

Acknowledgments

The authors are grateful for the assistance of Johannes Knoll and

for the helpful discussions of Christina Jungfer and Jacqueline S.This study was supported by the European Commission within the EU

6th Framework Program, the PathogenCombat Project, and by

Forschungszentrum Karlsruhe GmbH. L. monocytogenes DNA was

kindly provided by the Max Rubner Institute, Karlsruhe. Special

thanks to Jordi Rovira and his team (Burgos University, Burgos, Spain)

for the assistance in sampling in Spain. Cooperation of the German

and Spanish food companies is also gratefully acknowledged.

References

Allen, M.J., Edberg, S.C., Reasoner, D.J., 2004. Heterotrophic plate count bacteria whatis their significance in drinking water? International Journal of Food Microbiology92, 265274.

Casani, S., Knochel, S., 2002. Application of HACCP to water reuse in the food industry.Food Control 13, 315327.

Cook, K.L., Britt, J.S., 2007. Optimization of methods for detecting Mycobacterium aviumsubspparatuberculosis in environmental samples using quantitative, real-time PCR.

Journal of Microbiological Methods 69, 154160.Craun, G., 1985. A summary of waterborne illness transmitted through contaminated

groundwater. Journal of Environmental Health 48, 122127.Delgado-Viscogliosi, P., Solignac, L., Dellatre, J.-M., 2009. Viability PCR, a culture-

independent method for rapid and selective quantification of viable Legionellapneumophila cells in environmental water samples. Applied and EnvironmentalMicrobiology 75 (11), 35023512.

Emtiazi, F., Schwartz, T., Marten, S.-M., Krolla-Sidenstein, P., Obst, U., 2004.Investigation of natural biofilms formed during the production of drinking waterfrom surface water embankment filtration. Water Research 38, 11971206.

EU, 1998. European Union. Council Directive 98/83/EC of 3 November 1998 relating tothe quality of water intended for human consumption. Official Journal of theEuropean Communities L 330, 3254.

EU, 2005. European Union. Guidance Document. Implementation of procedures basedon the HACCP principles, and facilitation of the implementation of the HACCP

principles in certain food businesses. Brussels.



9/9

FAO/WHO, 2006. Food and Agriculture Organisation/World Health Organisation.Guidance to governments on the application of HACCP in small and/or less-developed food businesses. FAO food and nutrition paper 86. ISSN 0254-4725.

Fogel, G.B., Collins, C.R., Li, J., Brunk, C.F., 1999. Prokaryotic genome size and SSU rDNAcopy number: estimation of microbial relative abundance froma mixedpopulation.Microbial Ecology 38, 93113.

Frahm, E., Obst, U., 2003. Application of the flourogenic probe technique (TaqMan PCR)to the detection of Enterococcus spp. and Escherichia coli in water samples. Journalof Microbiological Methods 52, 123131.

Frahm, E., Heiber, I.,Hoffman, S., Koob, C.,Meier, H., Ludwig, W.,Amann,R., Schleifer, K.H.,Obst, U., 1998. Application of 23S rDNA-targeted oligonucleotide probes specific for

enterococci to water hygiene control. Systematic and Applied Microbiology 21,450453.Green, S.J., Minz, G., 2005. Suicide polymerase endonuclease restriction, a novel

technique for enhancing PCR amplification of minor DNA templates. Applied andEnvironmental Microbiology 71, 47214727.

Grobe, S., Wingender, J., Flemming, H.C., 2001. Capability of mucoid Pseudomonasaeruginosa to survive in chlorinated water. International Journal of Hygiene andEnvironmental Health 204, 139142.

Gusbeth, C., Frey, W., Volkmann, H., Schwartz, T., Bluhm, H., 2009. Pulsed electric fieldtreatment for bacteria reduction and its impact in hospital wastewater. Chemo-sphere 75 (2), 228233.

Hein, I., Flekna, G., Krassnig, M., Wagner, M., 2006. Real-Time PCR for the detection ofSalmonella spp. in food: an alternative approach to a conventional PCR systemsuggested by the FOOD-PCR project. Journal of Microbiological Methods 66,538547.

Jungfer, C., Schwartz, T., Obst, U., 2007. U V-induced dark repair mechanisms in bacteriaassociated with drinking water. Water Research 41 (1), 188196.

Kreader, C.A.,1996. Reliefof amplification inhibition in PCR with bovineserum albuminor T4 Gene 32 Protein. Applied and Environmental Microbiology 62, 11021106.

Leclerc, H., 2003. Relationships between common water bacteria and pathogens indrinking water. In: Bartram, J., Cotruvo, J., Exner, M., Fricker, C., Glasmacher, A.(Eds.), Heterotrophic Plate Counts and Drinking Water Safety: The Significance ofHPCs for Water Quality and Human Health. : WHO Emerging Issues in Water andInfectious Disease Series, Chapter 6. IWA Publishing, London.

Leclerc, H., Schwartzbrod, L., Dei-Cas, E., 2002. Microbial agents associated withwaterborne diseases. Critical Reviews in Microbiology 28 (4), 371409.

Legnani, P., Rapuano, S., Turin, D., Valenti, C.,1999. Survival andgrowth ofPseudomonasaeruginosa in natural mineral water: a 5-year study. International Journal of FoodMicrobiology 53 (23), 153158.

Lehtola, M.J., Nissinen, T.K., Miettinen, I.T., MArtikainen, P.J., Vartiainen, T., 2004.Removal of soft deposits from the distribution system improves the drinking waterquality. Water Research 38 (3), 601610.

Malorny, B., Bunge, C., Helmuth, R., 2001. Evaluation of Salmonella spp.-specific primersets for the validation within the Food PCR Project. Federal Institute for HealthProtection of Consumers and Veterinary Medicine, National Reference Laboratoryfor Salmonella, Diedersdofer Weg, 1, p. 12277. Berlin, Germany.

Muldrew, K., McGann, L.E., 1994. The osmotic rupture hypothesis of intracellularfreezing injury. Biophysical Journal 66, 532541.

Murray, A.E., Hollibaugh, J.T., Orrego, C., 1996. Phylogenetic compositions ofbacterioplankton from two California estuaries compared by denaturing gradientgel electrophoresis of 16S rDNA fragments. Applied and Environmental Microbi-ology 62, 26762680.

Muyzer, G., De Waal, E., Uiterlinden, A.G., 1993. Profiling of complex microbialpopulations by denaturing gradient gel electrophoresis analysis of polymerasechain reaction-amplified genes coding for 16S rRNA. Applied and EnvironmentalMicrobiology 59 (3), 695700.

Nocker, A., Sossa-Fernandez, P., Burr, M.D., Camper, A.K., 2007. Use of propidiummonoazide for live/dead distinction in microbial ecology. Applied and Environ-mental Microbiology 73 (16), 51115117.

Nogva, H.K., Bergh, A., Holck, A., Rudi, K., 2000. Application of the 5-nuclease PCRassay in evaluation and development of methods for quantitative detection ofCampylobacter jejuni. Applied and Environmental Microbiology 66 (9), 40294036.

Oliver, J.D., 2000. The public health significance of viable but nonculturable bacteria. In:Colwell, R.R., Grimes, D.J. (Eds.), Nonculturable Microorganisms in the Environ-ment. ASM Press, Washington, D.C., pp. 277300.

Oliver, J.D.,2005. Viable but nonculturable bacteria in foodenvironments. In: Fratamico,P.M., Bhunia, A.K., Smith, J.L. (Eds.), Foodborne Pathogens Microbiology andMolecular Biology. Caister Academic Press, Great Britain, p. 99.

Real Decreto 140/2003, 2003. Royal Decree of 7 February, establishment of sanitarycriteria of water quality for human consumption. BOE number 45, pp. 72287245.Spain.

Rieder, A., Schwartz, T., Schn-Hlz, K., Marten, S.-M., S, J., Gusbeth, C., Kohnen, W.,Swoboda, W., Obst, U., Frey, W., 2008. Molecular monitoring of inactivationefficiencies of bacteria during pulsed electricfield treatment of clinical wastewater.

Journal of Applied Microbiology 105 (6), 20352045.Ritter, l., Solomon, K., Sibley, P., Hall, K., Keen, P., Mattu, G., Linton, B., 2002. Sources,

pathways, and relative risks of contaminants in surface water and groundwater: aperspective prepared for the Walkerton inquiry. Journal of Toxicology andEnvironmental Health 65 (1), 1142.

Rodrguez-Lzaro, D., Hernndez, M., Scortti, M., Esteve, T., Vsquez-Boland, J.A.,Pla, M.,2004. Quantitative detection ofListeria monocytogenes and Listeria innocua by real-time PCR: assessment of hly, iap, and lin02483 targets and AmpliFluor Technology.Applied and Environmental Microbiology 70, 13661377.

Sachse, K., Frey, J., 2003. PCR detection of microbial pathogens. In: Sachse, Konrad, Frey,Joachim (Eds.), Methods in Molecular Biology, vol. 216. Humana Press Inc, otowa,NJ, p. 20.

Scandura, J.E., Sobsey, M.D., 1997. Viral and bacterial contamination of groundwaterfrom on-site sewage treatment systems. Water Science and Technology 35 (11),141146.

Schwartz, T., Hoffman, S., Obst, U., 1998. Formation and bacterial composition of young,natural biofilms obtained from public bank-filtered drinking water systems. WaterResearch 32 (9), 27872797.

Schwartz, T., Hoffmann, S., Obst, U., 2003. Formation of natural biofilms during chlorinedioxide and UV disinfection in a public drinking water distribution system. Journalof Applied Microbiology 95, 591601.

Shannon, K.E., Lee, D.Y., Trevors, J.T., Beaudette, L.A., 2007. Application of real-timequantitative PCR for the detection of selected bacterial pathogens during municipalwastewater treatment. Science of the Total Environment 382, 121129.

Suess,J., Schubert,K., Sass, H.,Cypionka, H.,Overmann, J.,Engelen,B., 2006. Widespreaddistribution and high abundance of Rhizobium radiobacter within Mediterraneansubsurface sediments. Environmental Microbiology 8, 17531763.

Sutlovic, D., Gojanovic, M.D., Andelinovic, S., 2007. Rapid extraction of human DNAcontaining humic acid. Croatica Chemica Acta 80, 117120.

Szewzyk, U., Szewzyk, R., Manz, W., Schleifer, K.-H., 2000. Microbiological safety ofdrinking water. Annual Review of Microbiology 54, 81127.

TrinkwV 2001. Trinkwasserverordnung [Drinking Water Ordinance 2001]. Verordnungber die Qualitt von Wasser fr den menschlichen Gebrauch [Ordinance on waterquality for human use]. Germany. http://bundesrecht.juris.de/bundesrecht/trinkwv_2001/gesamt.pdf.

USEPA, 1992. Seminar publication: control of biofilm growth in drinking waterdistribution systems. EPA/625/R-92/001. Office of Research and Development, U.S.Environmental Protection Agency, Washington, DC. http://www.p2pays.org/ref/15/14291.pdf.

Volkmann, H., Schwartz, T., Kirchen, S., Stofer, C., Obst, U., 2007. Evaluation of inhibitionand cross-reaction effects on real-time PCR applied to the total DNA of wastewatersamples for the quantification of bacterial antibiotic resistance genes and taxon-specific targets. Molecular and Cellular Probes 21, 125133.

WHO, 2004a. In: Ainsworth, R. (Ed.), World Health Organization. Safe piped water:managing microbial water quality in piped distribution systems. IWA Publishing,London, UK. ISBN: 1843390396.

WHO, 2004b. In: LeChevallier, M.W., Au, K.K. (Eds.), World Health Organization. Watertreatment and pathogen control: process efficiency in achieving safe drinkingwater. IWA Publishing, London, UK. ISBN: 1 84339069 8.

WHO, 2006. World Health Organization. Health aspects of plumbing. World HealthOrganization and World Plumbing Council, Geneva, Switzerland. ISBN: 978 92 4156318 5.

WHO, 2008. World Health Organization. Guidelines for Drinking Water Quality:incorporating 1st and 2nd addenda. In: Volume 1 Recommendations, Third edition. .ISBN: 978 92 4 154761 1. Geneva, Switzerland.

Wilson, I.G., 1997. Minireview: inhibition and facilitation of nucleic acid amplification.Applied and Environmental Microbiology 63, 37413751.


1. culture-independent techniques applied to food industry water

Documents