1 heidi contreras1, matthew d. liptak4

Mycobacterial Rv0203 transfers heme to MmpL3 and MmpL11

1

The Mycobacterium tuberculosis Secreted Protein, Rv0203, Transfers Heme to Membrane Proteins, Mycobacterial membrane protein Large 3 (MmpL3) and MmpL11

Cedric P. Owens1,3, Nicholas Chim1, Amanda B. Graves4, Christine A. Harmston1, Angelina Iniguez1,

Heidi Contreras1, Matthew D. Liptak4 and Celia W. Goulding1,2*

1Department of Molecular Biology and Biochemistry, 2Department of Pharmaceutical Sciences

University of California, Irvine, Irvine, CA 92697

3Current address: Department of Chemistry and Biochemistry, University of California, San Diego, La Jolla, CA 92093

4Department of Chemistry, University of Vermont, Burlington VT, 05405

Running title: M. tuberculosis Rv0203 transfers heme to MmpL3 and MmpL11

*Corresponding author: Celia Goulding, E-mail: [email protected], Phone: (949) 824 0337, Fax: (949) 824 8551

Keywords: Mycobacterium tuberculosis, iron acquisition, heme transfer Background: A novel Mycobacterium tuberculosis heme acquisition has recently been discovered. Result: The membrane protein MmpL11 is required for efficient heme uptake, and secreted Rv0203 may transfer heme to extracellular domains of both MmpL3 and MmpL11. Conclusion: MmpL3 and MmpL11 are potential heme transporters, whereby heme is transported into the cytosol. Significance: This work enhances our understanding of Mycobacterium tuberculosis heme uptake. SUMMARY

Mycobacterium tuberculosis (Mtb) is the causative agent of tuberculosis (TB), which is becoming an increasingly global public health problem due to the rise of drug resistant strains. While residing in the human host, Mtb needs to acquire iron for its survival. Mtb has two iron uptake mechanisms, one that utilizes non-heme iron and another that taps into the vast host heme-iron pool. To-date, proteins known to be involved in mycobacterial heme uptake are Rv0203, MmpL3 and MmpL11. While Rv0203 transports heme across the bacterial periplasm or scavenges heme from host heme proteins, MmpL3 and MmpL11 are

thought to transport heme across the membrane. In this work, we characterize the heme-binding properties of the predicted extracellular soluble E1 domains of both MmpL3 and MmpL11 utilizing absorption, electron paramagnetic resonance and magnetic circular dichroism spectroscopic methods. Furthermore, we demonstrate that Rv0203 transfers heme to both MmpL3-E1 and MmpL11-E1 domains at a rate faster than passive heme dissociation from Rv0203. This work elucidates a key step in the mycobacterial uptake of heme, and may be useful in the development of anti-TB drugs targeting this pathway.

INTRODUCTION

The human pathogen Mycobacterium tuberculosis (Mtb) 1 , the etiological agent of tuberculosis (TB), continues to be a global health burden (1). The waning drug efficacies due to emerging drug-resistant Mtb strains as well as the synergism with HIV necessitates the development 1 The abbreviations used are: Mtb, Mycobacterium tuberculosis; TB, tuberculosis; MmpL, Mycobacterial membrane Large; RND, Resistance-nodulation-cell Division; E1, first extracellular domain of MmpL3 or MmpL11; ZnMP, zinc mesoporphyrin; Mb, myoglobin; metHB, methemoglobin

http://www.jbc.org/cgi/doi/10.1074/jbc.M113.453076The latest version is at JBC Papers in Press. Published on June 11, 2013 as Manuscript M113.453076

Copyright 2013 by The American Society for Biochemistry and Molecular Biology, Inc.

by guest on April 3, 2018

http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/cgi/doi/10.1074/jbc.M113.453076

http://www.jbc.org/


2

of unique anti-TB therapeutics and thus increased understanding of Mtb biology. To that end, the acquisition of iron, an essential nutrient, represents an important pathway to fully understand.

Heme-iron represents a large portion of the human iron pool (2) and is an important source of iron for bacteria living within a human host. Sophisticated heme uptake pathways have been discovered in both gram-positive and gram-negative bacteria, which mediate host heme acquisition (3-7). Recently, Mtb was discovered to have a heme-uptake pathway (8,9), whereby a siderophore deficient Mtb strain that is unable to acquire non-heme iron, can survive when presented with heme as an alternative iron source. To date, three Mtb proteins have been proposed as part of its heme uptake pathway: the secreted protein Rv0203, and the transmembrane proteins MmpL3 and MmpL11 (Fig. 1A).

The structure of Rv0203 was solved by X-ray crystallography and its heme binding properties determined, suggesting that it acts as an extracellular or periplasmic heme transport protein (9,13). MmpL3 and MmpL11 are members of the Mycobacterial membrane protein Large (MmpL) protein family, which consists of 13 members. The MmpL family itself is a mycobacteria specific subfamily within the diverse Resistance-Nodulation-cell Division (RND) permease superfamily of transmembrane transporters (14), which are known to mediate substrate transport across the membrane of gram-negative bacteria (15-18). Several MmpL proteins have been shown to be necessary for fully virulent Mtb infection in mice. Mice infected with Mtb mutants harboring deletions of MmpL8 and MmpL11 survived significantly longer compared to mice infected with wild type (WT) Mtb (14). More strikingly, MmpL4 and MmpL7 knockout mutants appear to be avirulent (14). Furthermore, MmpL5 and MmpL10 appear to be important in Mtb survival in mice lungs (19). The respective functions of the different MmpL proteins are not well characterized. While RND transporters are typically involved in drug efflux, only MmpL5 and MmpL7 have been shown to be involved in drug efflux (19,20). Additionally, MmpL7 and MmpL8 have been shown to transport the polyketide phthiocerol dimycocerosate and sulfolipid-1 across the bacterial membrane, respectively (21-24) while both MmpL4 and

MmpL5 have recently been reported to play roles in siderophore export (25). Finally, MmpL3 has been implicated in both heme uptake (9) and trehalose monomycolate export (26-28).

MmpL3 is encoded by an essential Mtb gene (9,14) preventing direct investigation of the role of MmpL3 in heme uptake. MmpL3 is the closest homologue to MmpL11 with 24 % amino acid sequence identity, and is located within close genomic vicinity of MmpL11, hinting at a functional relationship. Gene deletion experiments indicate that MmpL11 is involved in Mtb heme uptake. Mtb mutants deficient in both siderophore production and MmpL11 display a significant growth defect when cultured in the presence of heme, suggesting it plays a role in heme-iron uptake and is required for efficient substrate acquisition (9). The topologies of MmpL3 and MmpL11 are predicted to be similar, where both contain two predicted extracellular domains E1 and E2, and one intracellular domain C1 (Fig. 1B). Notably, recombinant E1 and E2 domains from MmpL3 and MmpL11 were shown to bind heme (9), suggesting that both MmpL3 and MmpL11 are transmembrane heme transports. Thus, we hypothesize that the extracellular heme binding protein Rv0203 can directly transfer heme to MmpL3 and MmpL11 extracellular domains, mirroring the mechanisms found in both gram-positive and gram-negative heme uptake systems (7,29-34).

In this work, due to the challenges of producing full-length transmembrane proteins MmpL3 and MmpL11 (Fig. 1B), we undertook a modular approach to further investigate the heme uptake pathway. Preliminary experiments demonstrated rapid heme transfer from Rv0203 to the E1 domains of both MmpL3 and MmpL11; therefore, we embarked on a detailed characterization of their heme transfer mechanisms. Although both E1 domains bind heme with similar spectroscopic properties, their affinities to heme are quite distinct. Furthermore, heme binding to both E1 domains favor domain oligomerization, which leads to a two-step heme binding mechanism. Heme transfer experiments demonstrate that holo-Rv0203 rapidly and efficiently transfers heme to either MmpL11-E1 or MmpL3-E1 domain, suggesting an interaction driven mechanism, providing further evidence that MmpL3 and MmpL11 play a role in heme transport across the


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


3

mycobacterial membrane. Additionally, we use the non-pathogenic and fast-growing model organism Mycobacterium smegmatis, to demonstrate that MmpL11 is required for the efficient uptake of a heme analog. EXPERIMENTAL PROCEDURES

MmpL3-E1 and MmpL11-E1 cloning, expression and purification - DNA sequences of residues 32 – 187 and 41 – 187 from MmpL3 and MmpL11, respectively, were cloned into pET28a (Novagen) encoding a fusion protein of the respective E1-domain with a His(6)-tag using NdeI and HindIII and BamHI and XhoI restriction enzyme sites (Fermentas Scientific) for MmpL3-E1 and MmpL11-E1, respectively. The respective E1 domain was transformed into BL21-Gold (DE3) cells and grown at 37ºC in LB medium containing 30 µg/ml kanamycin. Protein expression was induced when cells reached OD600nm of 0.8 by the addition of 1 mM IPTG and cells harvested after 4 hours by centrifugation at 5100 rpm for 20 minutes, followed by resuspension in 50 mM Tris, pH 7.4, and 350 mM NaCl. Cells were next lysed by sonication after addition of egg hen lysozyme (5 mg, Sigma) with phenylmethylsulfonyl fluoride (40 µM, Sigma) and the cell lysate centrifuged at 14000 rpm for 20 minutes. After addition of 400 µl Proteoblock protease inhibitor cocktail (Fermentas), the supernatant was loaded onto a Ni2+-charged HisTrap column (GE Healthcare) and eluted with a linear imidazole gradient (between 100 – 250 mM imidazole). Fractions containing E1 were identified by SDS-PAGE, pooled and concentrated using a Centricon centrifugal concentrator (Millipore). Further purification of E1 was achieved by running the protein over an S75 gel filtration column (GE Healthcare) equilibrated with 50 mM Tris pH 7.4, 150 mM NaCl, which yielded nearly 100% homogeneous protein. Cleavage of the His(6)-tag was conducted in cleavage buffer (50 mM Tris pH7.4, 150 mM NaCl, 10 mM CaCl2) by adding 1 ml of thrombin-agarose suspension (Sigma) to the protein. After an overnight incubation at 4ºC the thrombin-agarose was removed on a glass frit. Each E1 domain was then run over an S75 gel filtration column equilibrated with 50 mM Tris pH 7.4, 150 mM NaCl to separate E1 from the His(6)-tag.

Reconstitution of the apo-proteins with heme - Approximately 4 mg of heme (hemin, Sigma) were dissolved in 0.4 ml of ice cold 0.1 M NaOH and vortexed periodically. After 30 minutes, 0.4 ml of 1 M Tris, pH 7.4 was added to the solution. The solution was subsequently centrifuged for 10 minutes at 4ºC at 13000 rpm. The heme solution was then diluted with chilled 50 mM Tris, pH 7.4, 150 mM NaCl and centrifuged again at 5100 rpm to remove any heme aggregates. Final concentrations were determined using ε385 = 58.44 mM-1cm-1 (35). Heme solutions were used within 12 hours.

For spectroscopy and kinetics purposes, apo-protein was fully reconstituted by slowly adding heme to the respective E1 domains in small increments to a 1.5-fold molar excess. After an overnight incubation at 4ºC excess heme was removed using an S200 gel filtration column (GE Healthcare) or a desalting column (GE Healthcare) and the protein collected in 1 ml fractions. Protein concentrations were measured using the modified Lowry assay (Pierce). The extinction coefficient for the Soret peak for both E1 domains was determined to be equal to 60 mM-1cm-1 by the pyridine hemochromagen assay (36) and used for hemoprotein concentration determination.

To determine the oligomerization state of the respective E1 domains, heme was incrementally added to the protein to the molar ratio indicated in the text and incubated overnight at 4ºC. The heme-loaded E1 domains were run on an S200 gel filtration column (GE healthcare) and their respective molecular weights calculated using molecular weight standards (BioRad).

Spectroscopic measurements - All absorption spectra were recorded at room temperature on a Beckman DU800 spectrophotometer using cells with 1 cm pathlength, except for heme titration measurements, which were recorded on a Varian Cary 3E dual beam spectrophotometer.

Electron paramagnetic resonance spectra were taken in house on a Bruker EMX500 spectrometer fitted with a Bruker ER041x microwave bridge and an Oxford Instruments continuous flow liquid He cryostat. The temperature was maintained at 4.5 K and monitored using an Oxford iTC503S temperature control unit. The magnetic field frequency was calibrated using a 2,2-diphenyl-1-picrylhydrazyl standard (g=2.0036).


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


4

Far-UV circular dichroism (CD) spectra were recorded at 4°C on a Jasco J-715 spectropolarimeter using 0.1 cm pathlength cells. The bandwidth was set to 2 nm, the response time was equal to 8 s, scanning speed was 10 nm/min and data pitch was 0.5 nm.

Magnetic circular dichroism (MCD) samples were prepared by exchanging fully reconstituted holoprotein samples into 50 mM potassium phosphate buffer pH 7.4 with 150 mM NaCl. The solutions were concentrated in Amicon stirred cells (Millipore) and then combined in a 60:40 (v/v) mixture of glycerol and protein solution. The samples were loaded into custom build sample cells and flash frozen. MCD spectra were recorded on a home-built MCD setup consisting of a Jasco J-815 CD spectrometer with an Oxford SM4000-8T Spectromag, controlled by a Mercury iTC temperature controller and a Mercury iPS power supply. Data was collected between 900 and 300 nm with a bandwidth of 1 nm, an integration time of 0.25 seconds, a data pitch of 0.5 nm, and a scan speed of 200 nm/min.

On- and off- rate measurements - The on-rates from MmpL3-E1 and MmpL11-E1 were measured anaerobically using ferrous-CO heme (2 µM for MmpL3-E1 and 1 µM for MmpL11-E1) binding to the respective E1 domain using previously described methods (13,37). The off-rate was measured using the apo-H64Y/V68F-myoglobin (Mb) assay described previously (13,38).

Ferric heme binding experiments - To measure ferric heme binding, varying molar excess amounts of apo-E1 were mixed with ferric heme (5 µM) in a SX.18MV stopped flow spectrophotometer (Applied Photophysics) by rapid, equal volume mixing at room temperature. Spectra were recorded between 260 nm and 700 nm and the resulting time-courses at 410 nm and 372 nm were fitted to single exponential functions using Graphpad Prism, as described in the results section.

Pull-down assay - All procedures described in this section were done in 20 mM PBS pH 7.4, 150 mM NaCl. Rv0203 was biotinylated in a 1:1 protein:biotin ratio using the Pierce biotinylation kit according to manufacturer’s directions. Heme was subsequently added to biotinylated apo-Rv0203 as described above. The absorption spectrum of biotinylated holo-Rv0203 is identical to that of unbiotinylated holo-Rv0203, which

suggests that the biotin group does not interfere with heme binding.

Holo-Rv0203 (5 µM) was mixed with a 10-fold molar excess apo-E1 in 500 µl reaction volume. After an incubation period, the length of which is described in the results section, 120 µl streptavidin agarose beads (Novagen) were added to the reaction mixture. The beads were incubated for at least 10 minutes before the reaction mixture was placed in a spin filter and spun at 1000 rpm for 5 minutes. The flow-through was collected and the beads subjected to two wash steps with 250 µl buffer. All fractions were run on an SDS-PAGE gel and absorption scans of each fraction recorded. When holo-Rv0203 was incubated with streptavidin agarose beads only, the flow-through contained minimal amounts of heme indicating heme loss from holo-Rv0203 was not due to nonspecific interactions with the agarose beads.

Heme transfer between holo-Rv0203 and E1 domains - In a SX.18MV stopped flow spectrophotometer (Applied Photophysics), 5 µM Rv0203 in an approximately 1:1 complex with heme was mixed with the respective E1 domain at various concentrations, as indicated in the results section, and spectra were recorded between 260 nm and 700 nm. Reverse transfer experiments with holo-MmpL11-E1 and apo-Rv0203 were conducted in a stopped flow device in the same manner as the forward reaction at the protein concentrations indicated in the text. Heme transfer between holo-MmpL3-E1 and apo-Rv0203 was initially monitored by stopped flow, but only a fraction of the heme was transferred within the instrument timerange. Therefore, reverse transfer between holo-MmpL3-E1 and Rv0203 was recorded in a Beckman DU-800 spectrophotometer. Timecourses were fitted to single or double exponential functions using Graphpad Prism as indicated in the text.

Construction of M. smegmatis knockout – The M. smegmatis mutant was constructed as previously described (39). To generate the deletion strain, 800 bp flanking the 5` and 3` M. smegmatis (mc2155 strain) genomic region to be knocked out was amplified by PCR and ligated to the suicide vector, pJSC232, which contains both sacB and kanr cassettes, creating an AflII site at the junction. This vector was then electroporated into electro-competent M. smegmatis cells. Successful transformants were selected by growth on 7H10


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


5

agar containing kanamycin, which were then grown to late log phase in 7H9 media not supplemented with kanamycin. Loss of the plasmid was confirmed by growth on sucrose and kanamycin sensitivity. The deletion was verified by PCR mapping and Southern Blot. Primers used for construction of the deletion strain are listed in Table 1.

Iron depletion and testing of mutant’s growth in various iron supplements - Strains were first grown in LB 0.05% tyloxapol liquid media to late log phase. They were then diluted to 0.1 OD750 in iron-free 7H9 0.05% tyloxapol-NoFe (7H9 without ferric ammonium citrate) and grown again to late log phase. The strains were then passaged again as previously described (7) to deplete intracellular iron, and then inoculated at OD700 of 0.1 into 7H9 0.05% tyloxapol-NoFe media with 1 µM FeCl3, 1 µM heme, or no iron. Cell density was measured over 62 hours. Knock-out mutant strain was complemented with its respective Mtb gene, p-NBV1-mmpL11.

Zinc Mesoporphyrin uptake assay - Zinc mesoporphyrin (ZnMP, Frontier Scientific) was dissolved into 100% DMSO to 1 mM. The resulting solution was filter sterilized before use in cultures.

Strains were grown in LB 0.05% tyloxapol and passaged once into 7H9 0.05% tyloxapol-NoFe as previously described. Each strain was then inoculated into fresh 7H9 0.05% tyloxapol-NoFe and grown to OD of 0.4. At this point, 1 µM ZnMP was added to the cultures and they were further incubated for 1 hour. After incubation, cells were harvested by centrifugation at 3500 rpm for 15 min. The resulting pellets were washed in PBS with 1% BSA. BSA is included to remove any membrane associated ZnMP that could otherwise contaminate cell lysate measurements. The cells were then pelleted again and washed 4 additional times with PBS without BSA to be sure that the cells are washed clear of any contaminating ZnMP. The resulting pellet was resuspended in 200 µl of PBS, and sonicated for 45 seconds. The lysed cells were then centrifuged at 13000 rpm at 4°C. The cytosolic fraction (supernatant) was separated and pelleted cell debris was discarded. The cytosolic fraction was analyzed by fluorimetry using an excitation wavelength of 416 nm, using a slit width of 2.5 nm.

RESULTS

Expression and purification of MmpL3-E1 and MmpL11-E1 - MmpL3-E1 and MmpL11-E1 domains were heterologously expressed and purified from Escherichia coli. The respective E1 domain boundaries were chosen based on in silico domain and transmembane helix predictions (40). Several E1 constructs for both MmpL3 and MmpL11 were generated with varying N- and C-termini and tested for solubility, stability and secondary structure elements. The final MmpL3-E1 and MmpL11-E1 constructs consist of residues 32-187 and 41-187, respectively. A sequence alignment and secondary structure prediction of MmpL3-E1 and MmpL11-E1 is shown in Fig. 2A. Fig. 2B shows an SDS-PAGE of both E1 domains purified to near homogeneity.

Heme reconstitution and absorption spectra of ferric MmpL3-E1 and MmpL11-E1 - Titration experiments suggest that MmpL3-E1 and MmpL11-E1 bind heme in a 1:1 stoichiometry (Fig. 3A&B). These results were confirmed by reconstitution experiments for both MmpL3-E1 and MmpL11-E1. The E1 domains were reconstituted by adding 1.5-fold molar excess heme to the respective proteins. Removal of unbound heme over a desalting column resulted in the formation of a 1:1 heme to protein complex as determined by the pyridine hemochromagen (41) and Lowry assays, which measure the heme and protein concentrations, respectively

The Soret peak maximum of MmpL3-E1 (Fig. 4A) is located at 388 nm, whereas the Soret peak maximum of MmpL11-E1 is 379 nm (Fig. 4A). Both domains feature a charge transfer band near 620 nm, which is characteristic of a high spin heme molecule and shifted compared to that of aqueous heme, which has a charge transfer band at 611 nm. The Soret peaks of MmpL3-E1 and MmpL11-E1 are broad, which may indicate the presence of multiple heme species.

Electron paramagnetic resonance (EPR) spectra of MmpL3-E1 and MmpL11-E1 - The EPR spectra of MmpL3-E1 and MmpL11-E1 are identical (Fig. 5), revealing mixed spin states with a high spin population characterized by g⊥ = 5.99 and g|| = 1.96 and at least two low spin populations characterized by g = 2.92, g = 2.26 and g = 2.04. The high and low spin mixture seen in the E1 domains resemble those of ChaN (42), which also


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


6

exhibits both high and low spin heme populations, although with different low spin g-values. Furthermore, the EPR spectra of MmpL3-E1 and MmpL11-E1 also resemble that of Rhizobium leguminosarum Irr (Rl-Irr), an iron response protein, with heme bound to its low affinity site (43), which has nearly identical high and low spin g-values as the E1 domains.

Magnetic circular dichroism (MCD) spectra of MmpL3-E1 and MmpL11-E1 - The MCD spectra of MmpL3-E1 and MmpL11-E1 at 5 K display very similar spectral features to one another (Fig. 4B), in agreement with the absorption spectra of the two E1 domains (Fig. 4A). The most intense feature in the MCD spectrum of both species is a derivative-shaped feature centered at 410 nm, which corresponds to a shoulder observed in the absorption spectrum of MmpL3-E1. The wavelength and intensity of this feature is consistent with the Soret band of a low-spin heme species (44,45). Absorption spectra were acquired for both MmpL3-E1 and MmpL11-E1 at 20 K (data not shown) using the same samples and instrumental setup as described for MCD spectroscopy and the Soret peak maxima were between 380 and 390 nm, consistent with the presence of a high-spin heme species. Thus, taken together, the absorption (Fig. 4A), EPR (Fig. 5) and MCD (Fig. 4B) data all demonstrate that a mixture of low-spin and high-spin heme is present in both MmpL3-E1 and MmpL11-E1.

Heme promotes protein oligomerization - The oligomeric state of MmpL3-E1 and MmpL11-E1 was investigated using analytical gel filtration chromatography (Fig. 6). Both apo-MmpL11-E1 and apo-MmpL3-E1 are monomeric; addition of increasing molar amounts of heme to both MmpL3-E1 (Fig. 6A) and MmpL11-E1 (Fig. 6B) results in the incremental formation of larger oligomers, with the predicted molecular weight corresponding to either tetramers or pentamers. Of note, after gel filtration heme is not bound to the monomer but exclusively to the oligomeric species for both E1 domains. Moreover, MmpL3-E1 has higher oligomer to monomer ratios compared to MmpL11-E1, at the heme to protein ratios tested (Fig 6C), suggesting that heme binding to MmpL3-E1 is tighter than that to MmpL11-E1, which is further supported by the determination of heme off-rates described below.

Circular dichroism (CD) spectroscopy on MmpL3-E1 and MmpL11-E1 – To ensure heme-induced oligomerization of both E1 domains is not a result of major structural changes, we determined the secondary structure composition for each E1 domains in the absence and presence of heme. The CD spectrum of apo-MmpL3-E1 (Fig. 7A) reveals the α-helix and β-strand content based on the program K2D3 (46) to be 38 % and 12%, respectively, which is in good agreement with the structural prediction (Fig. 2A). Addition of heme to MmpL3-E1 causes both a slight decrease and shift in the absolute spectral minimum from 207.5 nm to 205.5 nm, resulting in a predicted slight decrease of α-helix and increase of β-strand content (34 % and 15 %, respectively), Fig. 7A. In contrast to MmpL3-E1, the CD spectra of apo- and holo-MmpL11-E1 are nearly identical consisting of a mixture of α-helices (34 %) and β-sheets (13 %) (Fig. 7B), also in good agreement with secondary structure prediction. These results demonstrate that heme binding does not induce drastic structural rearrangement of either E1 domain.

Heme off-rates for MmpL3-E1 and MmpL11-E1 - To measure the respective heme binding affinities, the off- and on-rates, koff and kon, of MmpL3-E1 and MmpL11-E1 were determined. The off-rate is highly variable between heme binding proteins, and typically determines the protein’s heme binding affinity. It is measured using the apo-H64Y/V68F-Mb assay (38). Neither E1 domain interacts with Mb and when apo-H64Y/V68F-Mb is present in excess, the rate of heme transfer is dependent exclusively on the rate of heme release, koff.

The experimental data for the Mb-assay of MmpL3-E1 follows biphasic kinetics with the fast phase kf equal to 0.0036 ± 0.0007 s-1 and the slow phase ks equal to 0.0004 ± 0.0001 s-1 (Table 3).

These values are similar to heme dissociation from human methemoglobin (metHb) β and α subunits, respectively (47) (Table 3). MmpL11-E1 features significantly faster monophasic heme dissociation as compared to MmpL3-E1 with koff equal to 0.34 ± 0.02 s-1 (Table 3). These values suggest that MmpL3-E1 binds heme more tightly than MmpL11-E1.

Heme on-rates for MmpL3-E1 and MmpL11-E1 - Heme binding can be described by the two-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


7

step mechanism shown in Scheme 1. The respective E1 domain forms an initial protein-heme complex. The final holo-protein is formed after subsequent structural changes within the heme-binding pocket governed by the rate kcoord. The on-rate was measured by adding increasing amounts of MmpL3-E1 or MmpL11-E1 to ferrous-CO heme. Since ferric heme tends to be dimeric, we used ferrous-CO heme as it is monomeric (52). It has been demonstrated that monomeric heme binding to proteins is usually not affected by the oxidation state of the heme molecule since the on-rate for monomeric ferric CN-heme (53) and monomeric ferrous-CO heme (52) binding to Mb are within experimental error of each other.

The experimental data for ferrous-CO heme binding were fitted to single exponential functions, which yield the experimental kobs at each individual protein concentration. Under conditions where apo-MmpL3-E1 and apo-MmpL11-E1 are in low molar excess compared to the heme concentration, the rate kobs depends linearly on the protein concentration and kon is equal to the slope. The on-rate for MmpL3-E1 is 29 ± 11 µM-1s-1 and that for MmpL11-E1 is 53 ± 18 µM-1s-1. These values are comparable with the on-rates of many heme-proteins (Table 3).

Ferric Heme Binding to E1 domains - While determination of kon necessitates using ferrous-CO, MmpL3-E1 and MmpL11-E1 are unlikely to encounter this heme adduct under physiological conditions, where CO concentrations are low. We therefore attempted to determine ferric heme binding to both MmpL3-E1 and MmpL11-E1.

Ferric heme binding to MmpL3-E1 and MmpL11-E1 are both two-step processes. The first, governed by the rate k1, results in an initial fast increase in absorption in the 400 nm - 410 nm range, which for MmpL3-E1 is coupled with a drop at 372 nm (Fig. 8A&C for MmpL3-E1, and 8B&D for MmpL11-E1). This species does not resemble the holo-MmpL3-E1 or holo-MmpL11-E1 spectra shown in Fig. 4A. Therefore, we propose that this species represents a heme binding intermediate. In the second step, k2, we observe an increase in absorption at 372 nm (Fig.

8E&F) over several minutes while the Soret peak blue-shifts to 388 nm for MmpL3-E1 and shifts slightly to 379 nm for MmpL11-E1. The final spectra for ferric heme binding to MmpL3-E1 (Fig. 8A) and MmpL11-E1 (Fig. 8B) now resemble the holo-E1 spectra shown in Fig. 4A.

When the rate of ferric heme binding to E1 domains is measured at two different protein concentrations the rates k1 and k2 display inverse concentration dependencies, and are slower when the E1 concentration is increased (Fig. 8 and Table 4). The inverse rate dependence could potentially be caused by concentration dependent oligomerization of the respective apo-E1 domains. To test this possibility, the experiment was conducted at constant E1 concentration and two different concentrations of heme (data not shown). This resulted in rates k1 and k2 for both E1 domains that display the same inverse rate dependence as described above. Thus, the inverse concentration dependence of k1 and k2 is not due to oligomerization of apo-E1 domains. Instead, we propose that the inverse rate dependence of k1 and k2 for both MmpL3-E1 and MmpL11-E1 are due to changes in oligomerization behavior of E1 domains due to heme binding, which is likely a multistep process, and the proposed mechanism of which will be outlined in the discussion.

Rv0203 transfers heme to MmpL3-E1 and MmpL11-E1 - To investigate whether heme is transferred from the heme-transport protein Rv0203 to MmpL3-E1 and/or MmpL11-E1, holo-Rv0203 was mixed with either apo-E1 domain, and the reaction was followed spectrophotometrically. Mixing holo-Rv0203 and apo-E1 domains in a conventional spectrophotometer resulted in a rapid spectral shift from that of holo-Rv0203 to that of the corresponding E1 domain.

The observation that heme is transferred from Rv0203 to E1 domains raised the question of whether a stable Rv0203-E1 complex can be formed. To investigate this possibility, holo-Rv0203 was biotinylated and incubated with a 10-fold molar excess of apo-MmpL3-E1 or apo-MmpL11-E1 for 60 minutes. Streptavidin-agarose beads were added to the protein mixture, and the mixture run over a spin-filter. SDS-PAGE subsequently detected proteins bound to streptavidin-agarose and those located in the flow-through. Inspection of the gel reveals that the


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


8

streptavidin-agarose beads contained only Rv0203, whereas MmpL3-E1 and MmpL11-E1 were entirely located in the flow-through (Fig. 9A). These results suggest Rv0203 and the E1 domains do not form high-affinity protein complexes.

Absorption spectra of the flow-through fractions in both experiments are characteristic of holo-E1, suggesting that heme is transferred from Rv0203 to E1 domains (Fig. 9B&C). Measurement of the total heme content within the flow-through and wash fractions demonstrate that for both MmpL3-E1 and MmpL11-E1 approximately 80% of total heme initially bound to Rv0203 was transferred, suggesting that heme transfer goes to near completion (Fig. 9D).

The efficient transfer of heme from Rv0203 to E1 domains was initially conducted with 10-fold molar excess of apo-E1 and the reaction was allowed to proceed for 60 minutes. To test whether transfer would occur with reduced molar excess of E1 domains or after a shorter incubation period, the incubation time and E1 domain concentration were varied. In the first experiment, a 2.5-fold molar excess of both E1 domains was used. In the second experiment, the reaction mixtures were incubated for only five minutes. In both cases approximately 80% of the heme was transferred suggesting low molar excess of each E1 domain is sufficient to drive the reaction to completion and that the reaction is rapid (data not shown).

Heme transfer kinetics - Since heme transfer to MmpL3-E1 and MmpL11-E1 is rapid, stopped flow techniques were used to investigate the mechanism of heme transfer. The overall kinetics of heme transfer between holo-Rv0203 and the respective apo-E1 domains are similar to that of ferric heme binding to E1 domains, where an initial increase of the Soret peak at 400 nm – 410 nm is observed (kI), followed by a slower increase at 372 nm (kII) (Fig. 10A&B). Importantly, the rate constants kI of heme transfer between holo-Rv0203 and both MmpL3-E1 and MmpL11-E1 domains are significantly faster than passive heme dissociation from holo-Rv0203, which has an off-rate, koff, equal to 0.08 s-1 (13) (Table 5).

For both MmpL3-E1 and MmpL11-E1, the rate kI of heme transfer does not change significantly as the concentration of E1 increases (Fig. 10C&D and Table 5). Furthermore, similar to ferric heme binding to MmpL3-E1, the rate kII (Fig. 8E and

Table 5) decreases slightly with increasing apo-MmpL3-E1 concentration and the values of kII are also similar to k2 from the ferric heme binding experiments (Tables 4 & 5). Similarly, for heme transfer from holo-Rv0203 to MmpL11-E1, the rate kII (Fig. 10F) is slower than kI and slower at high apo-MmpL11-E1 concentration (Table 5), which is the same trend observed for ferric heme binding to MmpL11-E1. Taken together, the experimental evidence suggests that heme is first rapidly transferred to the respective E1 domain at a rate faster than that permitted by passive heme dissociation from holo-Rv0203 but different from ferric heme binding to MmpL3-E1 or MmpL11-E1. Subsequently, the observed spectral changes upon heme transfer from holo-Rv0203 to MmpL3-E1 and MmpL11-E1 are similar to those observed during ferric heme binding to the respective E1 domain.

Directionality of heme transfer - To determine whether the reaction is unidirectional, the reverse reaction from the respective holo-E1 domains to Rv0203 was measured. For both holo-MmpL3-E1 and holo-MmpL11-E1, transfer proceeded at a rate similar to passive heme dissociation from the respective holo-E1 domain, koff (Table 5). The rates of passive transfer of heme from E1 domains to Rv0203 is considerably slower than that of heme transfer from Rv0203 to E1 domains. This suggests that the interactions between Rv0203 and MmpL3-E1 and MmpL11-E1 are specific for holo-Rv0203.

Zinc-mesoporphyrin uptake requires MmpL11 - The subcellular localization of heme that is acquired by mycobacteria is unknown; heme may be incorporated into the mycobacterial cell-wall and membrane-bound proteins or be imported into the mycobacterial cytosol to be broken down to release iron by the heme-degrading protein MhuD (10,11). To determine subcellular localization of acquired heme, zinc-mesoporphyrin (ZnMP), a fluorescent heme analogue previously used in assessing heme uptake in other organisms (54,55) was utilized. Experiments were carried out in M. smegmatis, a mycobacterium closely related to Mtb. Iron-depleted M. smegmatis cultures were treated with 1 µM ZnMP for 1 hour before harvesting the cells, which were then washed thoroughly to remove any membrane-associated ZnMP. The cells were then lysed by sonication, centrifuged and the cytosolic fraction was


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


9

analyzed for fluorescence. Excitation of ZnMP at 416 nm yields a fluorescence emission peak around 580 nm (56,57). As shown in Fig. 11, WT M. smegmatis cytosolic fraction displays a distinct ZnMP peak at 580 nm, indicating ZnMP was acquired and is located within the cytosol.

To further characterize the importance of MmpL11 in heme acquisition, a deletion mutant of the equivalent gene to Mtb MmpL11 in M. smegmatis, MSMEG_0241 (69% identical), was created (MsmegΔ0241) and verified by Southern blot. Of note, Mtb MmpL3 is encoded by an essential gene, preventing direct investigation of its role in mycobacterial heme uptake (9,14). ZnMP uptake in MsmegΔ0241 was nearly abolished (Fig. 11), whereas complementing Msmeg∆0241 with Mtb MmpL11, Msmeg∆0241::MtbmmpL11 displays an emission signal at 580 nm (Fig. 11). These results suggest that MSMEG_0241 is crucial for ZnMP uptake and Mtb mmpL11 restores ZnMP uptake. DISCUSSION

MmpL11 is required for efficient heme uptake – In this work, we used the heme analogue ZnMP to explicitly demonstrate that M. smegmatis can transport a metallated porphyrin into the mycobacterial cytosol. The ability of M. smegmatis to acquire ZnMP was further used to investigate the role MSMEG_0241 in mycobacterial heme uptake. Gene deletion experiments with Msmeg∆0241 demonstrate that MSMEG_0241 appears to be essential for ZnMP uptake; suggesting that MmpL11 is a major heme transporter in Mtb.

Heme-binding sites of MmpL3-E1 and MmpL11-E1 – Inspection of the literature reveals several transport proteins with similar absorption spectral features, including the Campylobacter jejuni heme transport protein ChaN (42), the Pseudomonas aeruginosa periplasmic heme transport mutant H209A/H212A-PhuS (58), and the Yersinia pestis perplasmic heme transporter HmuT (51) (Table 2). ChaN, HmuT and H209A/H212A-PhuS each feature a heme-binding site that accommodates two cofacially stacked heme molecules ligated by at least one Tyr in the case of ChaN and HmuT and either Tyr or OH- for H209A/H212A-PhuS. Furthermore, in ChaN and H209A/H212A-PhuS the binding site is located on a dimer interface. These observations may suggest

that MmpL3-E1 and MmpL11-E1 bind heme in a similar manner whereby heme may be ligated through a Tyr and heme-induced oligomerization may occur around the heme binding site. However, one should note that the stoichiometry of heme to E1 domain always remains 1:1. While heme stacking arrangements between protein dimers are rare, they appear more common in proteins involved in heme transport or scavenging (31). Other examples include the hemophore IsdX1 (59) from Bacillus anthracis and the heme transport protein Shp from Staphylococcus aureus (60). However, IsdX1 and Shp exhibit different spectroscopic features compared to ChaN and HmuT, suggesting that spectral features of MmpL3-E1 and MmpL11-E1 are not necessarily indicative of cofacially stacked heme molecules.

Instead, the absorption data may be indicative of five-coordinate, Tyr-ligated heme irrespective of whether the heme is monomeric or cofacially stacked. This possibility is supported by the similarity of the MmpL3-E1 and MmpL11-E1 absorption spectra to that of H25Y human heme oxygenase (hHO) (61) and H93Y Mb (62), Table 2. Both of these proteins bind a single five-coordinate, Tyr-ligated heme.

Both the EPR and MCD spectral data indicate that a mixture of high- and low-spin heme states is present in both E1 domains. A closer analysis of the MCD spectra of MmpL3-E1 and MmpL11-E1 suggests that three heme species are present (Fig. 4B): high-spin, nitrogen-ligated (His or Lys) heme; high-spin, oxygen-ligated (Tyr or Ser) heme; and low-spin, six-coordinate nitrogen/oxygen-ligated heme. The lowest energy feature in the MCD spectra of MmpL3-E1 and MmpL11-E1 is a negative band at 638 nm. This feature is similar to the ligand-to-metal charge transfer (LMCT) bands observed in ferric Mb at pH 6.8 and cyclohexylamine-ligated H93G Mb, suggesting that one of the high-spin species present in MmpL3-E1 and MmpL11-E1 is a His- or Lys-ligated heme (44,45). The wavelength and sign of the broad positive feature centered at 594 nm is most similar to the positive LMCT bands in three anionic oxygen-bound heme proteins: alkaline H93G Mb (62); H93Y Mb; (62) and C436S CYP2B4 (63). This suggests the presence of a second high-spin, (Tyr or Ser)-ligated heme. Finally, the derivative-shaped feature in the MCD spectra of MmpL3-E1 and MmpL11-E1 is ten-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


10

times more intense than the peaks in the 500-600 nm region indicating that a six-coordinate, low-spin heme species is also present. The wavelength of this feature is similar to the Soret band of alkaline heme oxygenase (64), suggesting that the low-spin species present is likely to be six-coordinate, nitrogen/oxygen-ligated heme. On inspection of the sequence and predicted structural alignment of MmpL3-E1 and MmpL11-E1 (Fig. 2A), there are two conserved Tyr and four conserved Ser residues, as well as non-conserved His and Lys residues that may contribute to heme binding.

The oligomerization behavior of MmpL3-E1 and MmpL11-E1 suggests that the respective holo-proteins form larger oligomers. This indicates that the presence of heme within the heme-binding site significantly increases the association constant for oligomer formation by increasing the strength of inter-subunit protein-protein interactions. Similar behavior was noted in ChaN (42), where the apo-protein is monomeric and holo-protein is dimeric. Furthermore, fully heme-bound RI-Irr is a hexamer, whereas apo-RI-Irr is a mixture of dimer and hexamer (65), which the authors suggest is heme promoted oligimerization of RI-Irr.

We note, however, that unlike RI-Irr, ChaN, HmuT and PhuT, both E1 domains are part of a large membrane protein. Therefore, the oligomerization state described for holo-MmpL3-E1 and holo-MmpL11-E1 domains in vitro may not reflect their behavior under physiological conditions; nevertheless, understanding E1 domain oligomerization is important for the interpretation of the heme binding and transfer experiments in this study.

MmpL3-E1 and MmpL11-E1 heme binding kinetics - The heme binding kinetics of MmpL3-E1 and MmpL11-E1 were studied by measuring on- and off-rates of the respective domains. The heme binding affinity of MmpL3-E1 is 8.1 × 109

M-1 and that of MmpL11-E1 is 1.6 × 108 M-1. The Ka for MmpL3-E1 is similar to that of hemoglobin (Hb) (47), whereas MmpL11-E1 binds with approximately one-fifth the affinity as compared to Rv0203 (13). These values indicate that MmpL3-E1 binds heme more tightly than MmpL11-E1.

Interestingly, ferrous-CO and ferric heme display very different binding kinetics. Ferrous-CO heme binding is characterized by heme

binding rates, kobs, which increase linearly with the apo-protein concentration. In contrast, ferric heme binding to both E1 domains is multiphasic, described by k1 and k2. The inverse rate dependence of k1 and k2 for both MmpL3-E1 and MmpL11-E1 may be an effect of the oligomerization behavior of the respective holo-E1 domains. Based on the observed two-step binding process we propose a mechanism in which E1 initially forms an E1-heme intermediate characterized by a red-shift in the Soret peak. The E1-heme intermediate undergoes oligomerization with apo-E1 forming weakly associated, unsaturated E1 oligomers. In a second step, the final product, oligomeric holo-E1 is formed, which is characterized by a Soret peak increase at 372 nm. Oligomeric holo-E1 is the only heme-bound E1 species detected after gel filtration experiments. Therefore, we believe its formation is essentially irreversible. The inverse rate dependence may be explained by the fact that when the apo-E1 concentration is high, formation of the holo-E1 product is relatively slow since E1-heme first undergoes oligomerization reactions with excess molar apo-E1 before the irreversible holo-E1 product forms (Fig. 12).

Because of the lack of positive rate dependence of k1 for ferric heme binding to E1, it is not possible to determine the on-rate for ferric heme and the Ka was instead determined using the on-rate from ferrous-CO heme experiments. However, given the lower values for k1 compared to kobs it is very likely that the on-rate for ferric heme is lower than that for ferrous-CO heme. This in turn suggests that under physiological conditions, where MmpL3-E1 and MmpL11-E1 will encounter ferric heme (7), the proteins’ respective heme binding affinities may not be as high as those determined in vitro using ferrous-CO heme.

Heme transfer from Rv0203 to the E1 domains occurs via a transient protein-protein interaction - Heme uptake in bacteria is typically accomplished by the transfer of heme between a series of proteins from outside to inside (7,31,66). Previously, we have determined the heme binding properties of Rv0203 and suggested that it acts as a heme transport protein (9,13). Additionally, the two homologous transmembrane proteins MmpL3 and MmpL11 have been suggested to function as transmembrane heme transporters (9). In this


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


11

work, we have demonstrated that the soluble domains, MmpL3-E1 and MmpL11-E1 bind heme, and heme is transferred from Rv0203 to MmpL3-E1 and MmpL11-E1.

Pull-down experiments between holo-Rv0203 and MmpL3-E1 and MmpL11-E1 have shown that heme is efficiently transferred to the E1 domains (Fig. 9). Furthermore, comparing the rates of heme transfer between holo-Rv0203 and the E1 domains with the rate of passive heme transfer between holo-Rv0203 and apo-H64Y/V68F-Mb revealed that the heme transfer reaction to either E1 domain is significantly faster than passive heme dissociation from holo-Rv0203, which suggests that transfer is perhaps driven by a transient protein-protein interaction (Fig. 10). The kinetic features of the heme transfer between holo-Rv0203 and the respective E1 domains resemble the biphasic kinetics of ferric heme binding. However, the rates kI for transfer are slower compared to ferric heme binding and do not display concentration dependence suggesting that heme transfer is a slower process than ferric heme binding to the respective E1 domain. The fastest observed rate of heme transfer, kI is a zero-order reaction as it is independent of the apo-E1 concentration. This suggests that the rate limiting step is the rate at which heme is transferred within the Rv0203-E1 protein-protein complex. The concentration independence of kI further suggests that the initial formation of the holo-Rv0203-E1 complex (Fig. 12), which is a bimolecular process, involves the rapid formation of a reversible, weak complex governed by rates of formation and dissociation kf and kr, respectively. The formation of the holo-Rv0203-E1 complex can be considered sufficiently rapid to be in equilibrium throughout the heme transfer process. The spectroscopic changes at 372 nm after heme transfer, kII, are similar to those seen during ferric heme binding to MmpL3-E1 and MmpL11-E1. Therefore kII is likely to be independent of the heme transfer reaction itself and arises from the mechanism with which the respective E1 domain binds heme post transfer. A proposed mechanism for heme transfer is outline in Fig. 12.

Heme transfer via protein-protein interactions between holo-Rv0203 and apo-E1 resembles the mode of transfer observed in other heme uptake systems such as the HasA-HasR interaction (33) in Serratia marcescens and the IsdX1-IsdC

interaction in B. anthracis (67). The binding affinity of the protein-protein interaction between Rv0203 and E1 is likely to be very weak as the Rv0203-E1 complex was not captured during pull-down experiments. The protein-protein interactions encountered in heme uptake pathways are often transient (29,48). Heme transfer in S. aureus has been extensively studied. IsdA is a heme transport protein that transfers heme to IsdC. Van’t Hoff analysis estimates the Kd between IsdA and IsdC to be equal to 17 µM (48), whereas NMR experiments suggest it to be in the mM range (34). A complication when studying heme transfer arises from the fact that the heme-recipient may have different affinities for the holo heme donor (Rv0203) compared to its apo-form. Support for this hypothesis is offered by experiments between the B. anthracis hemophore IsdX1 and its heme receptor IsdC (52). By surface plasmon resonance analysis, holo-IsdX1 was shown to bind IsdC with a Kd of 5 µM. In contrast no interaction between apo-IsdX1 and IsdC was recorded.

Downstream heme transfer - This work demonstrated that MmpL3 and MmpL11 receive heme from Rv0203 via their respective E1 domains. The subsequent steps to transfer heme across the membrane are not yet known. In the gram-negative organism S. marcescens, the HasA receptor HasR is part of a TonB dependent transport complex (6,30). In gram-positive bacteria such as S. aureus, the membrane bound heme receptors are part of ABC transporters, such as IsdE within the ABC transporter IsdDEF (31,32). MmpL3 and MmpL11 contain low sequence homology to non-mycobacterial proteins and are part of a different protein family than either HasR and IsdDEF. In addition, heme import mediated by MmpL3 and MmpL11 is likely to occur via a mechanism that is distinct from other RND transporters, which are typically efflux pumps that remove substrates from the cell using proton motive force (17,68). The predicted topology of MmpL3 and MmpL11 (Fig. 1B) is different from that of the four RND protein structures in the PDB, CusA (16), MexB (69), SecDF (70) and AcrB (71), which may reflect a difference in their substrate transport mechanism.

Recent research efforts have discovered that MmpL3 is the target of a variety of compounds that have antimycobacterial activites including adamantyl urea based compounds (72), SQ109


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


12

(73) and BM212 (27). The investigation of the mode of action of these compounds revealed that they inhibited mycobacterial growth by disrupting trehalose monomycolate transport across the membrane (27), preventing proper assembly of the mycobacterial cell wall. This suggests MmpL3 may be a bifunctional transporter. Such bifunctionality has been observed among other heme uptake transport proteins. For example, the S. aureus transmembrane protein HtsA displays dual roles as both a heme and siderophore receptor (74,75). Since MmpL3 is involved in both heme and trehalose monomycolate transport but not in

siderophore transport it is likely that the evolutionary origins of MmpL3 heme transport are distinct from that of HtsA. Recently MmpL4 was been shown to mediate siderophore export (25). The evolutionary origins of heme and siderophore transporters are often linked (76), thus the MmpL family of proteins may harbor members of a mycobacteria specific group of iron and heme uptake proteins. The observation that MmpL3 is a necessary protein and that the MmpL3 heme uptake mechanism may be unrelated to that of other bacteria suggests MmpL3 represents an excellent anti-TB drug target.

ACKNOWLEDGEMENTS This work was supported by the grant AI081161 (C.W.G) and GM101945 (H.C) from the National Institutes of Health. We would also like to thank Jeffrey Cox for the generous gift of the suicide vector, pJSC232, and John Olson who kindly provided the clone to produce apo-myoglobin (H64Y/V68F) mutant. REFERENCES 1. The World Health Organization, (2012) Global Tuberculosis report 2012. 2. Critchton, R. R. (2009) Iron Metabolism: From Molecular Mechanisms to Clinical

Consequences, 3rd ed., John Wiley & Sons, Ltd, Chichester, UK 3. Izadi, N., Henry, Y., Haladjian, J., Goldberg, M., E., Wandersman, C., Delepierre, M., and

Lecroisey, A. (1997) Purification and characterization of an extracellular heme-binding protein, HasA, involved in heme iron acquisition. Biochemistry 36, 7050-7057

4. Mazmanian, S. K., Skaar, E. P., Gaspar, A. H., Humayun, M., Gornicki, P., Jelenska, J., Joachmiak, A., Missiakas, D. M., and Schneewind, O. (2003) Passage of heme-iron across the envelope of Staphylococcus aureus. Science 299, 906-909

5. Tong, Y., and Guo, M. (2009) Bacterial heme-transport proteins and their heme-coordination modes. Arch Biochem Biophys 481, 1-15

6. Wandersman, C., and Delepelaire, P. (2004) Bacterial iron sources: from siderophores to hemophores. Annu Rev Microbiol 58, 611-647

7. Zhu, H., Xie, G., Liu, M., Olson, J. S., Fabian, M., Dooley, D. M., and Lei, B. (2008) Pathway for Heme Uptake from Human Methemoglobin by the Iron-regulated Surface Determinants System of Staphylococcus aureus. J Biol Chem 283, 18450-18460

8. Jones, C. M., and Niederweis, M. (2011) Mycobacterium tuberculosis can utilize heme as an iron source. J Bacteriol 193, 1767-1770

9. Tullius, M. V., Harmston, C. A., Owens, C. P., Chim, N., Morse, R. P., McMath, L. M., Iniguez, A., Kimmey, J. M., Sawaya, M. R., Whitelegge, J. P., Horwitz, M. A., and Goulding, C. W. (2011) Discovery and characterization of a unique mycobacterial heme acquisition system. Proc Natl Acad Sci U S A 108, 5051-5056

10. Chim, N., Iniguez, A., Nguyen, T. Q., and Goulding, C. W. (2010) Unusual Diheme conformation of the heme-degrading protein from Mycobacterium tuberculosis. J Mol Biol 395, 595-608

11. Nambu, S., Matsui, T., Goulding, C. W., Takahashi, S., and Ikeda-Saito, M. (2013) A new way to degrade heme: the Mycobacterium tuberculosis enzyme MhuD catalyzes heme degradation without generating CO. J Biol Chem 288, 10101-10109


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


13

12. Emanuelsson, O., Brunak, S., von Heijne, G., and Nielsen, H. (2007) Locating proteins in the cell using TargetP, SignalP and related tools. Nat Protoc 2, 953-971

13. Owens, C. P., Du, J., Dawson, J. H., and Goulding, C. W. (2012) Characterization of heme ligation properties of Rv0203, a secreted heme binding protein involved in Mycobacterium tuberculosis heme uptake. Biochemistry 51, 1518-1531

14. Domenech, P., Reed, M. B., and Barry, C. E., 3rd. (2005) Contribution of the Mycobacterium tuberculosis MmpL protein family to virulence and drug resistance. Infect Immun 73, 3492-3501

15. Blair, J. M., and Piddock, L. J. (2009) Structure, function and inhibition of RND efflux pumps in Gram-negative bacteria: an update. Curr Opin Microbiol 12, 512-519

16. Long, F., Su, C. C., Lei, H. T., Bolla, J. R., Do, S. V., and Yu, E. W. (2012) Structure and mechanism of the tripartite CusCBA heavy-metal efflux complex. Philos Trans R Soc Lond B Biol Sci 367, 1047-1058

17. Nikaido, H. (2011) Structure and mechanism of RND-type multidrug efflux pumps. Adv Enzymol Relat Areas Mol Biol 77, 1-60

18. Su, C. C., Long, F., Zimmermann, M. T., Rajashankar, K. R., Jernigan, R. L., and Yu, E. W. (2011) Crystal structure of the CusBA heavy-metal efflux complex of Escherichia coli. Nature 470, 558-562

19. Lamichhane, G., Tyagi, S., and Bishai, W. R. (2005) Designer arrays for defined mutant analysis to detect genes essential for survival of Mycobacterium tuberculosis in mouse lungs. Infect Immun 73, 2533-2540

20. Milano, A., Pasca, M. R., Provvedi, R., Lucarelli, A. P., Manina, G., Ribeiro, A. L., Manganelli, R., and Riccardi, G. (2009) Azole resistance in Mycobacterium tuberculosis is mediated by the MmpS5-MmpL5 efflux system. Tuberculosis (Edinb) 89, 84-90

21. Converse, S. E., Mougous, J. D., Leavell, M. D., Leary, J. A., Bertozzi, C. R., and Cox, J. S. (2003) MmpL8 is required for sulfolipid-1 biosynthesis and Mycobacterium tuberculosis virulence. Proc Natl Acad Sci U S A 100, 6121-6126

22. Cox, J. S., Chen, B., McNeil, M., and Jacobs, W. R., Jr. (1999) Complex lipid determines tissue-specific replication of Mycobacterium tuberculosis in mice. Nature 402, 79-83

23. Jain, M., and Cox, J. S. (2005) Interaction between polyketide synthase and transporter suggests coupled synthesis and export of virulence lipid in M. tuberculosis. PLoS Pathog 1, e2, doi: 10.1371/journal.ppat.0010002

24. Seeliger, J. C., Holsclaw, C. M., Schelle, M. W., Botyanszki, Z., Gilmore, S. A., Tully, S. E., Niederweis, M., Cravatt, B. F., Leary, J. A., and Bertozzi, C. R. (2012) Elucidation and chemical modulation of sulfolipid-1 biosynthesis in Mycobacterium tuberculosis. J Biol Chem 287, 7990-8000

25. Wells, R. M., Jones, C. M., Xi, Z., Speer, A., Danilchanka, O., Doornbos, K. S., Sun, P., Wu, F., Tian, C., and Niederweis, M. (2013) Discovery of a siderophore export system essential for virulence of Mycobacterium tuberculosis. PLoS Pathog 9, e1003120, doi: 10.1371/journal.ppat.1003120

26. Grzegorzewicz, A. E., Pham, H., Gundi, V. A., Scherman, M. S., North, E. J., Hess, T., Jones, V., Gruppo, V., Born, S. E., Kordulakova, J., Chavadi, S. S., Morisseau, C., Lenaerts, A. J., Lee, R. E., McNeil, M. R., and Jackson, M. (2012) Inhibition of mycolic acid transport across the Mycobacterium tuberculosis plasma membrane. Nat Chem Biol 8, 334-341

27. La Rosa, V., Poce, G., Canseco, J. O., Buroni, S., Pasca, M. R., Biava, M., Raju, R. M., Porretta, G. C., Alfonso, S., Battilocchio, C., Javid, B., Sorrentino, F., Ioerger, T. R., Sacchettini, J. C., Manetti, F., Botta, M., De Logu, A., Rubin, E. J., and De Rossi, E. (2012) MmpL3 is the cellular target of the antitubercular pyrrole derivative BM212. Antimicrob Agents Chemother 56, 324-331

28. Varela, C., Rittmann, D., Singh, A., Krumbach, K., Bhatt, K., Eggeling, L., Besra, G. S., and Bhatt, A. (2012) MmpL genes are associated with mycolic acid metabolism in mycobacteria and corynebacteria. Chem Biol 19, 498-506


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


14

29. Abe, R., Caaveiro, J. M., Kozuka-Hata, H., Oyama, M., and Tsumoto, K. (2012) Mapping ultra-weak protein-protein interactions between heme transporters of Staphylococcus aureus. J Biol Chem 287, 16477-16487

30. Cescau, S., Cwerman, H., Letoffe, S., Delepelaire, P., Wandersman, C., and Biville, F. (2007) Heme acquisition by hemophores. Biometals 20, 603-613

31. Grigg, J. C., Ukpabi, G., Gaudin, C. F., and Murphy, M. E. (2010) Structural biology of heme binding in the Staphylococcus aureus Isd system. J Inorg Biochem 104, 341-348

32. Grigg, J. C., Vermeiren, C. L., Heinrichs, D. E., and Murphy, M. E. (2007) Heme coordination by Staphylococcus aureus IsdE. J Biol Chem 282, 28815-28822

33. Izadi-Pruneyre, N., Huche, F., Lukat-Rodgers, G. S., Lecroisey, A., Gilli, R., Rodgers, K. R., Wandersman, C., and Delepelaire, P. (2006) The heme transfer from the soluble HasA hemophore to its membrane-bound receptor HasR is driven by protein-protein interaction from a high to a lower affinity binding site. J Biol Chem 281, 25541-25550

34. Villareal, V. A., Spirig, T., Robson, S. A., Liu, M., Lei, B., and Clubb, R. T. (2011) Transient weak protein-protein complexes transfer heme across the cell wall of Staphylococcus aureus. J Am Chem Soc 133, 14176-14179

35. Dawson, R. M. C., Elliot, C. D., Elliot, W. H., and Jones, M. K. (1986) Data for Biochemical Research, Oxford Univeristy Press, Oxford, UK

36. Bartsch, R. G. (1971) Cytochromes: Bacterial. Methods Enzymol 23, 344–363 37. Hargrove, M. S., Barrick, D., and Olson, J. S. (1996) The association rate constant for heme

binding to globin is independent of protein structure. Biochemistry 35, 11293-11299 38. Hargrove, M. S., Singleton, E. W., Quillin, M. L., Ortiz, L. A., Phillips, G. N., Jr., Olson, J. S.,

and Mathews, A. J. (1994) His64(E7)-->Tyr apomyoglobin as a reagent for measuring rates of hemin dissociation. J Biol Chem 269, 4207-4214

39. Converse, S. E., and Cox, J. S. (2005) A protein secretion pathway critical for Mycobacterium tuberculosis virulence is conserved and functional in Mycobacterium smegmatis. J Bacteriol 187, 1238-1245

40. Cole, C., Barber, J. D., and Barton, G. J. (2008) The Jpred 3 secondary structure prediction server. Nucleic Acids Res 36, W197-201

41. Bartsch, R. G., Kakuno, T., Horio, T., and Kamen, M. D. (1971) Preparation and properties of Rhodospirillum rubrum cytochromes c 2, cc', and b 557.5, and flavin mononucleotide protein. J Biol Chem 246, 4489-4496

42. Chan, A. C., Lelj-Garolla, B., F, I. R., Pedersen, K. A., Mauk, A. G., and Murphy, M. E. (2006) Cofacial heme binding is linked to dimerization by a bacterial heme transport protein. J Mol Biol 362, 1108-1119

43. Singleton, C., White, G. F., Todd, J. D., Marritt, S. J., Cheesman, M. R., Johnston, A. W., and Le Brun, N. E. (2010) Heme-responsive DNA binding by the global iron regulator Irr from Rhizobium leguminosarum. J Biol Chem 285, 16023-16031

44. Du, J., Sono, M., and Dawson, J. H. (2011) The H93G Myoglobin Cavity Mutant as a Versatile Scaffold for Modeling Heme Iron Coordination Structures in Protein Active Sites and Their Characterization with Magnetic Circular Dichroism Spectroscopy. Coord Chem Rev 255, 700-716

45. Vickery, L., Nozawa, T., and Sauer, K. (1976) Magnetic circular dichroism studies of myoglobin complexes. Correlations with heme spin state and axial ligation. J Am Chem Soc 98, 343-350

46. Louis-Jeune, C., Andrade-Navarro, M. A., and Perez-Iratxeta, C. (2011) Prediction of protein secondary structure from circular dichroism using theoretically derived spectra. Proteins

47. Hargrove, M. S., Whitaker, T., Olson, J. S., Vali, R. J., and Mathews, A. J. (1997) Quaternary structure regulates hemin dissociation from human hemoglobin. J Biol Chem 272, 17385-17389

48. Liu, M., Tanaka, W. N., Zhu, H., Xie, G., Dooley, D. M., and Lei, B. (2008) Direct hemin transfer from IsdA to IsdC in the iron-regulated surface determinant (Isd) heme acquisition system of Staphylococcus aureus. J Biol Chem 283, 6668-6676


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


15

49. Bhakta, M. N., and Wilks, A. (2006) The mechanism of heme transfer from the cytoplasmic heme binding protein PhuS to the delta-regioselective heme oxygenase of Pseudomonas aeruginosa. Biochemistry 45, 11642-11649

50. Nygaard, T. K., Blouin, G. C., Liu, M., Fukumura, M., Olson, J. S., Fabian, M., Dooley, D. M., and Lei, B. (2006) The mechanism of direct heme transfer from the streptococcal cell surface protein Shp to HtsA of the HtsABC transporter. J Biol Chem 281, 20761-20771

51. Mattle, D., Zeltina, A., Woo, J. S., Goetz, B. A., and Locher, K. P. (2010) Two stacked heme molecules in the binding pocket of the periplasmic heme-binding protein HmuT from Yersinia pestis. J Mol Biol 404, 220-231

52. Hargrove, M. S., and Olson, J. S. (1996) The stability of holomyoglobin is determined by heme affinity. Biochemistry 35, 11310-11318

53. Kawamura-Konishi, Y., Kihara, H., and Suzuki, H. (1988) Reconstitution of myoglobin from apoprotein and heme, monitored by stopped-flow absorption, fluorescence and circular dichroism. Eur J Biochem 170, 589-595

54. Huynh, C., Yuan, X., Miguel, D. C., Renberg, R. L., Protchenko, O., Philpott, C. C., Hamza, I., and Andrews, N. W. (2012) Heme uptake by Leishmania amazonensis is mediated by the transmembrane protein LHR1. PLoS Pathog 8, e1002795, doi: 10.1371/journal.ppat.1002795

55. Desuzinges-Mandon, E., Arnaud, O., Martinez, L., Huche, F., Di Pietro, A., and Falson, P. (2010) ABCG2 transports and transfers heme to albumin through its large extracellular loop. J Biol Chem 285, 33123-33133

56. Masuda, T., Inoue, K., Masuda, M., Nagayama, M., Tamaki, A., Ohta, H., Shimada, H., and Takamiya, K. (1999) Magnesium insertion by magnesium chelatase in the biosynthesis of zinc bacteriochlorophyll a in an aerobic acidophilic bacterium Acidiphilium rubrum. J Biol Chem 274, 33594-33600

57. Moller, J. K., Adamsen, C. E., Catharino, R. R., Skibsted, L. H., and Eberlin, M. N. (2007) Mass spectrometric evidence for a zinc-porphyrin complex as the red pigment in dry-cured Iberian and Parma ham. Meat Sci 75, 203-210

58. Block, D. R., Lukat-Rodgers, G. S., Rodgers, K. R., Wilks, A., Bhakta, M. N., and Lansky, I. B. (2007) Identification of two heme-binding sites in the cytoplasmic heme-trafficking protein PhuS from Pseudomonas aeruginosa and their relevance to function. Biochemistry 46, 14391-14402

59. Ekworomadu, M. T., Poor, C. B., Owens, C. P., Balderas, M. A., Fabian, M., Olson, J. S., Murphy, F., Balkabasi, E., Honsa, E. S., He, C., Goulding, C. W., and Maresso, A. W. (2012) Differential function of lip residues in the mechanism and biology of an anthrax hemophore. PLoS Pathog 8, e1002559, doi: 10.1371/journal.ppat.1002559

60. Aranda, R. t., Worley, C. E., Liu, M., Bitto, E., Cates, M. S., Olson, J. S., Lei, B., and Phillips, G. N., Jr. (2007) Bis-methionyl coordination in the crystal structure of the heme-binding domain of the streptococcal cell surface protein Shp. J Mol Biol 374, 374-383

61. Liu, Y., Moenne-Loccoz, P., Hildebrand, D. P., Wilks, A., Loehr, T. M., Mauk, A. G., and Ortiz de Montellano, P. R. (1999) Replacement of the proximal histidine iron ligand by a cysteine or tyrosine converts heme oxygenase to an oxidase. Biochemistry 38, 3733-3743

62. Pond, A. E., Roach, M. P., Sono, M., Rux, A. H., Franzen, S., Hu, R., Thomas, M. R., Wilks, A., Dou, Y., Ikeda-Saito, M., Ortiz de Montellano, P. R., Woodruff, W. H., Boxer, S. G., and Dawson, J. H. (1999) Assignment of the heme axial ligand(s) for the ferric myoglobin (H93G) and heme oxygenase (H25A) cavity mutants as oxygen donors using magnetic circular dichroism. Biochemistry 38, 7601-7608

63. Perera, R., Sono, M., Voegtle, H. L., and Dawson, J. H. (2011) Molecular basis for the inability of an oxygen atom donor ligand to replace the natural sulfur donor heme axial ligand in cytochrome P450 catalysis. Spectroscopic characterization of the Cys436Ser CYP2B4 mutant. Arch Biochem Biophys 507, 119-125


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


16

64. Hawkins, B. K., Wilks, A., Powers, L. S., Ortiz de Montellano, P. R., and Dawson, J. H. (1996) Ligation of the iron in the heme-heme oxygenase complex: X-ray absorption, electronic absorption and magnetic circular dichroism studies. Biochim Biophys Acta 1295, 165-173

65. White, G. F., Singleton, C., Todd, J. D., Cheesman, M. R., Johnston, A. W., and Le Brun, N. E. (2011) Heme binding to the second, lower-affinity site of the global iron regulator Irr from Rhizobium leguminosarum promotes oligomerization. FEBS J 278, 2011-2021

66. Muryoi, N., Tiedemann, M. T., Pluym, M., Cheung, J., Heinrichs, D. E., and Stillman, M. J. (2008) Demonstration of the iron-regulated surface determinant (Isd) heme transfer pathway in Staphylococcus aureus. J Biol Chem 283, 28125-28136

67. Fabian, M., Solomaha, E., Olson, J. S., and Maresso, A. W. (2009) Heme transfer to the bacterial cell envelope occurs via a secreted hemophore in the Gram-positive pathogen Bacillus anthracis. J Biol Chem 284, 32138-32146

68. Kim, E. H., Nies, D. H., McEvoy, M. M., and Rensing, C. (2011) Switch or funnel: how RND-type transport systems control periplasmic metal homeostasis. J Bacteriol 193, 2381-2387

69. Sennhauser, G., Bukowska, M. A., Briand, C., and Grutter, M. G. (2009) Crystal structure of the multidrug exporter MexB from Pseudomonas aeruginosa. J Mol Biol 389, 134-145

70. Tsukazaki, T., Mori, H., Echizen, Y., Ishitani, R., Fukai, S., Tanaka, T., Perederina, A., Vassylyev, D. G., Kohno, T., Maturana, A. D., Ito, K., and Nureki, O. (2011) Structure and function of a membrane component SecDF that enhances protein export. Nature 474, 235-238

71. Murakami, S., Nakashima, R., Yamashita, E., and Yamaguchi, A. (2002) Crystal structure of bacterial multidrug efflux transporter AcrB. Nature 419, 587-593

72. Scherman, M. S., North, E. J., Jones, V., Hess, T. N., Grzegorzewicz, A. E., Kasagami, T., Kim, I. H., Merzlikin, O., Lenaerts, A. J., Lee, R. E., Jackson, M., Morisseau, C., and McNeil, M. R. (2012) Screening a library of 1600 adamantyl ureas for anti-Mycobacterium tuberculosis activity in vitro and for better physical chemical properties for bioavailability. Bioorg Med Chem 20, 3255-3262

73. Tahlan, K., Wilson, R., Kastrinsky, D. B., Arora, K., Nair, V., Fischer, E., Barnes, S. W., Walker, J. R., Alland, D., Barry, C. E., 3rd, and Boshoff, H. I. (2012) SQ109 targets MmpL3, a membrane transporter of trehalose monomycolate involved in mycolic acid donation to the cell wall core of Mycobacterium tuberculosis. Antimicrob Agents Chemother 56, 1797-1809

74. Grigg, J. C., Cheung, J., Heinrichs, D. E., and Murphy, M. E. (2010) Specificity of Staphyloferrin B recognition by the SirA receptor from Staphylococcus aureus. J Biol Chem 285, 34579-34588

75. Lei, B., Liu, M., Voyich, J. M., Prater, C. I., Kala, S. V., DeLeo, F. R., and Musser, J. M. (2003) Identification and characterization of HtsA, a second heme-binding protein made by Streptococcus pyogenes. Infect Immun 71, 5962-5969

76. Hopkinson, B. M., Roe, K. L., and Barbeau, K. A. (2008) Heme uptake by Microscilla marina and evidence for heme uptake systems in the genomes of diverse marine bacteria. Appl Environ Microbiol 74, 6263-6270

FIGURE LEGENDS Figure 1. (A) Proposed heme uptake mechanism in Mtb (9-11). (B) Topology of MmpL3, predicted with TMHMM (12), consists of 11 transmembrane helices and three soluble domains (E1, C1, and E2). A similar topology is also predicted for MmpL11. Figure 2 (A) Sequence alignment of MmpL3-E1 and MmpL11-E1 with the aid of the secondary structure prediction (based on the JPRED 3 prediction server (40)). Conserved and similar residues are highlighted pink and blue, respectively. The sequence identity between MmpL3-E1 and MmpL11-E1 is ~20%. Predicted helical regions are indicated by cylinders, while predicted β-strands are marked by arrows. (B)


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


17

SDS-PAGE of the purified MmpL3-E1 domain in lane 1 and MmpL11-E1 in lane 2, on the left is a MW marker. Figure 3 (A) Heme titration of MmpL3-E1 (5 µM) and (B) MmpL11-E1 (10 µM). The respective titration curves were generated by titrating small increments of a concentrated ferric heme solution into cuvettes containing either protein or buffer and measuring the difference spectrum between the protein sample and the buffer-only sample after a 5-min incubation. The wavelength for the maximal absorbance difference is 370 nm and 374 nm for MmpL3-E1 and MmpL11-E1, respectively. The saturation concentration is marked with an arrow and is reached when the differential absorbance remains constant. Figure 4 (A) Absorption spectra of ferric MmpL3-E1 (blue line) and MmpL11-E1 (red line). The heme concentration in both spectra is 13 µM. (B) MCD spectra of MmpL3-E1 (80 µM, blue line) and MmpL11-E1 (60 µM, red line) recorded at 5 K and 7 T. Figure 5. EPR spectrum of holo-MmpL3-E1 (1 mM heme) and holo-MmpL11-E1 (0.57 mM heme). The EPR spectrum was recorded at 4.5 K, a 9.39 GHz microwave frequency, a 0.02 mW microwave power, a 10 G modulation amplitude, and a 100 kHz modulation frequency. Figure 6. Analytical gel filtration of (A) holo-MmpL3-E1 and (B) holo-MmpL11-E1 preincubated with different heme to protein ratios. Each 100 µM protein sample with the corresponding heme molar ratio (total volume 200 µL) was loaded over an S200 10/300 gel filtration column with a flow rate of 0.5 ml min-1. The presence of heme in the holo-MmpL3-E1 and holo-MmpL11-E1 fractions was verified by absorption spectroscopy. (C) Bar graph demonstrating the accumulation of E1 oligomers with increasing heme concentration. Figure 7. CD spectra of apo- (blue) and holo- (red) (A) MmpL3-E1 and (B) MmpL11-E1. The spectra represent the average of two scans. Figure 8. Time resolved absorption spectra of (A) MmpL3-E1 and (B) MmpL11-E1 binding to ferric heme (5 µM). The spectra at 0s represents free heme, 1s the formation of an intermediate species and 100s the final holo-E1 species observed in Fig. 4A. Formation of the intermediate species was fitted to a single exponential fitting (0 – 1s) was followed at the change of absorbance at 410 nm for (C) MmpL3-E1 and (D) MmpL11-E1 for ferric heme binding at different apo-E1 concentrations. Formation of the holo-E1 species was followed at the change of absorbance at 372 nm for MmpL3-E1 (E) and MmpL11-E1 (F), and was fit to single exponentials, whereby the fitting window was 1 – 60 s. Figure 9. Heme transfer experiments. (A) SDS-PAGE of the pull-down fractions for transfer analyses between Rv0203 and MmpL3-E1 and Rv0203 and MmpL11-E1. Lane 1: streptavidin beads after reaction with MmpL3-E1, Lane 2: MmpL3-E1 flow-through, Lane 3: streptavidin beads after reaction with MmpL11-E1, Lane 4: MmpL11-E1 flow-through. A molecular weight marker is shown on the left. Rv0203 is boxed for clarity. The bands marked with * are due to E1 degradation during the course of purification and the experiment. (B) Absorption spectra of Rv0203 prior to MmpL3-E1 addition and the flow-through after addition of MmpL3-E1. (C) Absorption spectra of the Rv0203 prior to MmpL11-E1 addition and the flow-through. The heme-concentration in the absorption spectra in B and C is 5 µM. (D) Relative amount of heme transferred to MmpL3-E1 and MmpL11-E1 from Rv0203 in the pull-down experiments. The amount of heme bound to Rv0203 prior to MmpL3-E1 or MmpL11-E1 addition represents 100%. The heme transferred to MmpL3-E1 and MmpL11-E1 was located in the respective flow-through and wash fractions. The heme content was determined using either the pyridine hemochromagen assay (36) or the respective protein’s extinction coefficient at the Soret peak.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


18

Figure 10. Time resolved absorption spectra of Rv0203 (5 µM) heme transfer to 20-fold molar excess (A) MmpL3-E1 and (B) MmpL11-E1. The spectra at 0s represents holo-Rv0203, 1s the formation of an intermediate species and 100s the final holo-E1 species observed in Fig. 4A. Timecourses for the change at 410 nm for heme transfer between holo-Rv0203 and (C) apo-MmpL3-E1 and (D) apo-MmpL11-E1 at different molar excess amounts of apo-E1 and timecourses at 372 nm for (E) apo-MmpL3-E1 and (F) apo-MmpL11-E1. The concentration of holo-Rv0203 is 5 µM. The timecourses in (C) and (D) were fit to a single exponential function between 0 – 1 s and those in (E) and (F) between 0 – 100 s. Figure 11. Fluorescence scans of M. smegmatis WT and the mutant cytosol after treatment with ZnMP after 1 hour incubation with 1 µM ZnMP. The emission spectra are recorded after excitation at 416 nm. WT M. smegmatis compared to MsmegΔ0241 (Δ0241) and Msmeg∆0241::MtbmmpL11 (Δ0241::mmpL11). Figure 12. Proposed two-phase mechanism for heme transfer between holo-Rv0203 and apo-E1 domain (from either MmpL3 or MmpL11).


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


19

Table 1: Primers used to construct the suicide vectors for deletion strains. Primers with the suffixes “for1” and “rev1” were used to amplify the 3` genomic flanking regions of the desired genes to be deleted, while the primers with the suffixes “for2” and “rev2” were used to amplify the 5` flanking regions. They were ligated into the pJSC232 vector using the AflII site created by both “rev1” or “for2” primers and then electroporated into electro-competent M. smegmatis WT cells. Strain Primers: Primer sequence: Genes deleted

0241for1 CGCTGCAGGTTCGGTCAGTAGCCATCAGTA 0241rev1 CGCTTAAGACGATGTCCGAATGTCGGGTCC 0241for2 CGCTTAAGGACTGGTTGAGAGCGATCGACG

Msmeg∆0241

0241rev2 CGGCTAGCAGGCAACTGGCACTTGGTG

MSMEG_0241


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


20

Table 2. Comparison of the ferric absorption features of holo-MmpL3-E1 and holo-MmpL11-E1, and those of selected heme-proteins.

Protein [ref.] Soret, λmax (nm) Charge transfer, λmax (nm) MmpL3-E1 (this work) 388 618 MmpL11-E1 (this work) 379 621 ChaN (42) 403 630 H209A/H212A-PhuS (58) 395 615 HmuT (51) 375 620 (by visual inspection) H25Y hHO (61) 393 612 H93Y Mb (62) 398 621


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


21

Table 3. Kinetic parameters for heme binding to MmpL3-E1 and MmpL11-E1 and selected heme-proteins

Protein [ref.] On-rate (µM-1s-

1) Off-rate (s-1) Ka (M-1)

MmpL3-E1 [this work] 29 ± 11 kf: 0.0036 ± 0.0007 (44%) ks: 0.0004 ± 0.0001 (56%)

8.1 × 109 a

MmpL11-E1 [this work] 53 ± 18 0.34 ± 0.02 1.6 × 108 a Rv0203 (13) 133 0.08 1.6 × 109 a metHb (α subunit) (47) 100 0.00016 6.0 × 1011 a metHb (β subunit) (47) 100 0.0042 2.4 × 1010 a IsdA (48) 100 0.00026 3.8 × 1011 a PhuS (49) 0.18 0.04 (calc. from koff = kon/Ka) 5.0 × 106 b Shp (50) 1.6 0.0003 5.3 × 109 a HmuT (51) 3.4 × 109 (1st heme

molecule) c a Ka values are calculated using ferrous-CO heme binding on-rates and ferric heme binding off-rates. b Ka values are calculated by direct titration of ferric heme into apo-protein. c Ka values are calculated isothermal titration calorimitry with ferric heme.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


22

Table 4. Kinetic parameters describing ferric heme binding to MmpL3-E1 and MmpL11-E1 Apo-protein, fold molar excess vs. 5 µM heme

k1a (s-1) k2 b(s-1)

MmpL3-E1, 10× 15.81 ± 1.26 0.12 ± 0.05 MmpL3-E1, 50× 6.87 ± 0.33 0.05 ± 0.03 MmpL11-E1, 10× 14.64 ± 1.52 0.64 ± 0.25 MmpL11-E1, 50× 5.0 ± 0.4 0.16 ± 0.05

a The rate k1 represents the formation of the E1-heme intermediate characterized by an amplitude change at 410 nm in the time interval 0 – 1 s. b The rate k2 is obtained from the change in absorption at 372 nm in the 1 – 60 s interval and 0 – 60 s interval for MmpL3-E1 and MmpL11-E1, respectively.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


23

Table 5. Kinetic parameters for heme transfer between Rv0203 and MmpL3-E1 and MmpL11-E1

aExperiments were conducted with holo-protein concentrations of 5 μM bExperiments were conducted with holo-protein concentrations of 10 μM

kI (s-1) kII (s-1) Holo-Rv0203 to 10× apo-MmpL3-E1a 4.22 ± 0.64 0.08 ± 0.01 Holo-Rv0203 to 50× apo-MmpL3-E1 a 3.25 ± 0.47 0.03 ± 0.03 Holo-Rv0203 to 10× apo-MmpL11-E1

a 4.16 ± 1.37 0.13 ± 0.01

Holo-Rv0203 to 50× apo-MmpL11-E1

a 5.37 ± 1.61 0.09 ± 0.04

Holo-MmpL3-E1 to 5× apo-Rv0203 b 0.003 ± 0.001 n/d Holo-MmpL11-E1 to 5× apo-Rv0203 a 0.20 ± 0.08 n/d


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


24

Figure 1


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


25

Figure 2.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


26

Figure 3.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


27

Figure 4.

300 400 500 600 7000.0

0.3

0.6

0.9

(x4)

MmpL11-E1

MmpL3-E1

A

Wavelength (nm)

Abs

orba

nce

300 400 500 600 700-2000

-1500

-1000

-500

0

500

1000MmpL3-E1MmpL11-E1

(x6)

B

Wavelength (nm)

Δε

(M-1

cm

-1)


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


28

Figure 5.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


29

Figure 6.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


30

Figure 7.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


31

Figure 8.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


32

Figure 9.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


33

Figure 10.

350 400 4500.00

0.04

0.08

0.12

Wavelength (nm)A

bsor

banc

e

01100

Time (s)B

350 400 4500.03

0.06

0.09

0.12

0.150

Time (s)A

1001

Wavelength (nm)

Abs

orba

nce

0 20 40 60 80 1000.000

0.005

0.010

0.015

0.020

250 µM MmpL3-E150 µM MmpL3-E1E

Time (s)

Abs

orba

nce

372

nm

0.0 0.2 0.4 0.6 0.8 1.00.000

0.003

0.006

0.009

0.012

0.015

0.018

0.021

250 µM MmpL3-E150 µM MmpL3-E1

C

Time (s)

Abs

orba

nce

410

nm

0.0 0.2 0.4 0.6 0.8 1.00.000

0.003

0.006

0.009

0.012 50 µM MmpL11-E1250 µM MmpL11-E1

D

Time (s)

Abs

orba

nce

410

nm

0 20 40 60 80 1000.000

0.005

0.010

0.015

0.020

0.025

50 µM MmpL11-E1250 µM MmpL11-E1

F

Time (s)

Abs

. (37

2 nm

)


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


34

Figure 11.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


35

Figure 12.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Iniguez, Heidi Contreras, Matthew Liptak and Celia W. GouldingCedric P. Owens, Nicholas Chim, Amanda B. Graves, Christine A. Harmston, Angelina

MmpL11Membrane Proteins, Mycobacterial membrane protein Large 3 (MmpL3) and

Secreted Protein, Rv0203, Transfers Heme toMycobacterium tuberculosisThe

published online June 11, 2013J. Biol. Chem.

10.1074/jbc.M113.453076Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M113.453076

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;M113.453076v1&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2013/06/11/jbc.M113.453076

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=early/2013/06/11/jbc&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2013/06/11/jbc.M113.453076

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/

1 heidi contreras1, matthew d. liptak4

Documents