1 of 41 celltrion, inc., exhibit 1073 · 2017. 5. 10. · t ., schulman , m. j. traunecker , a. ,...

Europiiisches Patentamt

European Patent Office

Office europeen des brevets

@ Publication number: 0239400 A2

EUROPEAN PATENT APPLICATION

@ Application number: 87302620.7

@ Date offillng: 26.03.87

@ Priority: 27.03.86 GB 8607679

@ Date of publication of application: 30.09.87 BuRetln87/40

@) Designated Contracting States: AT BE CH DE ES FR GB GR ITLI LU NL SE

® Recombinant antibodies and methods for their production. @ An altered antibody is produced by replacing the com-plementarity determining regions (CDRs) of a variable region of an lmmunoglobulin (lg) w ith the CDRs from an lg of different specificity, using recombinant DNA techniques. The

gene coding sequences for producing the altered antibody

may be produced by site-directed mutagenesis using long ollgonucleot ides.

® Int.Cl.•: C 12 N 15/00, C 07 K 15/06, c 12 p 21/02

® Applicant: Winter, Gregory Peul, 64 Cavendish Avenue, Cambridge (GB)

@ Inventor: Winter, Gregory Paul, 64 C.Vendlah Avenue, Cambridge (GB)

@ Representative: Votler, Sidney David et al, CARPMAELS & RANSFORD 43, Bloomsbury Square, London WC1A2RA (GB)

Hl ndll l _1 _ 5· _ 2_,- - '- s· llemHI H FRI - FR2 - FR3 - FR4 t'

CORI CDR2 CDR3

HuVHP gene cloned In 11131T1119

O 1.3 CDR I ollgonuel1olld1 5' CT G,TCT ,CAC,CCA,GTT ,T AC,AtC,AT A,GCC,GCT ,GAA,GGT ,GCT

FR2 0 1.3 CORI FRI

01 .3 CDR2 ollgonuc1eollde S' CAT ,TGT ,CAC,TCT ,GGA,TTT ,GAG,AGC,TGA,ATT ,AT A,GTC.TGT,

FR3 OL! COR2 GTT ,TCC,ATC,ACC,CCA,AAT ,CAT ,T CC,AAT ,CCA,CTC

Ol.3CDR2 FR2

DI .3 CORJ ollgonucholldl 5' GCC,TTG,ACC,CCA,GTA,GTC,A"G,CCT ,ATA,ATC,TCT ,CTC,TCT,

FR~

TGC,ACA,ATA

fR3

01.3 COR3

ACTORUM AG

1 of 41 Celltrion, Inc., Exhibit 1073

0239400

-1-

RECOMBINANT DNA PRODUCT AND METHODS

The present invention relates to altered antibodies

in which at least parts of the complementarity

determining regions (CDRs) in the light or heavy

chain variable domains of the antibody have been

replaced by analogous parts of CDRs f rom an antibody

of different specificity . The present invention

also relates to methods for the production of such

altered antibodies .

Natural antibodies , or immunoglobulins , comprise two

heavy chains linked together by disulphide bonds and

two light chains , one light chain being linked to

each of the heavy chains by disulphide bonds . The

general structure of an antibody of class IgG (i . e .

an immunoglobulin (Ig) of class gamma (G)) is shown

schematically in Figure 1 of the accompanying

drawings .

Each heavy chain has at one end a variable domain

followed by a number of constant domains. Each

l ight chain has a variable domain at one end and a

constant domain at its other end , the variable

domain being aligned with the variable domain of the

heavy chain and the constant domain being aligned

with the first constant domain of the heavy chain .

The constant domains in the light and heavy chains

are not involved directly in binding the antibody to

the antigen .

The variable domains of each pair of light and heavy

chains form the antigen binding site. The domains

on the light and heavy chains have the same general

structure and each domain comprises four framework


0239400

- 2 -

regions , whose sequences are relatively conserved ,

connected by three hypervariable or complementarity

determining regions (CDRs~ (see Kabat , E.A., Wu,

T.T ., Bilofsky , H., Reid-Miller, M. and Perry , H.,

in "Sequences of Proteins of Immunological

Interest" , US Dept . Health and Human Services 1983) .

The four framework regions largely adopt a ~-sheet

conformation and the CDRs form loops connecting, and

in some cases forming part of, the ~ -sheet

structure . The CDRs are held in close proximity by

the framework regions and , with the CDRs from the

other domain, contribute to the formation of the

antigen binding site .

For a more detailed account of the structure of

variable domains , r eference may be made to: Poljak,

R.J ., Amzel , L.M., Avey , H.P. , Chen , B.L.,

Phizackerly , R.P. and Saul, F. , PNAS USA, ]J_,

3305-3310, 1973; Segal, D.M., Padlan, E.A., Cohen,

G. H. , Rudikoff , s. , Potter , M. and Davies , D.R., PNAS USA , 21.1 4298-4302, 1974; and Marquart, M., Deisenhofer, J., Huber , R. and Palm, w., J. Mol . Biol ., 141 , 369-391, 1980 .

In recent years advances in molecular biology based

on recombinant DNA techniques have provided

processes for the production of a wide range of

heterologous polypeptides by transformation of host

cells with heterologous DNA sequences which code for

the production of the desired products.

EP-A- 0 088 994 (Schering Corporation) proposes the

construction of recombinant DNA vectors comprising a

ds DNA sequence which codes for a variable domain of

a light or a heavy chain of an Ig specific for a


0239400

- 3 -

predetermined ligand . The ds DNA sequence is

provided with initiation and termination codons at

its 5 ' - and 3 '- termini respectively , but lacks any

nucleotides coding for amino acids superfluous to

the variable domain . The ds DNA sequence is used to

transform bacterial cells. The application does not

contemplate variations in the sequence of the

variable domain .

EP- A- 1 102 634 (Takeda Chemical Industries Limited)

describes the cloning and expression in bacterial

host organisms of genes coding for the whole or a

part of human IgE heavy chain polypeptide, but does

not contemplate variations in the sequence of the

polypeptide .

EP-A-0 125 023 (Genentech Inc.) proposes the use of

recombinant DNA techniques in bacterial cells to

produce Ig ' s which are analogous to those normally

found in vertebrate systems and to take advantage of

the gene modification techniques proposed therein to

construct chimeric Igs or other modified forms of Ig .

The term 'chimeric antibody ' is used to describe a

protein comprising at least the antigen binding

portion of an immunoglobulin molecule (Ig) attached

by peptide linkage to at least part of another

protein .

It is believed that the proposals set out in the

above Genentech application did not lead to the

expression of any significant quantities of Ig

polypeptide chains, nor to the production of Ig

activity , nor to the secretion and assembly of the

chains into the desired chimeric Igs .


0239400

- 4 -

The production of monoclonal antibodies was first disclosed by Kohler and Milstein (Kohler , G. and Milstein , c., Nature, 256 , 495-497 , 1975) . such monoclonal antibodies have found widespread use not only as diagnostic reagents (see , for example , ' Immunology for the 80s , Eds . Voller , A., Bartlett , A. , and Bidwell , D., MTP Press , Lancaster , 1981) but also in therapy (see , for example , Ritz, J. and Schlossman , S . F., Blood , ~' 1-11, 1982).

The recent emergence of t echniques allowing the stable introduction of Ig gene DNA into myeloma cell s (see , fo r example , Oi , V.T. , Morrison , S . L. , Berzenberg , L.A. and Berg , P ., PNAS USA , ~' 825-829 , 1983; Neuberger , M.S. , EMBO J ., 1, 1373-1378, 1983 ; and Ochi , T., Hawley, R.G ., Hawley , T., Schulman , M. J. , Traunecker , A. , Kohler , G. and Hozumi , N., PNAS USA , ~' 6351-6355 , 1983) , has opened up the possibility of using in vitro mutagenesis and DNA transfection to construct recombinant Igs possessing novel properties .

However , it is known that the function of an Ig molecule is dependent on its three dimensional structure , which in turn is dependent on its primary amino acid sequence. Thus , changing the amino acid sequence of an Ig may adversely affect its activity . Moreover , a change in the DNA sequence coding for the Ig may affect the ability of the cell containing the DNA sequence to express , secrete or assemble the Ig .

It is therefore. not at all clear that it will be possible to produce functional altered antibodies by recombinant DNA techniques.


0239400

- 5 -

However , colleagues of the present Inventor have

devised a process whereby chimeric antibodies in

which both parts of the protein are functional can

be secreted . The process , which is disclosed in

International Patent Application No . PCT/GB85/00392

(Neuberger et al. and Celltech Limited), comprises:

a) preparing a replicable expression vector

including a suitable promoter operably

linked to a DNA sequence comprising a

first part which encodes at least the

variable domain of the heavy or light

chain of an Ig molecule and a second part

which encodes at least part of a second

protein;

b) if necessary, preparing a replicable

expression vector including a suitable

promoter operably linked to a DNA

sequence which encodes at least the

variable domain of a complementary light

or heavy chain respectively of an Ig

molecule;

c) transforming an immortalised mammalian

cell line with the or both prepared

vectors; and

d) culturing said transformed cell line to

produce a chimeric antibody.


0239400

- 6 -

The second part of the DNA sequence may encode :

i) at least part, for instance the constant

domain of a heavy chain , of an Ig molecule of

different species, class or subclass;

ii) at least the active portion or all of an

enzyme ;

iii) a protein having a known binding specificity;

iv) a protein expressed by a known gene but

whose sequence , function or antigenicity is not

known; or

V) a protein toxin, such as ricin.

The above Neuberger application only shows the

production of chimeric antibodies in which complete

variable domains are coded for by the first part of

the DNA sequence. It does not show any chimeric

antibodies in which the sequence of the variable domain has been altered.

The present invention, in a first aspect, provides

an altered antibody in which at least parts of the

CDRs in the light or heavy chain variable domains

have been replaced by analogous parts of CDRs from

an antibody of different specificity

The determination as to what constitutes a CDR and

what constitutes a framework region was made on the

basis of the amino-acid sequences of a number of Igs . However , from the three dimensional structure

of a number of Igs it is apparent that the antigen

binding site of an Ig variable domain comprises

three looped regions supported on sheet- like structures. The loop regions do not correspond


0239400

-7-

: · exactly to the CDRs, although in general there is

considerable overlap.

Moreover , not all of the amino-acid residues in the

loop regions are solvent accessible and in one

case, amino-acid residues in the framework regions

are involved in antigen binding.(Amit, A.G . ,

Mariuzza, R.A. , Phillips , S.E.V. and Poljak , R.J.,

Science , 233 , 747-753 , 1986).

It is also known that the variable regions of the

two parts of an antigen binding site are held in the

correct orientation by inter-chain non- covalent

interactions. These may involve amino-acid residues

within the CDRs.

Thus , in order to transfer the antigen binding

capacity of one variable domain to another, it may

not be necessary to replace all of the CDRs with the

complete CDRs from the donor variable region. It

may be necessary only to transfer those residues

which are accessible from the antigen binding site,

and this may involve transferring framework region

residues as well as CDR residues .·

It may also be necessary to ensure that residues

essential for interchain interactions are preserved

in the acceptor variable domain.

Within a domain, the packing together and

orientation of the two disulphide bonded P,-sheets

(and therefore the ends of the CDR loops) are

relatively conserved. However, small shifts in

packing and orientation of these ~-sheets do occur


0239400

- 8-

(Lesk, A. M. and Chothia , c. , J. Mol. Biol ., 160, 325-342, 1982} . However, the packing together and orientation of heavy and light chain variable domains is relatively conserved (Chothia , c., Novotny , J . , Bruccoler~ , R. and Karplus , M., J. Mol . Biol; , 186 , 651- 653 , 1985} . These points will need to be borne in mind when constructing a new antigen biding site so as to ensure that packing and orientation are not altered to the deteriment of antigen binding capacity.

It is thus clear that merely by replacing one or more CDRs with complementary CDRs may not always result in a functional altered antibody . However , given the explanatiDns set out above , it will be well within the comP.etence of the man skill ed in the art , either by carrying out r outine experimentation or by trial and error testing to obtain a functional altered antibody .

Preferably , the variable domains in both the heavy and l ight chains have been altered by at least partial CDR replacement and , if necessary, by partial framework region replacement and sequence changing. Although the CDRs may be derived from an antibody of the same class or even subclass as the antibody from which the framework regions are derived, it is envisaged that the CDRs will be derived from an antibody of different class and preferably from an antibody from a different species .

Thus , it is envisaged, for instance , that the CDRs from a mouse antibody could be grafted onto the


-9-framework regions of a human antibody . This arrangement will be of particular use in the therapeutic use of monoclonal antibodies.

0239400

At present , when a mouse monoclonal antibody or even a chimeric antibody comprising a complete mouse variable domain is injected into a human, the human body ' s immune system recognises the mouse variable domain as foreign and produces an immune response thereto . Thus , on subsequent injections of the mouse antibody or chimeric antibody into the human , its effectiveness is considerably reduced by the action of the body ' s immune system against the foreign antibody. In the altered antibody of the present invention , only the CDRs of the antibody will be foreign to the body , and this should minimise side effects if used for human therapy . Although , for example, human and mouse framewor k regions have characteristic sequences , there seem to be no characteristic features which distinguish human from mouse CDRs . Thus , an antibody comprised of mouse CDRs in a human framework may well be no more foreign to t he body than a genuine human antibody.

Even with the altered antibodies of the present invention, there is likely to be an anti- idiotypic response by the recipient of the altered antibody . This response is directed to the antibody binding region of the altered antibody, It is believed that at least some anti-idiotype antibodies are directed at sites bridging the CDRs and the framework r egions . It would therefore be possible to provide a panel of antibodies having the same partial or complete CDR replacements but on a series of different framework regions . Thus, once a first altered antibody became therapeutically ineffective, due to an anti- idiotype


0239400

-10-

response , a second altered antibody from the series

could be used , and so on , to overcome the effect of

the anti-idiotype response . Thus , the useful life

of the antigen- binding capacity of the altered

antibodies could be extended.

Preferably, the altered antibody has the structure

of a natural antibody or a fragment thereof. Thus ,

the altered antibody may comprise a complete

antibody, an (Fab ' )2 fragment , an Fab fragment , a

light chain dimer or a heavy chain dimer.

Alternatively, the altered antibody may be a

chimeric antibody of the type described in the

Neuberger application referred to above. The

production of such an altered chimeric antibody can

be carried out using the methods described below

used in conjunction with the methods described in

t he Neuberger application .

The present invention , in a second aspect , comprises

a method for producing such an altered antibody

comprising :

a} preparing a first replicable expression

vector including a suitable promoter operably linked

to a DNA sequence which encodes at least a variable

domain of an Ig heavy or light chain , the variable

domain comprising framework regions from a first

antibody and CDRs comprising at least parts of the

CDRs from a second antibody of different specificity;

b) if necessary , preparing a second

replicable expression vector including a suitable

promoter operably linked to a DNA sequence which

encodes at least the variable domain of a

complementary Ig light or heavy chain respectively;


0239400

- 11-

c) transforming a cell line with the first or

both prepared vectors; and

d) culturing said transformed cell line to

produce said altered antibody .

The present invention also includes vectors used to

transform the cell line, vectors used in producing

the transforming vectors, cell lines transformed

with the transforming vectors, cell lines tranformed

with preparative vectors , and methods for their

production.

Preferably, the cell line which is transformed to

produce the altered antibody is an immortalised

mammalian cell line , which is advantageously of

lymphoid origin , such as a myeloma, hybridoma ,

trioma or quadroma cell line. The cell line may

also comprise a normal lymphoid cell , such as a

B-cell , which has been immortalised by

transformation with a virus , such as the Epstein- Barr

virus. Most preferably , the immortalised cell line

is a myeloma cell line or a derivative thereof .

Although the cell line used to produce the altered

antibody is preferably a mammalian cell line , any

other suitable cell line , such as a bacterial cell

line or a yeast cell line , may alternatively be

used. In particular, it is envisaged that E. Coli

derived bacterial strains could be used.

It is known that some immortalised lymphoid cell

lines, such as myeloma cell lines , in their normal

state secrete isolated Ig light or heavy chains. If


0239400

- 12-

such a cell line is transformed with the vector

prepared in step a) of the process of the invention,

it will not be necessary to carry out step b) of the

process, provided that the normally secreted chain

is complementary to the variable domain of the Ig

chain encoded by the vector prepared in step a).

However , where the immortalised cell line does not secrete or does not secrete a complementary chain ,

it will be necessary to carry out step b). This

step may be carried out by further manipulating the

vector produced in step a) so that this vector encodes not only the variable domain of an altered

antibody light or heavy chain , but also the complementary variable domain .

Alternatively, step b) is carried out by

preparing a second vector which is used to transform

the immortalised cell line . This alternative leads

to easier construct preparation , but may be less

preferred than the first alternative in that it may not lead to as efficient production of antibody .

The techniques by which such vectors can be produced

and used to transform the immortalised cell lines

are well known in the art , and do not form any part of the invention.

In the case where the immortalised cell line secretes a complementary light or heavy chain , the

transformed cell line may be produced for example by

transforming a suitable bacterial cell with the

vector and then fusing the bacterial cell with the

immortalised cell line by spheroplast fusion.

Alternatively, the DNA may be directly introduced into the immortalised cell line by electroporation.


0239400

- 13-

The DNA sequence encoding the altered variable

domain may be prepared by oligonucleotide

synthesis . This requires that at least the

framework region sequence of the acceptor antibody

and at least the CDRs sequences of the donor

antibody are known or can be readily determined.

Although determining these sequences, the synthesis

of the DNA from oligonucleotides and the preparation

of suitable vectors is to some extent laborious, it

involves the use of known techniques which can

readily be carried out by a person skilled in the

art in light of the teaching given here.

If it was desired to repeat this strategy to insert

a different antigen binding site , it would only

require the synthesis of oligonucleotides encoding

the CDRs, as the framework oligonucleotides can be

re-used.

A convenient variant of this technique would involve

making a symthetic gene lacking the CDRs in which

the four framework regions are fused together with

suitable restriction sites at the junctions. Double

stranded synthetic CDR cassettes with sticky ends

could then be ligated at the junctions of the

framework regions . A protocol for achieving this

variant is shown diagrammatically in Figure 6 of the

accompanying drawings .

Alternatively , the DNA sequence encoding the altered

variable domain may be prepared by primer directed

oligonucleotide site-directed mutagenesis. This


0239400

- 14-

'technique' in esse~~e i~volves hybridising an oligonucleoti'ae coding for a desired mutation with a single strand of DNA containing the region to be mutated and using the single strand as a template for extension of the oligonulcleotide to produce a strand containing the mutation. This technique , in various forms , is described by : Zoller, M.J. and Smith, M. , Nuc. Acids Res . , .!.Q., 6487- 6500 , 1982; Norris , K. , Norris F. , Christiansen, L. and Fiil, N. , Nuc . Acids Res. , 11 , 5103-5112, 1983 ; Zoller, M.J. and Smith , M. , DNA , l ' 479- 488 (1984); Kramer , w. , Schughart , K. and Fritz, w. -J., Nuc . Acids Res. , .!Q_, 6475- 6485 , 1982.

For various reasons, this technique in its simplest form does not always produce a high frequency of mutation. An improved technique for introducing both single and multiple mutations in an Ml3 based vector , has been described by Carter et al . (Carter , P . , Bedouelle H. and Winter , G. , Nuc . Acids Res. , ]d, 4431- 4443 , 1985)

Using a long oligonucleotide, it has proved possible to introduce many changes simultaneously (as in Carter et al ., loc . cit.) and thus single oligonucleotides, each encoding a CDR, can be used to introduce the three CDRs from a second antibody into the framework regions of a first antibody. Not only is this technique less laborious than total gene synthesis, but it represents a particularly convenient way of expressing a variable domain of required specificity , as it can be simpler than tailoring an entire VH domain for insertion into an expression plasmid.


0239400

-15-

The oligonucleotides used for site-directed

mutagenesis may be prepared by oligonucleotide

synthesis or may be isolated from DNA coding for the

variable domain of the second antibody by use of

suitable restriction enzymes. Such long

oligonucleotides will generally be at least 30 bases

long and may be up to or over 80 bases in length .

The techniques set out above may also be used, where

necessary, to produce the vector of part (b) of the

process.

The method of the present invention is envisaged as

being of particular use in "humanising" non-human

monoclonal antibodies . Thu? , for instance, a mouse

monoclonal antibody against a particular human cancer cell may be produced by techniques well known

in the art . The CDRs from the mouse monoclonal

antibody may then be partially or totally grafted

into the framework regions of a human monoclonal , antibody , which is then produced in quantity by a

suitable cell line . The product is thus a

specifically targetted, essentially human antibody

which will recognise the cancer cells , but will not

itself be recognised to any significant degree , by a

human ' s immune system, until the anti-idiotype

response eventually becomes apparent. Thus , the

method and product of the present invention will be

of particular use in the clinical environment.

The pr~sent invention is now described , by way of

example only , with reference to the accompanying

drawings, in which:


0239400 16

Figure 1 is a schematic diagram showing the . . structure ~f an IgG molecule;

Figure 2 shows the amino acid sequence of the VH domain of NEWM in comparison with the v8 domain of the BI-8 antibody;

Figure 3 shows the amino acid and nucleotide sequence of the HuVNP gene ;

Figure 4 shows a comparison of the results for HUVNp- IgE and MoVNp- IgE in binding inhibition assays;

Figure 5 shows the structure of three oligonucleotides used for site directed mutagenesis;

Figure 6 shows a protocol for the construction of CDR replacements by insertion of CDR cassettes into a vector containing four framework regions fused together;

Figure 7 shows the sequence of the variable domain of antibody Dl . 3 and the gene coding therefor ; and

Figure 8 shows a protocol for the cloning of the Dl . 3 variable domain gene.

EXAMPLE 1

This example shows the production of an altered antibody in which the variable domain of the heavy chains comprises the framework regions of a human heavy chain and the CDRs from a mouse heavy chain.


0239400

-17-

The framework regions were derived from the human

myeloma heavy chain NEWM, the crystallographic

structure of which is known (see Poljak et al. , loc.

cit. and Reth , M. , Hammerling , G.J. and Rajewsky;

K. , EMBO J. , l ' 629- 634 , 1982.)

The CDRs were derived from the mouse monoclonal · ·

antibody Bl-8 (see Reth et al ., loc. cit.) , which binds the hapten NP- cap (4- hydroxy- 3-nitrophenyl

acetyl- caproic acid: KNP-CAP=l . 2 JM).

A gene encoding a variable domain HuVNp , comprising

the Bl- 8 CDRs and the NEWM framework regions , was

constructed by gene synthesis as follows.

The amino acid sequence of the Vtt domain of NEWM is

shown in Figure 2, wherein it is compared to the

amino acid sequence of the VH domain of the Bl-8

antibody . The sequence is divided into framework regions and CDRs according to Kabat et al. (loc.

cit . ) . Conserved residues are marked with a line.

The amino acid and nucleotide sequence of the HuVNP

gene , in which the CDRs from the Bl-8 antibody

alternate with the framework regions of the NEWM

antibody, is shown in Figure 3. The HuVNP gene was

derived by replacing sections of the MoVNP gene i-n

the vector pSV-VNP (see Neuberger , M. S., Williams,

G.T., Mitchell , E. B. , Jouhal, s., Flanagan , J .G. and Rabbitts, T.H. , Nature, 314 , 268-270 , 1985) by a

synthetic fragment encoding the HuVNP domain . Thus

the 5' and 3' non-coding sequences , the leader sequence , the L-V intron, five N-terminal and four


0239400 - 18-

C- terminal amino acids are from the MoVNP gene and the r~st of the coding sequence is from the synthetic HuVNP fragment .

The oligonucleotides from which the HuVNP fragment was assembled are aligned below the corresponding portion of the HuVNP gene . For convenience in cloning , the ends of oligonucleotides 25 and 26b form a Hind II site followed by a Bind III site, and the sequences of the 25/26b oligonucleotides therefore differ from the HuVNP gene .

The HuVNP synthetic fragment was built as a PstI-Hind III fragment. The nucleotide sequence was derived from the protein sequence using the computer programme ANALYSEQ (Staden, R., Nuc. Acids . Res., 12, 521- 538 , 1984) with optimal codon usage taken from the sequences of mouse constant domain genes. The oligonucleotides Cl to 26b , 28 in total) vary in size from 14 to 59 residues and were made on a Biosearch SAM or an Applied Biosystems machine, and purified on SM- urea polyacrylamide gels (see Sanger , F . and Coulson, A. , FEBS Lett ., ~' 107-110 , 1978) .

The oligonucleotides were assembled in eight single stranded blocks (A-D) containing oligonucleotides

(1 , 3 , 5 , 7) (Block A) , (2 , 4 ,6,8) (block A' ) , [9 , ll,13a,13b) (Block B), [lOa, lOb,12/14) (block B' ) , [ 15 , 17] (block c) , [ 16 , 18) (block c' ) , [ 19 , 21 , 23 , 25) (block D) and (20 , 22/24, 26a, 26b) (block D').


0239400

-19-

In a typical assembly , for example of block A, 50 pmole of oligonucleotides 1 , 3,5 and 7 were phosphorylated at the 5 ' end with T4 polynucleotide kinase and mixed together with 5 pmole of the terminal oligonucleotide [l] which had been phosphorylated with 5 pCi [~-32p] ATP (Amersham 3000 Ci/rnrnole) . These oligonucleotides were annealed by heating to 80°C and cooling over 30 minutes to room temperature , with unkinased oligonucleotides 2, 4 and 6 as splints , in 150 pl of 50 mM Tris.Cl , pH 7.5, 10 mM MgCl2. For the ligation , ATP (1 mM) and DTT (lOmM) were added with 50 U T4 DNA ligase (Anglian Biotechnology Ltd . ) and incubated for 30 minutes at room temperature. EDTA was added to 10 mM, the sample was extracted with phenol, precipitated from ethanol, dissolved in 20.Jll water and boiled for 1 minute with an equal volume of formamide dyes . The sample was loaded onto and run on a 0.3 mm SM- urea 10% polyacrylamide gel . A band of the expected size was detected by autoradiography and eluted by soaking.

Two full length single strands were assembled from blocks A to D and A' to D' using splint oligonucleotides . Thus blocks A to D were annealed and ligated in 30 y1 as set out in the previous paragraph using 100 pmole of oligonucleotides lOa , 16 and 20 as splints. Blocks A' to D' were ligated using oligonucleotides 7, 13b and 17 as splints .

After phenol/ether extraction, block A- D was annealed with block A'-D ', small amounts were cloned in the vector Ml3mpl8 (Yanish- Perron , c ., Vieira , J . and Messing , J ., Gene , ]l , 103- 119 , 1985) cut with PstI and Hind III , and the gene sequenced by the


0239400

- 20-

dideoxy techni~ue (Sanger, F., Nicklen, s. and Coulson, A.R., PNAS USA, 74, 5463-5467 , 1979).

The MoVNP gene was transferred as a Hind III - BarnHI fragment from the vector pSV-VNP (Neuberger et al., loc. cit.) to the vector Ml3mp8 (Messing , J . and Vieira, J., Gene , 11_ , 269-276 , 1982). To facilitate the replacement of MoVNP coding sequences by the synthetic HuVNP fragment , three Hind II sites were removed from the 5 ' non- coding sequence by site directed mutagenesis, and a new Hind II site was subsequently introduced near the end of the fourth framework region (FR4 in Figure 2). By cutting the vector with PstI and Hind II , most of the VNP fragment can be inserted as a PstI-Hind II fragment. The sequence at the Hind II site was corrected to NEWM FR4 by site directed mutagenesis.

The Hind III - Barn HI fragment , now carrying the HuVNP gene , was excised from Ml3 and cloned back into pSV-VNP to replace the MoVNP gene and produce a vector pSV-HuVNP· Finally , the genes for the heavy chain constant domains of human Ig E (Flanagan, J.G. and Rabbitts, T.H., EMBO J ., .!1 655-660, 1982) were introduced as a Barn HI fragment to give the vector pSV-HuVNP· HE . This was transfected into the myeloma line J558 L by spheroplast fusion.

The sequence of the HuVNP gene in pSV-HuVNP· HE was checked by recloning the Hind III-Barn HI fragment back into Ml3mp8 (Messing et al., loc. cit . ) . J558L myeloma cells . secrete lambda 1 light chains which ' . have been shown to associate with heavy chains containing the MoVNP variable domain to create a


0239400

- 21-

binding site for NP- cap or the related hapten

NIP-Cap (3- iodo- 4- hydroxy-5-nitrophenylacetyl-

caproic acid) (Reth, M., Hammerling , G.J. and

Rajewsky , K., Eur. J . Immunol. , ~, 393- 400 , 1978) .

As the plasmid pSV-HuVNp.HE contains the .9£!: marker , stably transfected myeloma cells could be selected

in a medium containing mycophenolic acid.

Transfectants secreted an antibody (HuVNp- IgE) with

heavy chains comprising a HuVNP variable domain

(i.e. a "humanised" mouse var iable r egion) and

human O constant domains , and lambda 1 light chains from the J558L myeloma cells .

The cul ture supernatants of several gpt+ clones were

assayed by radioimmunoassay and found to contain

NIP- cap binding antibody . The antibody secreted by

one such clone was purified from culture super natant

by affinity chromatography on NIP-cap Sepharose

(Sepharose is a registered trade mark). A

polyacrylamide - SDS gel i ndicated that the protein

was indistinguishable from the chimer ic antibody

MoVNp- IgE (Neuberger et al. , loc . cit . ).

The HuVNp-IgE antibody competes effectively with the

MoVNp-IgE for binding to both anti-human-IgE and to

NIP- cap coupled to bovine serum albumin .

Various concentrations of HuVNp- IgE and MoVNp- IgE

were used to compete the binding of r adiolabelled

MoVNp- IgE to polyvinyl microtitre plates coated with

(a) Sheep anti- human-IgE antiserum (Seward

Laboratories) ; (b) NIP-cap-bovine serum albumi n; (c)

Ac38 anti- idiotypic antibody ; (d) Ac 146

anti- idiotypic antibody; and (e) rabbit anti- MoVNP


0239400

- 22 -

antiserum. Binding was also carried out in the presence of MoVNp-IgM antibody (Neuberger, M.S. , Williams, G.T. and Fox , R.O ., Nature, 312, 604-608, 1984) or of JWS/1/2 which is an IgM antibody differing from the MoVNp-IgM antibody at 13 residues mainly located in the VH CDR2 region.

The results of the binding assays are shown in Figure 4, wherein black circles represent HuVNP r white circles MoVNPr black squares MoVNp-IgM and white squares JWS/1/2. Binding is given relative to the binding in the absence of the inhibitor .

The affinities of HuVNp-IgE for NP-cap and NIP-cap were then measured directly using the fluorescence quench technique and compared to those for MoVNP-IgE, using excitation at 295 nm and observing emission at 340 nm (Eisen, · H.N ., Methods Med. Res. , .!.Q_, 115-121 , 1964) .

Antibody solutions were diluted to 100 nM in phosphate buffered saline, filtered (0.45 pm pore cellulose acetate) and titrated with NP- cap in the range 0.2 to 20 JM· As a control , mouse DI-3 antibody (Mariuzza, R.A., Jankovic, D.L., Bulot , G., Amit , A.G ., Saludjian , P. , Le Guern , A., Mazie , J.C. and Poljak , R.J., J. Mol. Biol . , 170 , 1055- 1058 , 1983), which does not bind hapten , was titrated in parallel.

Decrease in the ratio of the fluorescence of HuVNp-IgE or HuVNp- IgE to the fluorescence of the Dl-3 antibody was taken to be proportional to NP-cap occupancy of the antigen binding sites . The maximum


0239400

- 23 -

quench was about 40% for both antibodi~s , and hapten dissociation constants were determined from least-squares fits of triplicate data sets to a hyperbola.

For NIP- cap , hapten concentration varied from 10 to 300 nM , and about 50% quenching of fluorescence was observed at saturation . Since the antibody concentrations were comparable to the value of the dissociation constants, data were fitted by least squares to an equation describing tight binding inhibition (Segal , I .H., in "Enzyme Kinetics", 73-74 , Wiley , New York, 1975).

The binding constants obtained from these data for these antibodies are shown in Table 1 below.

MoVNp-IgE HuVNp-IgE

Table l

KNP- cap

1 . 2 )lM 1 . 9 JIM

KNrP- cap

0. 02 J1M

0 . 07 JlM

These results show that the affinities of these antibodies are similar and that the change in affinity is less than would be expected for the loss of a hydrogen bond or a van der Waals contact point at the active site of an enzyme.

Thus , it has been shown that it is possible to produce an antibody specific for an artificial small hapten, comprising a variable domain having human framework regions and mouse CDRs, without any significant loss of antigen binding capacity.


0239400

- 24-

As shown in Figure 4(d), the HuVNp- IgE antibody has lost the MoVNP idiotypic determinant recognised by the antibody Acl46. Furthermore , HuVNp- IgE also binds the Ac38 antibody less well {Figure 4(c)), and it is therefore not surprising that HuVNp-IgE has lost many of the determinants recognised by the polyclonal rabbit anti-idiotypic antiserum {Figure 4(e)).

It can thus be seen that, although the HuVNp-IgE antibody has acquired substantially all the antigen binding capacity of the mouse CDRs , it has not acquired any substantial proportion of the mouse antibody ' s antigenicity .

The results of Figures 4{d) and 4(e) carry a further practical implication. The mouse {or human) CDRs could be transferred from one set of human frameworks {antibody l) to another {antibody 2). In therapy , anti-idiotypic antibodies generated in response to antibody 1 might well bind poorly to antibody 2 . Thus , as the anti- idiotypic response starts to neutralise antibody 1 treatment could be continued with antibody 2 , and the CDRs of a desired specificity used more than once.

For instance, the oligonucleotides encoding the CDRs may be used again , but with a set of oligonucleotides encoding a different set of framework regions.

The above work has shown that antigen binding characteristics can be transferred from one framework to another without loss of activi ty , so


0239400

- 25-

long as the original antibody is specific for a

small hapten.

It is known that small haptens generally fit into an

antigen binding cleft. However , this may not be

true for natural antigens , for instance antigens

comprising an epitopic site on a protein or

polysaccharide. For such antigens , the antibody

may lack a cleft (it may only have a shallow

concavity) , and surface amino acid residues may play

a significant role in antigen binding . It is

therefore not readily apparent that the work on

artificial antigens shows conclusively that CDR

replacement could be used to transfer natural antigen binding properties .

Therefore work was carried out to see if CDR

replacement could be used for this purpose . This

work also involved using primer- directed ,

oligonucleotide site- directed mutagenesis using

three synthetic oligonucleotides coding for each of

the mouse CDRs and the flanking parts of framework

regions to pr oduce a variable domain gene similar to

the HUVNP gene.

EXAMPLE 2

The three dimensional structure of a complex of

lysozyme and the antilysozyme antibody Dl.3 (Amit et

al ., loc . cit.) was solved by X- ray

crystallography . There is a large surface of

interaction between the antibody and antigen. The

antibody has two heavy chains of the mouse IgGl

class (H) and two Kappa light chains (K) , and is

denoted below as H2K2 .


0239400

-26-

The DNA sequence of the heavy chain variable

region was determined by making cDNA from the mRNA

of the Dl . 3 hybridoma cells, and cloning into

plasmid and Ml3 vectors . The sequence is shown in

Figure 7, in which the boxed residues comprise the

three CDRs and the asterisks mark residues which

contact lysozyme .

Three synthetic oligonucleotides were then designed

to introduce the Dl . 3 VHCDRs in place of the VHCDRs

of the HuVNP gene . The HuNP gene has been cloned

into Ml3mp8 as a BamHI- Hind III

fragment , as described above . Each oligonucleotide

has 12 nucleotides at the 5 ' end and 12 nucleotides

at the 3 ' end which are complementary to the

appropriate HuVNP framework regions. The central

portion of each oligonucleotide encodes either CDRl ,

CDR2 , or CDR3 of the Dl . 3 antibody, as shown in

Figure 5, to which reference is now made . It can be

seen from this Figure that these oligonucleotides

are 39, 72 and 48 nucleotides long respectively .

10 pmole of Dl . 3 CDRl primer was phosphorylated at

the 5 ' end and annealed to lpg of the Ml3-HuVNP

template and extended with the Klenow fragment of

DNA polymerase in the presence of T4 DNA ligase .

After an oligonucleotide extension at 15°C , the

sample was used to transfect E. Coli strain BHM71/18

mutL and plaques gridded and grown up as infected

colonies .

After transfer to nitrocellulose filters , the

colonies were probed at room temperature with 10

pmole of Dl . 3 CDRl primer labelled at the 5 ' end


0239400 - 27-

with 30 yc132_p-ATP. After a 3" wash at 60°C,

autoradiography revealed about 20% of the colonies

had hybridised well to the probe. All these

techniques are fully described in "Oligonucleotide

site-directed mutagenesis in Ml3 " an experimental

manual by P . Carter, H. Bedouelle, M.M.Y. Waye and

G. Winter 1985 and published by Anglian

Biotechnology Limited , Hawkins Road , Colchester ,

Essex C02 8JX. Several clones were sequenced, and

the replacement of HuVNP CDRl by D.13 CDRl was

confirmed . This Ml3 template was used in a second

round of mutagenesis with Dl . 3 CDR2 primer; finally

template with both CDRs 1&2 replaced was used in a

third round of mutagenesis with D.13 CDR3 primer.

In this case , three rounds of mutagenesis we~e

used.

The variable domain containing the Dl.3 CDRs was

then attached to sequences encoding the heavy chain

constant regions of human IgG2 so as to produce a

vector encoding a heavy chain Hu*. The vector was

transfected into J558L cells as above. The antibody

Hu*2L2 is secreted.

For comparative purposes, the variable region gene

for the Dl.3 antibody was inserted into a suitable

vector and attached to a gene encoding the constant

regions of mouse IgGl to produce a gene encoding a

heavy chain H* with the same sequence as H. The

protocol for achieving this is shown in Figure 8 .

As shown in Figure 8, the gene encoding the Dl.3

heavy chain V and CHl domains and part of the hinge

region are cloned into the Ml3mp9 vector .


0239400

-28-

The vector (vector A) is then cut with NcoI , blunted

with Klenow polymerase and cut with PstI . The

PStI-NcoI fragment is purified and cloned into

PstI- HindII cut MVNP vector to replace most of the

MVNP coding sequences . The MVNP vector comprises

the mouse variable domain gene with its promoter , 5'

leader , and 5 ' and 3 ' intrans cloned into Ml3mp9 .

This product is shown as vector B in Figure 8.

Using site directed mutagenesis on ~he single

stranded template of vector B with two primers , the

sequence encoding the N- terminal portion of the c8 1 domain and the Pstr site near the N-terminus of the

V domain are removed . Thus the V domain of Dl . 3 now

replaces that of VNP to produce vector C of Figure 8.

Vector c is then cut with HindIII and BamHI and the fragment formed thereby is inserted into

HindIII/BamHI cut Ml3mp9 . The product is cut with

Hind III and SacI and the fragment is inserted into

PSV- VNP cut with Hind III/SacI so as to replace the

VNP variable domain with the Dl.3 variable domain .

Mouse IgGl constant domains are cloned into the

vector as a SacI fragment to produce vector D of

Figure 8.

Vector D of Figure 8 is transfected into J558L cells

and the heavy chain H* is secreted in association

with the lambda light chain L as an antibody H*2L2.

Separated K or L light chains can be produced by

treating an appropriate antibody (for instance Dl . 3

antibody to produce K light chains) with

2- mercaptoethanol in guanidine hydrochloride ,


0239400 -29-

blocking the free interchain sulphydryls with iodoacetamide and separating the dissociated heavy and light chains by HPLC in guanidine hydrochloride .

Different heavy and light chains can be reassociated to produce functional antibodies by mixing the separated heavy and light chains, and dialysing into a non- denaturing buffer to promote re- association and refolding . Properly reassociated and folded antibody molecules can be purified on protein A-sepharose columns . Using appropriate combinations of the above procedures , the following antibodies were prepared .

H2K2 H*2L2 H*2K2 Hu*2L2

(Dl 3 antibody) (Dl.3 heavy chain , lambda light chain) (recombinant equivalent of Dl.3) ( "humanised" Dl.3 heavy chain , lambda light chain) {"humanised" Dl . 3)

The antibodies containing the lambda light chains were not tested for antigen binding capacity. The other antibodies were, and the results are shown in Table 2.

Antibody

Dl. 3 (H2K2) Dl. 3 (H2K2) (reassociated)

Table 2

Dissociation constant for lysozyme (nM)

14.4

15.9, 11.4

, I


recombinant Dl . 3 (H*2K2)

(reassociated)

"humanised" Dl. 3 (Hu2K2)

(reassociated)

-30-

0239400

9 . 2

3.5 , 3.7

The affinity of the antibodies for lysozyme was

determined by fluorescent quenching, with excitation

at 290nm and emission observed at 340nm Antibody

solutions were diluted to 15-30pg/mg in phosphate

buffered saline, filtered (0.45 um-cellulose

acetate) and titrated with hen eggwhite lysozyme .

There is a quenching of fluorescence on adding ·the

lysozyme to the antibody ( ) 100% quench) and data

were fitted by least squares to an equation

describing tight binding inhibition (I.H. Segal in

Enzyme Kinetics, p73- 74, Wiley , New York 1975).

Although at first sight the data suggest that the

binding of the "humanised" antibody to lysozyme is

tighter than in the original Dl . 3 antibody , this

remains to be confirmed. It is clear however that

the humanised antibody binds lysozyme with a

comparable affinity to Dl.3

Further work (with another antibody-CAMPATHI) has

shown that CDRs 1,2 and 3 can be exchanged

simultaneously, by priming as above with all three

primers. 10% hybridisation positives were detected

by screening with the CDRl primer; 30% of these

comprised the triple mutant in which all the CDRs

were replaced.


0239400

-31-

It has therefore been shown that CDR replacement can

be used not only for artificial antigens (haptens) . . but also for natural antigens , thereby showing that

the present invention will be of therapeutic use .

It will of course be understood that the present

invention has been described above purely by way of

example, and modifications of detail can be made

within the scope of the invention as defined in the

appended claims .


0239400

- 32-

CLAIMS

1. An altered antibody in which at least parts of

the complementarity determining regions (CDRs) in

the light or heavy chain variable domains have been

replaced by analogous parts of CDRs from an antibody

of different specificity.

2 . The altered antibody of claim 1 , in which the

entire CDRs have been replaced.

3 . The altered antibody of claim 1 or claim 2 , in

which the variable domains in both the heavy and

light chains have been altered by CDR replacement .

4 . The altered antibody of any one of claims 1 to

3 in which the CDRs from a mouse antibody are

grafted onto the framework regions of a human

antibody .

5. The altered antibody of any one of claims 1

to 4, which has the structure of a natural antibody

or a fragment thereof.

6 . A method for producing an altered antibody

comprising:

a) preparing a first replicable expression

vector including a suitable promoter operably linked

to a DNA sequence which encodes at least a variable

domain of an Ig heavy or light chain , the variable

domain comprising framework regions from a first

antibody and CDRs comprising at least parts of the

CDRs from a second antibody of different specificity;


0239400 -33-

b) if necessary , preparing a second replicable expression vector including a suitable promoter ope(ably linked to a DNA sequence which encodes at least the variable domain of a complementary Ig light or heavy chain respectivelyi

c) transforming a cell line with the first or both prepared vectors ; and

d) culturing said transformed cell line to produce said altered antibody.

7. The method of claim 6 , in which the cell line which is transformed to produce the altered antibody is an immortalised mammalian cell line.

8 . The method of claim 7 , in which the immortalised cell line is a myeloma cell line or a derivative thereof.

9. The method of any one of claims 6 to 8 , in which the DNA sequence encoding the altered variable domain is prepared by oligonucleotide synthesis.

10. The method of any one of claims 6 to 8 , in which the DNA sequence encoding the altered variable domain is prepared by primer directed oligonucleotide site-directed mutagenesis using a long oligonucleotide.


0239400

Fig. 1

- domains tM - inter-domain sections

- disulphide bonds

v - variable c - constant l - light chain H - heavy chain


NE'-IM

81-9

FR1 ' --- ----30 XUQLQESGPGLURPSQTLSLTCTUSGSTFS

QUQLQQPGAELUKPGASUKLSCKASGYTFT

FR2 3f>- - 49

NE'-IM LJURQPPGRGLBI I G 01-e IJUKQRPGRGLELJ I G

FR3

COA1 31

NOYYT35

SYLJMH

SO COR2 f>S YUFYHGTSODTTPLRS RIDPHSGGTKYHEKFKS

66-- --- 04 05 CDRJ 102 NLI AGC I OU NEUM RUTMLUOTSKNQFSLRLSSUTRADTAUYYCAR

e1-0 KATLTUOKPSSTAYMQLSSLTSEOSAUYYCAR - - -- ----FR4

103- -113 NEUN i.IGQGSLUTUSS 01-0 LJGQGTTL TUSS - -

YOYYGSSYFDY

Fig. 2

/ "-) ·'-.-._

··Y

0 N w (.,0

+--0 0


0239400

1Hindi11 -48 -23_ -7_

5· .. . . .. ...... . ATGCAAATCCTCTGAATCTACATGGTAAATATAGGTTTGTCTATAC

11--t RNA starts II--+ RNA starts CACAAACAGAAAAACATGAGATCACAGTTCTCTCTACAGTTACTGAGCACACAGGACCTC

NP leader Splice In o w s c 1 1 L F L u A r A rl!

ACCATGGGATGGAGCTGTATCATCCTCTTCTTGGTAGCAACAGCTACAGGTAAGGGGCTC

ACAGTAGCAGGCTTGAGGTCTGGACATATATATGGGTGACAF\TGACATCCACTTTGCCTT

Sp I ice 1 :S Ps ti 10 !G U H S Q U Q l Q ! E S G P G L U R

TCTCTCCACAGGTGTCCACTCCCAGGTCCAACTGCA GGAGAGCGGTCCAGGTCTTGTGAG s· 1----3' ----2----.---

15 20 25 30 COAt · p s Q T l s l T c T v s G s T F sis y w)

ACCTAGCCAGACCCTGAGCCTGACCTGCACCGTGTCTGGCAGCACCTTCAGCAGCTACTG _J 3 s "-7---- 4 o e---

35 40 45 50 COR2 52A

~n-H"""")w u Ra PP G R G L Eu 1 olR 1 o Pl GATGCACTGGGTGAGACAGCCACCTGGACGAGGTCTTGAGTGGATTGGAAGGATTGATCC --7 9a 9b '--11----. .---1oa 1ob---, 12114--

ss COR2 60 65 70 N S G G T k V N E K F K SIR V T M L U D

TAATAGTGGTGGTACTAAGTACAATGAGAAGTTCAAGAGCAGAGTGACAATGCTGGTAGA ---11 L-- t3a 13b-----' '---15------12/ 14 16---

75 ea e2A e c es T S k N Q F S L R l S S V T A A 0 T A U

CACCAGCAAGAACCAGTTCAGCCTGAGACTCAGCAGCGTGACAGCCGCCGRCACCGCGGT -1s 11 to----,-----10-------.. .-----20---

90 95 COR3 100A B C 105

v v c A Riv D y v G s s y F 0 vlw G Q G CTATTATTGTGCAAGATACGATTACTACGGTAGTAGCTACTTTGACTACTGGGGTCAAGG --19 21 23 L-------------22/24 ,--26a-

110 !Splice 1eomHI SLUTVSS "

CAGCCTCGTCACAGTCTCCTCAGGT ..... . -193bp · · ·· · 3 · -2S--GACA 3' --., r26b- CTGTTCGA 5'

Fig. 3


Anti-human E:. • Q... NIP24 -BSA 0

1001- "X~ ::--. ' .... -- ' ~ 'o.. • HuVNP \ \ ~ \ \

\ ' \ \ . CJ'>

50 \ ' ~ c Mo v NP \ MoV NP 'a., -0

c '....,,~ \ . Fig. 4 ..0 'o,. \ -~.::::-

\ 0 -~ \ HuVNP -+J \ \ c \ ' '~HuV o

0239400

.)/?'

Fig. 5 Hindi II 2 3 s· BemHI

FRI FR4

CORI COR2 CDR3

HuVNP gene cloned in M13mp8

01 .3 CDR I oligonucleotide s· CTG,TCT,CAC,CCA,GTI,TAC,ACC,ATA,GCC,GCT ,GAA,GGT,GCT

FR2 01.3COR1 FRI

D 1.3 CDR2 oltgonucleotide S' CAT ,TGT,CAC,TCT,GGA,TTT ,GAG,AGC,TGA,ATT,AT A,GTC,TGT,

FR3 01 .3 CDR2 GTT ,TCC,ATC,ACC,CCA,AAT ,CAT ,TCC,AAT ,CCA,CTC

D 1.3 CDR2 FR2

D 1.3 COR3 oligonucleotide . 5' GCC,TTG,ACC,CCA,GTA,GTC,AAG,CCT ,ATA,ATC,TCT,CTC,TCT,

FR4

TGC,ACA,AT A

FR3

01 .3 CDR3


1..11 Vf I

RESTRICTION SITES

1 2 3

, ,.., •• •.v.v.•.•,v.•.',Y.;f I

VECTOR FRl f R2 f R3

( 1) Diqest vector / FR 1-4 at restriction sites 1, 2, & 3.

{2) L1gate CDR sticky end duplexes 1, 2 & 3.

CDR 1 + CDR2

+ CDR3

w ... .w.• • .fa.w;,• h

0239400

FR4 VECTOR

VECTOR FRl CDR 1 f R2 CDR2 FR3 CDR3 FR4 VECTOR

....

ft,g . t-. -15 SI GNAL - 10 -5

IM A u L A L L F c L u T F p s c I LI TCAGAGCATGGCTGTCCTGGCATTACTCTTCTGCCTGGTAACATTCCCAAGCTGTATCCT -1 +1 5 10 15

c::§J Q U Q L K E S G P G L U A P S Q S L S TTCCCAGGTGCAGCTGAAGGAGTCAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTGTC

CA J · 20 25 >I< * * CDR 1 35

I T c T u s G F s L T IG y G u NI w u R Q CATCACATGCACCGTCTCAGGGTTCTCATTAACCGGCTATGGTGTAAACTGGGTTCGCCA

40 45 50 * * * SS CDR2 p p G K G L E w L G IM I w G 0 G N T D YI

GCCTCCAGGAAAGGGTCTGGAGTGGCTGGGAATGATTTGGGGTGATGGAAACACAGACTA

60 COR2 65 70 75 I N s A L K s I R L s 1 s K o N ·s K s Q v F TAATTCAGCTCTCAAATCCAGACTGAGCATCAGCAAGGACAACTCCAAGAGCCAAGTTTT

80 82A B C I 85 90 95 * L K H N S l H T D D T A R Y Y C A R [[::Bl

CTTAAAAATGAACAGTCTGCACACTGATGACACAGCCAGGTACTACTGTGCCAGAGAGAG +-----

* >1< >1< COR3 105 110 I D y R L D YI w G Q G T T L T u s s AGATTATAGGCTTGACTACTGGGGCCAAGGCACCACTCTCACAGTCTCCTCA -- 0---+ JH 2 ". - ---- -4


A

B

c

D

:;,!~ . I . ' .

C:·o ,.g ·-~~:a · · ·:. .

V domain CH1 domain hinge

I I 11 1*i"'"'."'-*'""'%lfil\llMM I

H3 P B P N E

VNP promoter leader, N-term

lrl .., H3 p

V NP promoter leader, N-term

V domain

Cl V domain I 15$ H3

VNP c-term, 3 ' intron

N 8 E

VNP c-term, 3' intron

e I I 8 E

0239400

~ ..

VNP promoter leader, N-term

VNP c-term, 3' int ron

mouse lgG1 genomic clone

G V domain CH1 hinge 1r1~-ED-~1SaJC=====1B-..,----1l'imJ~•·f-Effiii\mBl·@iiJ-HWM·• 1 I

CH2 CH3 .

H3 s S B

H3 =Hindi II, p = Pstl B = BamHI N - .N I , , - co , E = EcoRI, H2 = Hindll


1 of 41 celltrion, inc., exhibit 1073 · 2017. 5. 10. · t ., schulman , m. j. traunecker , a. ,...

Documents