1 tiktaalik discovered in 2004 on ellesmere island, canada. fossil dated to 385 - 359 million years...
TRANSCRIPT
![Page 1: 1 Tiktaalik Discovered in 2004 on Ellesmere Island, Canada. Fossil dated to 385 - 359 million years ago](https://reader035.vdocument.in/reader035/viewer/2022070412/5697bf861a28abf838c88547/html5/thumbnails/1.jpg)
1
Tiktaalik
TiktaalikDiscovered in 2004 on Ellesmere Island, Canada.
Fossil dated to 385-359 million years ago
![Page 2: 1 Tiktaalik Discovered in 2004 on Ellesmere Island, Canada. Fossil dated to 385 - 359 million years ago](https://reader035.vdocument.in/reader035/viewer/2022070412/5697bf861a28abf838c88547/html5/thumbnails/2.jpg)
2
Archaeopteryx
Fossil dated to 150 Million years ago
![Page 3: 1 Tiktaalik Discovered in 2004 on Ellesmere Island, Canada. Fossil dated to 385 - 359 million years ago](https://reader035.vdocument.in/reader035/viewer/2022070412/5697bf861a28abf838c88547/html5/thumbnails/3.jpg)
3
Nostrils
Source: evolution.berkeley.edu
![Page 4: 1 Tiktaalik Discovered in 2004 on Ellesmere Island, Canada. Fossil dated to 385 - 359 million years ago](https://reader035.vdocument.in/reader035/viewer/2022070412/5697bf861a28abf838c88547/html5/thumbnails/4.jpg)
![Page 5: 1 Tiktaalik Discovered in 2004 on Ellesmere Island, Canada. Fossil dated to 385 - 359 million years ago](https://reader035.vdocument.in/reader035/viewer/2022070412/5697bf861a28abf838c88547/html5/thumbnails/5.jpg)
“Fossil” beta globinScientists have discovered that The Antarctic Ice Fish (Chaenocephalus aceratus) does not have any red blood cells. Instead of transporting oxygen through their blood, they absorb oxygen from the water through their skin and large gills.
It is discovered that the ice fish genome contains a segment that looks like the beta globin gene found in closely-related fish, but is not functional.
Ice fish genome
Looks like a broken down beta globin gene
![Page 6: 1 Tiktaalik Discovered in 2004 on Ellesmere Island, Canada. Fossil dated to 385 - 359 million years ago](https://reader035.vdocument.in/reader035/viewer/2022070412/5697bf861a28abf838c88547/html5/thumbnails/6.jpg)
6
Human chromosome 2
Human chromosome 2
Chimp chromosomes 2q and 2p
Looks like a centromere
Humans have 23 pairs of chromosomes. All other ape species have 24 pairs.
centromeres
![Page 7: 1 Tiktaalik Discovered in 2004 on Ellesmere Island, Canada. Fossil dated to 385 - 359 million years ago](https://reader035.vdocument.in/reader035/viewer/2022070412/5697bf861a28abf838c88547/html5/thumbnails/7.jpg)
Vestigial parts• Humans have much smaller appendices than herbivorous animals. • In herbivorous animals, but not in humans, the appendix serves to aid digestion of plant material. • It is still unclear what function, if any, the appendix serves in humans.
• Humans have a small immobile tail made up of four fused vertebrae.• In other primates, these vertebrae are not fused and allow the tail to move, aiding in balance and mobility.
![Page 8: 1 Tiktaalik Discovered in 2004 on Ellesmere Island, Canada. Fossil dated to 385 - 359 million years ago](https://reader035.vdocument.in/reader035/viewer/2022070412/5697bf861a28abf838c88547/html5/thumbnails/8.jpg)
![Page 9: 1 Tiktaalik Discovered in 2004 on Ellesmere Island, Canada. Fossil dated to 385 - 359 million years ago](https://reader035.vdocument.in/reader035/viewer/2022070412/5697bf861a28abf838c88547/html5/thumbnails/9.jpg)
Guppy experiment #1
Initial observations: Scientists observe that male guppies that stand out from their surroundings attract more females
evolution.berkeley.edu
![Page 10: 1 Tiktaalik Discovered in 2004 on Ellesmere Island, Canada. Fossil dated to 385 - 359 million years ago](https://reader035.vdocument.in/reader035/viewer/2022070412/5697bf861a28abf838c88547/html5/thumbnails/10.jpg)
Guppy experiment #2
evolution.berkeley.edu
![Page 11: 1 Tiktaalik Discovered in 2004 on Ellesmere Island, Canada. Fossil dated to 385 - 359 million years ago](https://reader035.vdocument.in/reader035/viewer/2022070412/5697bf861a28abf838c88547/html5/thumbnails/11.jpg)
Staphylococcus aureus
• Bacteria commonly found on mucous membranes and skin
• Can cause infections (Staph infections)• Penicillin introduced as antibiotic in 1940– very effective against Staph in the early 1940’s
• 95% of staph strains now resistant to penicillin• Many strains are now resistant to multiple
antibiotics: penicillin, methicillin, tetracycline– MRSA: Methicillin-resistant Staphylococcus aureus
![Page 12: 1 Tiktaalik Discovered in 2004 on Ellesmere Island, Canada. Fossil dated to 385 - 359 million years ago](https://reader035.vdocument.in/reader035/viewer/2022070412/5697bf861a28abf838c88547/html5/thumbnails/12.jpg)
![Page 13: 1 Tiktaalik Discovered in 2004 on Ellesmere Island, Canada. Fossil dated to 385 - 359 million years ago](https://reader035.vdocument.in/reader035/viewer/2022070412/5697bf861a28abf838c88547/html5/thumbnails/13.jpg)
Nested traitsNucleus Chloroplast Seeds Nervous
systemJaws Placenta Feathers
Bacteria
Algae X X
Corn X X X
Palm Tree X X X
Jellyfish X
Starfish X X
Human X X X X
Cow X X X X
Crocodile X X X
Robin X X X X
Cardinal X X X X
![Page 14: 1 Tiktaalik Discovered in 2004 on Ellesmere Island, Canada. Fossil dated to 385 - 359 million years ago](https://reader035.vdocument.in/reader035/viewer/2022070412/5697bf861a28abf838c88547/html5/thumbnails/14.jpg)
Comparing DNA
Species Partial sequence of beta globin gene
Human ATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGG
Macaque ATGGTGCATCTGACTCCTGAGGAGAAGAATGCCGTCACCACCCTGTGG
Mouse ATGGTGCACCTGACTGATGCTGAGAAGGCTGCTGTCTCTGGCCTGTGG
Rat ATGGTGCACCTGACTGATGCTGAGAAGGCTGCTGTTAATGGCCTGTGG
Dog ATGGTGCATCTGACTGCTGAAGAGAAGAGTCTTATCTCCAGCATGTGG