12 november 2009 doi:10.1038/nature08549 letters · so far, the transcription factor foxp2...

LETTERS

Human-specific transcriptional regulation of CNSdevelopment genes by FOXP2Genevieve Konopka1,3, Jamee M. Bomar1,3, Kellen Winden1,3, Giovanni Coppola3, Zophonias O. Jonsson5,Fuying Gao3, Sophia Peng3, Todd M. Preuss6, James A. Wohlschlegel5 & Daniel H. Geschwind1,2,3,4

The signalling pathways controlling both the evolution anddevelopment of language in the human brain remain unknown.So far, the transcription factor FOXP2 (forkhead box P2) is theonly gene implicated in Mendelian forms of human speech andlanguage dysfunction1–3. It has been proposed that the amino acidcomposition in the human variant of FOXP2 has undergoneaccelerated evolution, and this two-amino-acid change occurredaround the time of language emergence in humans4,5. However,this remains controversial, and whether the acquisition of theseamino acids in human FOXP2 has any functional consequence inhuman neurons remains untested. Here we demonstrate thatthese two human-specific amino acids alter FOXP2 function byconferring differential transcriptional regulation in vitro. Weextend these observations in vivo to human and chimpanzee brain,and use network analysis to identify novel relationships among thedifferentially expressed genes. These data provide experimentalsupport for the functional relevance of changes in FOXP2 thatoccur on the human lineage, highlighting specific pathways withdirect consequences for human brain development and disease inthe central nervous system (CNS). Because FOXP2 has an import-ant role in speech and language in humans, the identified targetsmay have a critical function in the development and evolution oflanguage circuitry in humans.

The amino acid structure of FOXP2 had been highly conservedalong the mammalian lineage until the common ancestor of humansand chimpanzees, when the human variant of FOXP2 acquired twodifferent amino acids under positive selection, which has been inter-preted as evidence for accelerated evolution4,5. To test whether theamino acids under positive selection in human FOXP2 have a distinctbiological function, which would support the role of these changes inevolution, we expressed either human FOXP2 or the same constructmutated at two sites to yield the chimpanzee amino acid content,FOXP2chimp, in human neuronal cells without endogenous FOXP2(Fig. 1a–f). Exogenous FOXP2 protein expressed from both con-structs was localized in the nucleus as determined by immunocyto-chemistry (Fig. 1c–e) and subcellular fractionation (Fig. 1f), con-sistent with its endogenous expression. To determine if modifyingtwo amino acids leads to changes in gene expression, we conductedwhole-genome microarray analysis. We identified 61 genes signifi-cantly upregulated and 55 genes downregulated by FOXP2 comparedto FOXP2chimp (Supplementary Table 1), as well as genes regulated byboth FOXP2 and FOXP2chimp (Supplementary Table 2). Notably,FOXP2chimp overexpression resulted in more changes in gene regu-lation than FOXP2 (Supplementary Table 3). In replicate experi-ments in a different human neuronal cell line, FOXP2chimp againregulated more genes than FOXP2 even though its expression was

higher than FOXP2 in these cells (data not shown). To control for anypotential confounding effects of FOXP2 levels, we performed corre-lations of the levels of every gene on the array to either FOXP2 orFOXP2chimp levels, as well as performing random permutation test-ing, and found no significant differences between other genes’ cor-relations to either FOXP2 or FOXP2chimp. These data indicate thatthe differentially expressed genes are not due to different levels ofFOXP2 or FOXP2chimp, and are a true indication of differential tran-scriptional regulation by these two proteins.

To confirm the validity of differentially expressed FOXP2 targetgenes, we conducted quantitative polymerase chain reaction followingreverse transcription (qRT–PCR) using independent RNA samples.We confirmed 93% of the FOXP2 upregulated genes and 75% of thedownregulated genes examined (Fig. 1g, h and Supplementary Fig. 1).Five genes confirmed by qRT–PCR (COL9A1, ROR2, SLIT1, SYK, andTAGLN; Fig. 1g, h and Supplementary Fig. 1) were previously iden-tified as direct FOXP2 targets using ChIP-chip6,7. Sixty per cent ofpromoters of the identified differentially expressed genes have at leastone canonical FOXP2 binding site, 92% have at least one forkheaddomain binding site, and 99% have at least one ‘core’ FOXP2 bindingsite (Supplementary Table 4). The canonical FOXP2 binding siteCAAATT, as well as the core site AAAT, is significantly enriched inthe downregulated genes (P 5 3.3 3 1024 and P 5 8.6 3 1023, respec-tively) compared to randomly permuting the same number of pro-moters from the genome. Genes with promoters containing a canonicalFOXP2 binding site are likely to be direct FOXP2 or FOXP2chimp

targets.To confirm that these findings were not an artefact of the cell lines

used, we further assessed whether a different primary neural cell,human neural progenitors, would show similar differential regulationby FOXP2 and FOXP2chimp. We confirmed one-third of the genesexamined in these human cells using both a different method of genetransduction, and populations of cells with greater levels ofFOXP2chimp compared to human FOXP2 overexpression, which com-plements the SH-SY5Y data to further show that the observed rela-tionships are not due to FOXP2 levels (Supplementary Fig. 2). As anadditional level of validation and to extend the findings to the level ofprotein, we confirmed two genes, CACNB2 and ENPP2, by immuno-blotting in additional SH-SY5Y cell lines (Supplementary Fig. 3).

To explore the potential function of the differential FOXP2 targets,we determined enrichment of gene ontology (GO) categories. GOcategories enriched for genes upregulated by FOXP2 compared toFOXP2chimp are involved in transcriptional regulation of geneexpression and cell–cell signalling. Those GO categories enrichedfor genes downregulated by FOXP2 compared to FOXP2chimp areimportant for protein and cell regulation (Supplementary Table 5).

1Program in Neurogenetics, 2Semel Institute and Department of Psychiatry, 3Departments of Neurology, 4Human Genetics, and 5Biological Chemistry, David Geffen School ofMedicine, University of California, Los Angeles, California 90095, USA. 6Division of Neuroscience and Center for Behavioral Neuroscience, Yerkes National Primate Research Center,and Department of Pathology & Laboratory Medicine, Emory University School of Medicine, Atlanta, Georgia 30329, USA.

Vol 462 | 12 November 2009 | doi:10.1038/nature08549

213 Macmillan Publishers Limited. All rights reserved©2009

www.nature.com/doifinder/10.1038/nature08549

www.nature.com/nature


These data support the idea that FOXP2 and FOXP2chimp have dis-tinguishable downstream effects as reflected by their differences ingene regulation.

To determine the potential mechanisms by which FOXP2 orFOXP2chimp might differentially regulate gene expression, we firstexamined whether either protein preferentially interacts withFOXP1 or FOXP4, two proteins known to form a heterodimer withFOXP2 (ref. 8). Both FOXP2 and FOXP2chimp co-localized withFOXP1 in the cell nucleus, co-immunoprecipitated with FOXP1 asevidenced by immunoblotting, and co-immunoprecipitated withboth FOXP1 and FOXP4 when assayed by mass spectrometry(Figs 1c–e, 2a, b and Supplementary Fig. 4b–g), ruling out a major

difference in FOXP1 or FOXP4 interaction causing differential geneexpression. Mass spectrometry showed no significant difference ineither co-immunoprecipitation experiment, indicating that differ-ences in hetero- or homodimerization did not underlie the observeddifferences in gene expression between the chimpanzee and humanFOXP2. We also tested whether changes in cell proliferation couldaccount for gene expression differences, but did not find significantchanges in growth with either FOXP2 construct (Fig. 2c).

We next assessed whether FOXP2 and FOXP2chimp expression ledto differential promoter transactivation of target genes. We selectedeight genes confirmed by qRT–PCR that also contained at least oneforkhead binding site (Supplementary Table 6). Six of the promoters

Vect

or

FOX

P2

b

FKHDPolyQ Zn

N303 S325

LeuN C

FKHDPolyQ Zn

T303 N325

LeuN C

FOXP2

FOXP2chimp

Flag

GAPDH

d e

Vect

or

FOX

P2c

him

p

FOX

P2

FOX

P2c

him

p

FOX

P2

FOX

P2c

him

p

FOX

P2

Cytoplasm

Vect

or

Vect

or

Flag

TUBB

f

Flag

Flag

Flag

Flag

Flag

Flag

CDCA7L

*

**

*

*

* * **

*

a

* *

*

** *

*

*EPAS1

ArraysqRT–PCR

1.7711.57

1.707.14

1.551.43

1.877.43

1.685.26

1.851.18

1.7420.00

1.642.44

1.642.55

1.753.70

1.255.33

1.592.11

ArraysqRT–PCR

ACTA2–1.69–3.92

DCN–1.78–17.19

EDNRA–1.62–6.25

IGFBP3–1.58–3.96

IRF6–1.54–1.99

MAGEA10–1.73–2.11

–1.54MAOB

–2.14

PCDH17–1.58–3.00

PPP2R2B–1.56–3.55

PRPH–2.04–2.67

TAGLN–1.53–9.67

TMEM100–1.58–2.29

g

h

FOX

P2/

FOX

P2c

him

p fo

ld c

hang

eFO

XP

2/FO

XP

2chi

mp fo

ld c

hang

e

FOX

P2c

him

p

1

3

5

7

9

11

13

15

17

19

21

23

21

19

17

15

13

11

9

7

5

3

1

c

Flag PNucleus

ZNF521SYKSLC30A3RUNX1T1ROR2PRNPPDGFRAHEBP2GRM8EYA1

**

Figure 1 | FOXP2 and FOXP2chimp differentially regulate genes in SH-SY5Ycells. a, Schematic of human FOXP2 showing its major functional proteindomains (Zn indicates the zinc finger domain, Leu indicates the leucine-zipper domain, and FKHD indicates the forkhead DNA binding domain)and the two amino acid changes in the mutant FOXP2chimp. b, Representativeimmunoblot for Flag-tagged FOXP2 and FOXP2chimp stable overexpressionin SH-SY5Y cells. c–e, Immunofluorescent staining of antibodies againstFlag epitope (green) and FOXP1 (red), and 4,6-diamidino-2-phenylindole

(DAPI; blue) for nuclei. Vector cells demonstrate no Flag expression(c), whereas both FOXP2 (d) and FOXP2chimp (e) expressing cells have Flag-tagged FOXP2 in the cell nucleus. Arrows indicate examples of cell nucleipositive for Flag expression. Scale bars, 5 mm. f, Subcellular fractionationfollowed by immunoblotting. g, h, Quantitative RT–PCR of genes that weredifferentially expressed in cells expressing FOXP2 compared to FOXP2chimp.Asterisks indicate P # 0.05 and error bars are 6 s.e.m. (two-tailed Student’st-test, n 5 3 or 4).

LETTERS NATURE | Vol 462 | 12 November 2009


tested showed differential regulation by FOXP2 compared toFOXP2chimp in the same direction as the microarrays (Fig. 2d, e),whereas two did not demonstrate significant transactivation in eitherdirection (data not shown). In contrast, a canonical FOXP2 bindingsite in triplicate alone, outside of a genomic context, was regulatedequally by both FOXP2 and FOXP2chimp (Supplementary Fig. 5).Given the complexity of cis-acting gene transactivation elements,these data are particularly compelling considering our use of simpli-fied 59 promoter regions. These data demonstrate that at least asubset of differentially regulated genes is also differentially transacti-vated by FOXP2 and FOXP2chimp, indicating that they are probablydirect FOXP2 targets.

To place these gene expression changes within a more systematiccontext, we applied weighted gene co-expression network analysis9,10 tothe entire SH-SY5Y microarray data set to examine co-regulation ofgene expression across all genes. We uncovered two modules where themodule eigengene (for definition, see Methods) was driven by differ-ences in FOXP2 and FOXP2chimp, and one module driven by similargene regulation (Fig. 3 and Supplementary Fig. 6). Using this unsuper-vised analysis, we found additional genes of interest that do not meetthe criteria for differential expression, but that are co-regulated withdifferences in FOXP2 and FOXP2chimp expression (SupplementaryTable 7). Notably, two of the genes with the most connections, so-called‘hub’ genes, in one of the differential networks are DLX5 and SYT4, twogenes important for brain development and function11,12.

To extrapolate these findings to true in vivo expression and provideexternal validation, we compared the differentially expressed genes inSH-SY5Y cells to differentially expressed genes from adult humanand chimpanzee brain tissue. We performed microarray analysis ontissue from three brain regions where FOXP2 is expressed in develo-ping brain: caudate nucleus, frontal pole and hippocampus. Weexamined gene expression in human compared to chimpanzee foreach brain region separately as well as for all brain regions combined,for a total of eight comparisons. There was a significant overlap inseven out of eight of these comparisons, a remarkable convergencewith the in vitro data (Table 1). These data are particularly notable, asthe tissue was from adult brain. We surmise that a subset of theoverlapping differentially expressed genes found in adult brain isthe result of differential functions by FOXP2 in the developing brain,

and may lead to increased vulnerability to disease. For example,mutations in both FGF14 and PPP2R2B lead to spinocerebellar ataxia(spinocerebellar ataxia type 27 and 12, respectively), which involvesmotor-related speech defects13,14. Because both of these genes have acritical role in cerebellar function, it is of note that patients withFOXP2 mutations have decreased grey matter in the cerebellum15,and Foxp2 knockout mice have their most pronounced morphologicalphenotype in the cerebellum16. Mutations in COL9A1 lead to Sticklersyndrome in which patients have craniofacial abnormalities17, andpatients with mutations in GJA12 (also called GJC2) present withataxia, nystagmus, other motor impairments, and often mentalretardation18.

Although comparisons of developing brain between human andchimpanzee are challenged by a lack of tissue, a recent study examinedgene expression in many regions of human fetal brain19. Comparingthe list of 116 differentially expressed genes with those focally expressedduring human fetal development, we find 14 genes specificallyexpressed in one brain region, including FOXP2 (SupplementaryTable 8). Two regions of the human fetal brain with high FOXP2expression19—perisylvian cortex and cerebellum—have a significantnumber of enriched genes that overlap with the differentially expressedFOXP2 and FOXP2chimp genes (P 5 1.1 3 1024 and P 5 1.3 3 1024,respectively; Supplementary Table 8). A significant number of thedifferentially expressed genes are also associated with human-specificaccelerated highly conserved non-coding sequences (haCNS), butnot with chimpanzee highly conserved non-coding sequences(P 5 1.2 3 1026 and P 5 0.04; Supplementary Table 8)19,20. We con-firmed a number of these genes, such as GRM8, MAOB, PPP2R2B,PRICKLE1 and RUNX1T1, either by qRT–PCR and/or with the adultin vivo data set (Fig. 1 and Table 1). Together, these data suggest thatthe FOXP2 differentially expressed genes identified here may haveimportant roles in brain development and patterning, and may alsohave evolved cis-regulatory elements important for their expressionspecifically in human brain.

Previously, we identified ChIP-chip targets of FOXP2 that themselveswere also under positive selection6. We hypothesized that networks ofgenes important for language circuitry had been positively selectedthrough selective pressure on human brain evolution. Thus, we alsoexamined whether any differential FOXP2 targets were themselves

Flag

FOXP1

Input

FOX

P2

FOX

P2c

him

p

FOX

P2

FOX

P2c

him

p

FOX

P2

FOX

P2c

him

p

FOX

P2

FOX

P2c

him

p

aC

ell n

umb

er

Vector

c

FOXP2FOXP2chimp

0

500,000

1,000,000

1,500,000

2,000,000

2,500,000

1 2 3 4Day

FOX

P2/

FOX

P2c

him

p

norm

aliz

ed fo

ld c

hang

e

*

ArraysLuciferase

CDCA7L1.771.86

GRM81.871.55

ROR21.641.60

2.5

2.0

1.5

1.0

* *

ACTA2–1.69–1.31

IGFBP3–1.58–1.47

TAGLN–1.53–1.32

ArraysLuciferase

–2.0

–1.75

–1.5

–1.25

–1.0

d

e

FOXP2

FOXP2chimp

FOXP1

FOXP2

FOXP2chimp

SH

-SY

5Y29

3T

FOXP2

65/16

29/11

32/10

106/23

34/11

11/8

5/4

18/11

15/9

2/2

6/5

21/10

b

IPFOXP1FlagNo Ab

FOXP4

FOX

P2/

FOX

P2c

him

p

norm

aliz

ed fo

ld c

hang

e

Figure 2 | FOXP2 and FOXP2chimp differentiallytransactivate target promoters independent ofFOXP1 or FOXP4 interaction. a, Immunoblottingfor Flag or FOXP1 followingimmunoprecipitation with either Flag or FOXP1antibodies. b, Mass spectrometry results fromSH-SY5Y or 293T cells overexpressing FOXP2 orFOXP2chimp. The first number indicates thenumber of spectra and the second is the numberof unique peptides. c, Cell growth analysis doesnot show a significant difference in proliferationbetween cells expressing FOXP2 or FOXP2chimp

over time (P # 0.05). Error bars are 6 s.e.m.(two-tailed Student’s t-test, n 5 3). d, e, Dualluciferase assays in 293T cells transientlytransfected with promoter fragments drivingluciferase and either FOXP2 or FOXP2chimp.Asterisks indicate P # 0.05 and error barsare 6 s.e.m. (two-tailed Student’s t-test,n 5 3–6).

NATURE | Vol 462 | 12 November 2009 LETTERS


under positive selection. Five genes (AMT, C6orf48, MAGEA10,PHACTR2 and SH3PXD2B) met the standard criteria of Ka/Ks $ 1.0for positive selection on the human lineage (where Ka indicates the rateof non-synonymous substitutions and Ks indicates the rate of synony-mous substitutions; Supplementary Table 9)21. These data, along withthe haCNS and expression data mentioned above, suggest that a subsetof differential FOXP2 targets may have co-evolved to regulate pathwaysinvolved in higher cognitive functions.

The positive selection of two amino acids in human FOXP2 waspreviously hypothesized as a mechanism by which human FOXP2might assume a novel biological function with implications forspeech and language evolution4,5. A recent study made an elegantattempt to examine the role of these two amino acids by generatinga transgenic mouse with the human version of FOXP2 (ref. 22). Thesemice show a number of interesting phenotypic alterations includ-ing increases in dendritic length in striatal neurons and changes in

Table 1 | Overlap of cell and in vivo microarray data

Genes Cells All brain areas(7.36 3 10

24 upregulated;1.10 3 10

26 downregulated)*

Hippocampus(4.49 3 10


28 downregulated)*

Caudate(4.04 3 10


22 downregulated)*

Frontal pole(7.21 3 10


24 downregulated)*

UpregulatedADAMTS9 1.38 1.91 1.72 2.35 1.73

BCAN 1.29 – – 1.64 –COL9A1 1.26 1.23 – 1.26 –EXPH5 1.27 1.41 1.29 1.43 1.53

FRZB 1.32 1.65 1.39 2.04 1.57

IGFBP4 1.27 1.35 – – 1.59

ISLR2 1.30 1.27 1.53 – –MGST1 1.26 2.33 1.79 3.34 2.13

NPTX2 1.24 1.28 – 1.46 –PDGFRA 1.84 1.27 – 1.35 –PRICKLE1 1.45 – 1.43 – –RUNX1T1 1.64 1.24 1.33 – 1.24

SLC30A3 1.75 1.92 2.20 1.83 1.74

DownregulatedACCN2 21.27 21.33 21.31 21.28 21.39

B3GNT1 21.24 21.73 21.47 22.55 21.39

C6orf48 21.23 21.56 21.53 21.65 21.51

C8orf13 21.27 21.36 21.64 – 21.29

CACNB2 21.23 21.69 21.4 22.58 21.35

DCN 21.78 21.39 21.68 – 21.33

ELMO1 21.28 21.34 – 21.64 21.32

ENPP2 21.39 21.43 21.72 – –FAM43A 21.40 – 21.32 – –FAM43B 21.40 – – – 21.41

FGF14 21.23 21.34 21.24 21.57

FLJ11286 21.27 21.38 21.32 21.31 21.51

GJA12 21.25 21.35 – – –GLRX 21.29 – – 21.30 –HIST2H2BE 21.30 21.39 21.61 – 21.39

IFIT2 21.24 21.34 21.49 – –IGFBP3 21.58 – 21.30 – –MAOB 21.54 – 21.26 – –PPP2R2B 21.56 21.23 21.66 21.35 21.41

*Overlap P values for upregulated and downregulated genes are given in parentheses.

C9orf4

C1orf53

HIST2H2BE

C9orf111MATR3

SYNPRPFTK1 PCAF

AMOT METRNL

MTA3 ELF4

LRRK1PTPRR

GCH1ATP6V1G2CDCA7L ARHGEF7

C9orf58

C3orf32

RGS16

WDR62

WDR22

DECR1

GRIA3S100A6

BCHE

FLJ11286

DLX5

PRPH

ROR2

EBF3

ADAMTS9

ADM

ZCCHC12

ZNF556

SYT4

FAM43A

RAB32

RUNX1T1

ABCC3

DDIT4

RAI2

C7

GARNL3

RAB31

HEBP2

RBPMS2TMEFF2

PDGFRA

HIST1H4HLOC352909

BSCL2

CHRNA3ENO3HIST1H2AE

ACTA2PVRL2

GPR30ALKBH8

RFC3L3MBTL3FBXO27XKZNF537

FRZB

LRRTM4

HSD17B1

STEAP3SGK

RASL11B

OVCA2

C1orf85MAGEA3

MGST1

ZNF521

LRRC8C

SLC25A24NELL1

LOX

ASB9

MAOB

RDX

TMPO

CXCR4 LRRN6C

AMT GLRXFLJ46082 TRIM36

AXUD1

PPP2R2B

LIG1

FLRT3

ZNF488

CPNE2

PIWIL1

ZNF702

GRM7

NME3

NDN

ISLR2

MGC33846

EGFR

HCST

TACC2

GLRX2

CPB1EFNB2

SPSB4

SNCAIP

FLJ35409GABRA3

TIMP1

Figure 3 | Visualization of one of the modulescontaining FOXP2 and FOXP2chimp differentiallyexpressed genes. Two-hundred-and-fifty pairsof genes with the greatest topological overlap areshown. Positive correlations are depicted in redand negative correlations are depicted in blue.The gene symbols for hub genes are accentuatedin large, bold text.

LETTERS NATURE | Vol 462 | 12 November 2009


ultrasonic vocalizations, as well as some modest changes in geneexpression. Although the mouse is an experimentally tractable modelsystem, from a strictly evolutionary standpoint, the interpretation ofdata obtained in the mouse specifically for the study of human evolu-tion is challenged by the vast differences in human and mouse brainand the amount of time since the human and mouse commonancestor diverged (70 million years23). Here, we demonstrate thatthese two amino acid changes have a functional consequence inhuman cells, validate these differences in vivo in tissue, and elucidatesome of the downstream pathways affected by this adaptive evolu-tionary change.

Using whole-genome microarrays, we uncovered genes that aredifferentially regulated upon mutation of these two amino acids,including some with functions critical to the development of thehuman central nervous system. Moreover, this study reveals enrich-ment of differential FOXP2 targets with known involvement in cere-bellar motor function, craniofacial formation, and cartilage andconnective tissue formation, suggesting an important role for humanFOXP2 in establishing both the neural circuitry and physical struc-tures needed for spoken language. The significant overlap of humanFOXP2 targets in cell lines with genes enriched in human comparedto chimpanzee brain tissue presents the possibility that human andchimpanzee FOXP2 have differentially regulated targets during braindevelopment. As suggested over 30 years ago24, and reaffirmed by thesequencing of both the human and chimpanzee genomes, the pheno-typic differences exhibited by humans and chimpanzees cannot beexplained by differences in DNA sequence alone, and are probablydue to differences in gene expression and regulation. Previous micro-array studies identified differences in gene expression betweenhuman and chimpanzee brains25,26. Here, we link new whole-genomeexpression microarray data from human and chimpanzee brain todirect differences in gene regulation by the human and chimpanzeeversion of the transcription factor FOXP2. Because normal FOXP2function is critical for speech in humans, these differentially regu-lated targets may be relevant to the evolution and establishment orfunction of pathways necessary for speech and language in humans.

METHODS SUMMARYCell culture and stable line generation. SH-SY5Y cells (ATCC) and human fetal

neuronal progenitors (Lonza) were grown according to the manufacturer’s

instructions, with some modifications (see Methods).

Microarrays. Total RNA was extracted using Qiagen’s RNeasy kit. Illumina

HumanRef-8 v2 (SH-SY5Y samples) or v3 (tissue samples) were used and ana-

lysed as described27. Sample information is in Methods.

Full Methods and any associated references are available in the online version ofthe paper at www.nature.com/nature.

Received 26 August; accepted 1 October 2009.

1. Feuk, L. et al. Absence of a paternally inherited FOXP2 gene in developmentalverbal dyspraxia. Am. J. Hum. Genet. 79, 965–972 (2006).

2. Lai, C. S., Fisher, S. E., Hurst, J. A., Vargha-Khadem, F. & Monaco, A. P. A forkhead-domain gene is mutated in a severe speech and language disorder. Nature 413,519–523 (2001).

3. MacDermot, K. D. et al. Identification of FOXP2 truncation as a novel cause ofdevelopmental speech and language deficits. Am. J. Hum. Genet. 76, 1074–1080(2005).

4. Enard, W. et al. Molecular evolution of FOXP2, a gene involved in speech andlanguage. Nature 418, 869–872 (2002).

5. Zhang, J., Webb, D. M. & Podlaha, O. Accelerated protein evolution and origins ofhuman-specific features: Foxp2 as an example. Genetics 162, 1825–1835 (2002).

6. Spiteri, E. et al. Identification of the transcriptional targets of FOXP2, a gene linkedto speech and language, in developing human brain. Am. J. Hum. Genet. 81,1144–1157 (2007).

7. Vernes, S. C. et al. High-throughput analysis of promoter occupancy reveals directneural targets of FOXP2, a gene mutated in speech and language disorders. Am. J.Hum. Genet. 81, 1232–1250 (2007).

8. Li, S., Weidenfeld, J. & Morrisey, E. E. Transcriptional and DNA binding activity ofthe Foxp1/2/4 family is modulated by heterotypic and homotypic proteininteractions. Mol. Cell. Biol. 24, 809–822 (2004).

9. Oldham, M. C. et al. Functional organization of the transcriptome in human brain.Nature Neurosci. 11, 1271–1282 (2008).

10. Zhang, B. & Horvath, S. A general framework for weighted gene co-expressionnetwork analysis. Stat. Appl. Genet. Mol. Biol. 4, 17 (2005).

11. Acampora, D. et al. Craniofacial, vestibular and bone defects in mice lacking theDistal-less-related gene Dlx5. Development 126, 3795–3809 (1999).

12. Yoshihara, M., Adolfsen, B., Galle, K. T. & Littleton, J. T. Retrograde signaling bySyt 4 induces presynaptic release and synapse-specific growth. Science 310,858–863 (2005).

13. Brusse, E. et al. Spinocerebellar ataxia associated with a mutation in the fibroblastgrowth factor 14 gene (SCA27): A new phenotype. Mov. Disord. 21, 396–401(2006).

14. Holmes, S. E. et al. Expansion of a novel CAG trinucleotide repeat in the 59 regionof PPP2R2B is associated with SCA12. Nature Genet. 23, 391–392 (1999).

15. Belton, E., Salmond, C. H., Watkins, K. E., Vargha-Khadem, F. & Gadian, D. G.Bilateral brain abnormalities associated with dominantly inherited verbal andorofacial dyspraxia. Hum. Brain Mapp. 18, 194–200 (2003).

16. Shu, W. et al. Altered ultrasonic vocalization in mice with a disruption in the Foxp2gene. Proc. Natl Acad. Sci. USA 102, 9643–9648 (2005).

17. Van Camp, G. et al. A new autosomal recessive form of Stickler syndrome iscaused by a mutation in the COL9A1 gene. Am. J. Hum. Genet. 79, 449–457(2006).

18. Uhlenberg, B. et al. Mutations in the gene encoding gap junction protein a12(connexin 46.6) cause Pelizaeus-Merzbacher-like disease. Am. J. Hum. Genet. 75,251–260 (2004).

19. Johnson, M. B. et al. Functional and evolutionary insights into human braindevelopment through global transcriptome analysis. Neuron 62, 494–509(2009).

20. Prabhakar, S., Noonan, J. P., Paabo, S. & Rubin, E. M. Accelerated evolution ofconserved noncoding sequences in humans. Science 314, 786 (2006).

21. Dorus, S. et al. Accelerated evolution of nervous system genes in the origin ofHomo sapiens. Cell 119, 1027–1040 (2004).

22. Enard, W. et al. A humanized version of Foxp2 affects cortico-basal gangliacircuits in mice. Cell 137, 961–971 (2009).

23. Kumar, S. & Hedges, S. B. A molecular timescale for vertebrate evolution. Nature392, 917–920 (1998).

24. King, M. C. & Wilson, A. C. Evolution at two levels in humans and chimpanzees.Science 188, 107–116 (1975).

25. Enard, W. et al. Intra- and interspecific variation in primate gene expressionpatterns. Science 296, 340–343 (2002).

26. Caceres, M. et al. Elevated gene expression levels distinguish human from non-human primate brains. Proc. Natl Acad. Sci. USA 100, 13030–13035 (2003).

27. Coppola, G. et al. Gene expression study on peripheral blood identifies progranulinmutations. Ann. Neurol. 64, 92–96 (2008).

Supplementary Information is linked to the online version of the paper atwww.nature.com/nature.

Acknowledgements We thank M. Oldham for generating the Illumina microarraymask file; J. Ou and E. Spiteri for performing site-directed mutagenesis; L. Chen fortechnical assistance; and L. Kawaguchi for laboratory management. Human tissuewas obtained from the NICHD Brain and Tissue Bank for Developmental Disordersat the University of Maryland (NICHD Contract numbers N01-HD-4-3368 andN01-HD-4-3383). The role of the NICHD Brain and Tissue Bank is to distributetissue, and therefore cannot endorse the studies performed or the interpretation ofresults. This work was supported by grant R21MH075028, R37MH60233-06A1(D.H.G.), T32HD007032, an A.P. Giannini Foundation Medical ResearchFellowship, and a NARSAD Young Investigator Award (G.K.), T32MH073526(K.W.) NIH/NCRR grant RR00165 and a James S. McDonnell Foundation grant,JSMF 21002093 (T.M.P).

Author Contributions G.K. and D.H.G. designed the study, analysed the data andwrote the paper; G.K. performed all of the experiments; J.M.B. made contributionsto an earlier phase of the project including generating cell lines, immunoblottingand qRT–PCR; K.W. performed statistical analysis and weighted genecoexpression network analysis; G.C. conducted promoter analysis and G.C. andF.G. analysed the microarray data; Z.O.J. and J.A.W. performed massspectrometry; S.P. performed some of the qRT–PCR; T.M.P. performed tissuedissections and provided non-human primate samples; all authors discussed theresults and commented on the manuscript.

Author Information Gene expression data have been deposited in the NCBI GeneExpression Omnibus (GEO; http://www.ncbi.nlm.nih.gov/geo) and are accessibleusing GEO series accession number GSE18142. Reprints and permissionsinformation is available at www.nature.com/reprints. Correspondence andrequests for materials should be addressed to G.K. ([email protected]) or D.H.G.([email protected]).

NATURE | Vol 462 | 12 November 2009 LETTERS




http://www.ncbi.nlm.nih.gov/geo

www.nature.com/reprints

mailto:[email protected]

mailto:[email protected]

METHODSAntibodies. The following antibodies were either used for immunoblotting (IB)

or immunofluorescence (IF): anti-Flag (mouse monoclonal, Sigma; 1:10,000

(IB), 1:10,000 (IF)), anti-GAPDH (mouse monoclonal, Chemicon; 1:2500

(IB)), anti-b-tubulin (rabbit polyclonal, Abcam; 1:1000 (IB)), anti-FOXP1

(ref. 6; 1:5000 (IB), 1:1000 (IF)), anti-CACNB2 (mouse monoclonal, Abcam;

1:100 (IB)), anti-ENPP2 (rabbit polyclonal, Cayman Chemical; 1:400 (IB)), goat

anti-rabbit horseradish peroxidase (Cell Signaling, 1:2,500), goat anti-mouse

horseradish peroxidase (Chemicon, 1:5,000), goat anti-mouse Alexa Fluor 488

(Invitrogen, 1:1,500), goat anti-rabbit Alexa Fluor 594 (Invitrogen, 1:1,500).Cell culture and stable line generation. Stable SH-SY5Y cell lines were generated

by transfecting cells with pCMV-Tag4a expression constructs using FuGENE

(Roche Applied Science) according to the manufacturer’s instructions. Popu-

lations of stable cells were selected using 1 mg ml21 geneticin (Invitrogen).

Multiple independent lines were generated from independent transfections.

Stable human fetal neuronal progenitor cell lines were generated by transducing

cells with lentiviruses as previously described28. FOXP2-producing lentiviral vec-

tors were generated by replacing the eGFP in pLUGIP (ATCC) with FOXP2.

Immunoprecipitation. Nuclear extract was incubated with either 1mg of Flag

antibody (Sigma) or a polyclonal FOXP1 antibody6.

Cell proliferation assay. Equal numbers of cells (2.0 3 104) were plated on time zero

and counted every subsequent day after trypsinization using a haemacytometer.

Dual luciferase assays. 293T cells (ATCC) were transfected with 50 ng of

reporter construct expressing Photinus pyralis (firefly) luciferase, 1 ng of

Renilla luciferase plasmid (pRL-EF), and 50 ng of pCMV-Tag4a FOXP2 expres-

sion plasmid using FuGENE (Roche Applied Science) according to the manu-

facturer’s instructions. Forty-eight hours later, cells were lysed and analysed

using the dual luciferase reporter assay system (Promega) according to themanufacturer’s instructions. Co-transfection of Renilla was used for transfection

normalization, and values were additionally normalized to cells transfected with

a promoter-less luciferase construct. Promoter information is in Supplementary

Table 6. The canonical FOXP2 binding site driving luciferase was generated by

cloning AATTTG in triplicate into pGL4 (Promega).

Gene ontology analysis. GO analysis was performed as described6 using DAVID

(http://david.abcc.ncifcrf.gov). The differentially expressed genes were com-

pared to all of the genes on the microarrays and a P value computed using a

Fisher’s exact test.

Immunoblotting. Whole-cell protein lysates were generated and immuno-

blotted as described28.

Immunofluorescence. Cells were grown on glass coverslips, fixed in 2% para-

formaldehyde, and permeabilized in 0.2% Triton X-100. TBST containing 10%

milk and 10% normal goat serum was used as blocking solution at room tem-

perature for 1 h. Antibodies were diluted in TBS with 0.25% BSA, 0.25% normal

goat serum and 0.1% Triton X-100 and applied to cells overnight at 4 uC.

Secondary antibodies were diluted in blocking solution and added at room

temperature for 1 h. Coverslips were mounted to glass slides and images takenusing a Zeiss Axio Imager D1.

Mass spectrometry. FOXP2 immunoprecipitates were precipitated by the addi-

tion of trichloroacetic acid and proteolysed by the sequential addition of Lys-C

and trypsin proteases29. Digested peptide samples were then analysed by mass

spectrometry as described29. Proteins were considered to be present in a sample if

at least two peptides per protein were identified using a false positive rate of less

than 5% per peptide as determined using a decoy database strategy30.

Microarrays. For the SH-SY5Y data, we analysed four biological replicates of

each genotype from three independently generated cell lines for a total of 12

microarrays per genotype. Each of these cell lines was created from populations

of cells rather than single clones, and as such, the expression data represent

changes from hundreds of independent integrations throughout the cells’

genomes. Furthermore, as the endogenous FOXP2 expression is very low in

SH-SY5Y cells, the potential confound of heterodimerization with endogenous

human FOXP2 is mitigated in these cells. For the tissue data, we analysed three to

six independent samples for each brain region in each species. Detailed code for

the microarray analysis is available31.

Permutation testing. For FOXP2 correlations, we computed the average correla-

tion for each gene on the microarray to either the level of the human or the

chimpanzee FOXP2. We then derived the absolute difference in correlation for

each gene between the human and chimpanzee FOXP2 arrays. The average of these

differences was not statistically different from performing the same test while ran-

domizing the correlation values for all of the genes on the arrays, or using the values

from only the differentially expressed genes. For promoter binding site calculations,

we calculated the number of promoters from differentially expressed genes with a

given motif and compared them to the average number from a random selection of

the same number of promoters from the genome. We assumed a normal distri-

bution and a Z-score less than 0.05 was called significant. Similar analysis was done

for comparing genes with a haCNS and expression in human fetal brain. For

microarray overlap comparisons, we included the number of differentially

expressed genes as well as the total number of probe sets on the microarrays for

each comparison. We used a hypergeometric distribution test with 10,000 permu-

tations to calculate the mean and standard deviation of the overlap. We assumed a

normal distribution, and a Z-score less than 0.05 was called significant.

Real-time PCR. RNA extraction and RT–PCR was performed as described6.

Primer sequences are in Supplementary Table 10.

Site-directed mutagenesis. Mutagenesis of pCMV-Tag4a/FOXP26 was carried

out using the GeneTailor Site-Directed Mutagenesis System (Invitrogen)

according to the manufacturer’s instructions using the following primers: site 1

(asparagine to threonine), F-59-CCTCCTCGACTACCTCCTCCACAACTTCC

AAAGC-39, R-59-GGAGGAGGTAGTCGAGGAGGAATTGTTAGTA-39; site 2

(serine to asparagine), F-59-ATGGACAGTCTTCAGTTCTAAACGCAAGACG

AGA-39, R-59-TAGAACTGAAGACTGTCCATTCACTATGGAA-39. Mutagenesis

was confirmed by both sequencing and mass spectrometry.

Weighted gene coexpression network analysis (WGCNA). WGCNA was

performed as previously described9,10. Briefly, genes were chosen for inclusion

into the network on the basis of their consistent presence on the array and high

coefficient of variation, and they were clustered based on their topological over-

lap. For each module, singular value decomposition (X 5 UDV’) was performed,

and the expression was re-calculated without the first principal component

because it corresponded to cell line differences. The modules reported in this

study were created using expression data with the first principal component

removed, as it represented an experimental batch effect.

28. Konopka, G., Tekiela, J., Iverson, M., Wells, C. & Duncan, S. A. Junctional adhesionmolecule-A is critical for the formation of pseudocanaliculi and modulatesE-cadherin expression in hepatic cells. J. Biol. Chem. 282, 28137–28148 (2007).

29. Wohlschlegel, J. A. Identification of SUMO-conjugated proteins and their SUMOattachment sites using proteomic mass spectrometry. Methods Mol. Biol. 497,33–49 (2009).

30. Elias, J. E. & Gygi, S. P. Target-decoy search strategy for increased confidence inlarge-scale protein identifications by mass spectrometry. Nature Methods 4,207–214 (2007).

31. Coppola, G., Winden, K., Konopka, G., Gao, F. & Geschwind, D. H. Expression andnetwork analysis of Illumina microarray data. Nature Protocols doi:10.1038/nprot.2009.215 (2009).

doi:10.1038/nature08549

Macmillan Publishers Limited. All rights reserved©2009

http://david.abcc.ncifcrf.gov

www.nature.com/doifinder/10.1038/nature08549



SUPPLEMENTARY INFORMATION

1www.nature.com/nature

doi: 10.1038/nature08549

1

1.5

2

2.5

3

3.5

Microarrays 1.26 1.41qRT-PCR 1.56 2.78

COL9A1 SLIT1

FOXP

2/FO

XP2ch

imp

Fo

ld C

hang

e

*

*

Supplementary Figure 1. Confirmation of additional differentially expressed genes that overlap with previously identified FOXP2 ChIP-chip targets. Quantitative RT-PCR of COL9A1 and SLIT1. Independent RNA was used, and both showed fold changes in the same direction as the microarrays. Asterisks indicate P<0.05 and error bars are +/- s.e.m. (two-tailed Student’s t-test, n=3).


doi: 10.1038/nature08549 SUPPLEMENTARY INFORMATION

FLAG

ACTB

Vector FOXP2 FOXP2chimpa

b

Supplementary Figure 2. Confirmation of targets in another human neuronal system.a, Immunoblotting of undifferentiated normal human neuronal progenitors (NHNPs)transduced with lentivirus to overexpress either the human or chimpanzee form ofFLAG-tagged FOXP2. In these cells the chimpanzee version of FOXP2 was more highly expressed than the human version. ACTB indicates equal loading using an antibody to beta-actin. b, Real-time RT-PCR was conducted on a subset of differential targets in NHNPs. Most of these genes had already been confirmed in SH-SY5Y cells by qRT-PCR, and many of these genes were also differentially expressed in tissue. 8/12 of the genes showed the same change in direction in both cells lines, and four of these were significant. 4/10 of the genes had changes in the opposite direction in the two cell lines, but only one of these values in the NHNPs was significant. (Two-tailed Student’s test, n=3) N/A indicates that these genes were not expressed at detectable levels in the undifferentiated NHNPs.

SH-SY5Y Array NHNP qRT-PCR NHNP qRT-PCR

Fold Change Fold Change P-Value

FOXP2 1.48 -2.85 2.39E-03

COL9A1 1.26 N/A N/A

DCN -1.78 -1.55 7.50E-01

FAM43A -1.40 -1.59 7.32E-02

FGF14 -1.23 1.62 3.97E-02

FRZB 1.32 2.22 2.16E-03

IGFBP3 -1.58 21.07 6.78E-02

MAOB -1.54 -1.67 2.42E-02

NPTX 1.24 2.51 5.31E-02

PDGFRA 1.85 -1.25 2.80E-01

PPP2R2B -1.56 9.77 2.15E-01

RUNX1T1 1.64 2.37 5.31E-02

SLC30A3 1.75 N/A N/A

TIMP1 -1.30 -1.48 5.66E-04

TMEFF2 1.24 9.20 5.65E-04


SUPPLEMENTARY INFORMATIONdoi: 10.1038/nature08549

Supplementary Figure 3. Confirmation of targets by immunoblotting in an idependentcell line. Immunoblotting of SH-SY5Y transduced with lentivirus to overexpress either the human or chimpanzee form of FLAG-tagged FOXP2. In these cells, the chimpanzee version of FOXP2 was more highly expressed than the human version. ENPP2 indicates anantibody to ectonucleotide pyrophosphatase/phosphodiesterase 2. CACNB2 indicates anantibody to the voltage-dependent calcium channel beta 2 subunit. The mRNAs of ENPP2and CACNB2 were reduced with forced human FOXP2 expression compared to chimpanzee FOXP2 in other SH-SY5Y cells, and were also lower in human brain compared to chimpanzee brain in certain tissues examined. ACTB indicates equal loading using an antibody to beta-actin.

FLAG

ACTB

CACNB2

ENPP2

Vector FOXP2 FOXP2 chimp



FLAGFLAG

FOXP1 FOXP1

b

c

d

e

f

g

FOXP2 FOXP2chimp

FLAG

GAPDH

FLAG

TUBB

Line

2Li

ne 3

Vect

or

FOXP

2

FOXP

2chim

pa

4

3

2

1

0FOXP2chimpFOXP2

Nor

mal

ized

Val

ues

Supplementary Figure 4. FOXP2 expression in multiple independent cell lines. a, Upper panel: immunoblotting for FLAG-tagged FOXP2 in the two other SH-SY5Y cell lines run on the microarrays. GAPDH or beta-tubulin (TUBB) indicates equal loading. Lower panel: densitometric analysis of FLAG immunoblotting to loading control for all cell lines. FOXP2 and FOXP2chimp levels as measured by FLAG immunoblotting is not significantly different (two-tailed Student’s t-test, n=3, P<0.05), error bars are +/ s.e.m. b-g, Immunofluorescent staining of antibodies against FLAG epitope (red) and FOXP1 (green) in additional independent stable SH-SY5Y cell lines not run on microarrays. Both FOXP2 (b) and FOXP2chimp (e) expressing cells have FLAG-tagged FOXP2 in the cell nucleus. d, and g, are overlaps of the FLAG and FOXP1 staining indicating the majority of FLAG immunoreactivity co-localizes with FOXP1.



FOXP2 FOXP2chimp

Nor

mal

ized

Fol

d C

hang

e

*

*

Supplementary Figure 5. Transactivation of a canonical FOXP2 binding site.Both FOXP2 and FOXP2chimp significantly repress activity of a canonicalFOXP2 binding site in triplicate driving expression of a luciferase reporter. Asterisks indicate P<0.01 and error bars are +/- s.e.m. (two-tailed Student’s t-test, n=4).

-1

-2

-3

-4



a

b

Supplementary Figure 6. Visualization of two other modules from WGCNA analysis. Five hundred pairs of genes with the greatest topological overlap are shown for each network plot. a, A module containing differentially regulated genes and b, a module containing FOXP2 and genes similarly regulated by FOXP2 and FOXP2chimp. Positive correlations are depicted in red and negative correlations are depicted in blue. The gene symbol for “hub” genes (i.e. genes with the greatest number of correlations) are accentuated in large bold text.



Konopka_Supplementary_Table_1Annotation information and raw intensity values for all differentially expressed genes.

UpregulatedProbeName GeneName Accession FOXP2 FOXP2chimp Fold Change pValueILMN_11549 GRM8 NM_000845.1 12.2 11.3 1.87 1.30E-03ILMN_13757 PDGFRA NM_006206.3 11.09 10.21 1.85 2.72E-02ILMN_14646 CDCA7L NM_018719.2 12.73 11.91 1.77 1.68E-03ILMN_6028 SLC30A3 NM_003459.4 11.46 10.65 1.75 3.08E-04ILMN_11177 PRNP NM_183079.1 11.33 10.54 1.74 2.89E-02ILMN_26360 EPAS1 NM_001430.3 13.06 12.29 1.7 6.61E-04ILMN_21130 HEBP2 NM_014320.2 9.43 8.68 1.68 3.89E-02ILMN_22834 ROR2 NM_004560.2 11.18 10.47 1.64 8.28E-04ILMN_1412 RUNX1T1 NM_175636.1 9.22 8.51 1.64 3.38E-03ILMN_22533 ZNF521 NM_015461.1 10.88 10.21 1.6 3.02E-03ILMN_9887 EYA1 NM_172059.1 11.78 11.14 1.55 3.00E-02ILMN_13272 AGTR1 NM_032049.1 11.67 11.04 1.55 2.24E-02ILMN_9515 SNCAIP NM_005460.2 9.05 8.47 1.49 9.12E-03ILMN_424 FOXP2 NM_148898.1 11.17 10.61 1.48 2.13E-03ILMN_14978 RSRC1 NM_016625.2 11.27 10.72 1.46 7.63E-03ILMN_3096 ARHGEF16 NM_014448.2 8.68 8.14 1.45 4.51E-06ILMN_15149 PRICKLE1 NM_153026.1 13.18 12.65 1.45 2.40E-02ILMN_21875 SYT4 NM_020783.2 14.52 13.98 1.45 1.36E-03ILMN_2941 TGIF NM_170695.2 9.79 9.27 1.43 2.02E-02ILMN_23270 SMARCA2 NM_139045.2 10.3 9.81 1.41 2.77E-04ILMN_17043 SLIT1 NM_003061.1 8.76 8.27 1.41 1.03E-04ILMN_25618 FOXN4 NM_213596.1 11.01 10.52 1.4 4.27E-03ILMN_14250 ADAMTS9 NM_182920.1 12.88 12.43 1.37 9.95E-03ILMN_28172 LRRN6A NM_032808.5 9.69 9.24 1.36 2.40E-06ILMN_29514 ADM NM_001124.1 12.19 11.77 1.34 1.98E-02ILMN_7344 ZCCHC12 NM_173798.2 10.94 10.52 1.33 3.36E-06ILMN_27829 HIST1H2BH NM_003524.2 9.14 8.73 1.33 1.85E-04ILMN_29091 FRZB NM_001463.2 10.42 10.02 1.32 1.05E-02ILMN_24422 ZNF702 NM_024924.3 8.61 8.21 1.32 2.45E-02ILMN_19002 DPYD NM_000110.2 9.05 8.65 1.31 5.56E-05ILMN_21827 PROM1 NM_006017.1 8.69 8.3 1.31 4.24E-02ILMN_19345 ISLR2 NM_020851.1 12.18 11.8 1.31 2.77E-04ILMN_28633 RDX NM_002906.3 11.29 10.92 1.3 7.26E-04ILMN_9683 BCAN NM_021948.3 9.13 8.76 1.29 1.27E-03ILMN_3827 EFNB2 NM_004093.2 12.53 12.16 1.29 4.87E-05ILMN_1023 LRRC8C NM_032270.2 10.45 10.08 1.29 8.34E-05ILMN_19382 MEIS1 NM_002398.2 10.68 10.32 1.28 3.68E-02ILMN_2509 FSTL5 NM_020116.2 11.41 11.05 1.28 9.06E-03ILMN_9513 TFAP2D NM_172238.1 8.22 7.86 1.28 7.93E-03ILMN_527 ABCB4 NM_000443.2 8.46 8.11 1.28 8.83E-03ILMN_10482 MFHAS1 NM_004225.1 8.61 8.27 1.27 3.96E-03ILMN_9309 IGFBP4 NM_001552.2 10.77 10.43 1.27 1.69E-02ILMN_22596 PCAF NM_003884.3 10.58 10.24 1.27 2.78E-02ILMN_15063 C7 NM_000587.2 10.07 9.73 1.26 3.23E-04ILMN_11325 CCNA1 NM_003914.2 9.48 9.15 1.26 2.87E-02ILMN_30102 EXPH5 NM_015065.1 8.42 8.08 1.26 2.42E-02ILMN_6526 RNF182 NM_152737.1 10.23 9.9 1.26 3.94E-03ILMN_1591 TMTC2 NM_152588.1 8.75 8.42 1.26 9.50E-03ILMN_988 MGST1 NM_020300.3 7.77 7.44 1.26 1.34E-07ILMN_19900 ZNF608 NM_020747.1 8.14 7.8 1.26 6.26E-04ILMN_15997 COL9A1 NM_001851.3 8.68 8.35 1.26 1.03E-03ILMN_5233 MORC4 NM_024657.2 11.08 10.76 1.25 4.21E-03ILMN_17743 POPDC2 NM_022135.2 10.14 9.83 1.25 3.10E-02ILMN_8126 SYK NM_003177.3 8.06 7.75 1.25 8.37E-05ILMN_26338 HDAC9 NM_014707.1 9.04 8.72 1.25 8.00E-03ILMN_4553 LRRC4C NM_020929.1 7.86 7.55 1.24 7.22E-05ILMN_28348 SH3PXD2B NM_001017995.1 10.14 9.84 1.24 2.72E-05ILMN_22638 NPTX2 NM_002523.1 12.99 12.68 1.24 5.64E-05ILMN_17013 TMEFF2 NM_016192.2 9.78 9.47 1.24 3.73E-02ILMN_6340 FLJ35409 NM_001001688.1 9.63 9.33 1.23 8.28E-06ILMN_24970 L3MBTL3 NM_001007102.1 8.39 8.09 1.23 9.22E-03



Konopka_Supplementary_Table_1 (continued)DownregulatedProbeName GeneName Accession FOXP2 FOXP2chimp Fold Change pValueILMN_6395 PRPH NM_006262.3 8 9.02 -2.04 1.31E-02ILMN_1179 DCN NM_133504.2 7.72 8.55 -1.78 3.43E-03ILMN_9088 MAGEA10 NM_001011543.1 8.92 9.71 -1.73 4.88E-02ILMN_6588 ACTA2 NM_001613.1 9.3 10.05 -1.69 1.39E-02ILMN_8606 EDNRA NM_001957.1 8.31 9 -1.62 1.12E-02ILMN_4881 TMEM100 NM_018286.1 11.11 11.78 -1.58 1.00E-05ILMN_5341 PCDH17 NM_014459.2 10.07 10.73 -1.58 1.02E-02ILMN_25529 IGFBP3 NM_001013398.1 8.39 9.05 -1.58 1.03E-06ILMN_1007 PPP2R2B NM_181676.1 10.9 11.54 -1.56 7.45E-04ILMN_9884 MAOB NM_000898.3 8.18 8.8 -1.54 2.75E-03ILMN_5889 IRF6 NM_006147.2 9 9.63 -1.54 1.14E-03ILMN_2335 TAGLN NM_003186.3 8.18 8.8 -1.53 2.90E-02ILMN_28729 TUBA6 NM_032704.2 8.06 8.63 -1.48 1.02E-02ILMN_25383 FLJ46082 NM_207417.1 8.54 9.06 -1.44 1.31E-02ILMN_5518 H2BFS NM_017445.1 12.15 12.65 -1.41 1.41E-02ILMN_13579 FAM43B NM_207334.1 8.19 8.68 -1.41 6.71E-03ILMN_21212 FAM43A NM_153690.4 9.88 10.37 -1.4 3.67E-06ILMN_26722 ENPP2 NM_006209.2 7.69 8.17 -1.39 6.79E-03ILMN_24238 LRRN6C NM_152570.1 9.95 10.43 -1.39 8.87E-03ILMN_21387 LRRN5 NM_006338.2 9.24 9.69 -1.36 7.12E-04ILMN_13759 GPR30 NM_001031682.1 10.39 10.82 -1.34 3.07E-02ILMN_5895 CDKN1A NM_078467.1 10.64 11.05 -1.33 3.63E-02ILMN_506 BTBD11 NM_152322.2 9.15 9.56 -1.32 4.47E-03ILMN_13950 FLJ20366 NM_017786.2 9.75 10.14 -1.31 2.98E-02ILMN_28293 HIST2H2BE NM_003528.2 10.83 11.21 -1.3 3.93E-05ILMN_3162 TIMP1 NM_003254.2 11.45 11.82 -1.3 3.85E-03ILMN_15041 ENC1 NM_003633.1 10.36 10.73 -1.3 7.66E-05ILMN_22606 GLRX NM_002064.1 10.19 10.56 -1.29 6.48E-05ILMN_11202 AMT NM_000481.2 11.75 12.11 -1.28 4.04E-02ILMN_138534 ELMO1 NM_130442.1 8.94 9.3 -1.28 9.38E-03ILMN_8275 MGC33846 NM_175885.3 10.3 10.65 -1.28 4.01E-02ILMN_23792 C6orf117 NM_138409.1 10.93 11.28 -1.28 2.94E-05ILMN_13364 ACTG2 NM_001615.3 7.2 7.55 -1.28 1.96E-02ILMN_26493 HIST1H2AC NM_003512.3 9.7 10.05 -1.27 4.50E-02ILMN_27702 C8orf13 NM_053279.1 13.48 13.83 -1.27 1.43E-03ILMN_22375 DSCR8 NM_032589.2 7.54 7.88 -1.27 2.34E-02ILMN_11170 PHACTR2 NM_014721.1 9.92 10.26 -1.27 2.53E-04ILMN_4152 MAB21L2 NM_006439.3 7.43 7.77 -1.27 9.13E-04ILMN_3534 ACCN2 NM_020039.2 9.75 10.1 -1.27 9.91E-07ILMN_20169 FLJ11286 NM_018381.1 8.22 8.56 -1.27 3.70E-02ILMN_22301 PTRF NM_012232.2 7.59 7.93 -1.27 1.24E-02ILMN_23268 CHRNA3 NM_000743.2 12.07 12.4 -1.26 1.93E-02ILMN_9913 ZNF556 NM_024967.1 9.05 9.38 -1.26 1.60E-05ILMN_29202 HTR2B NM_000867.2 7.48 7.81 -1.25 2.87E-05ILMN_1394 MAN1A1 NM_005907.2 7.55 7.87 -1.25 5.88E-04ILMN_6786 GJA12 NM_020435.2 9.63 9.95 -1.25 9.39E-06ILMN_22069 HIST2H4 NM_003548.2 11 11.32 -1.24 1.52E-02ILMN_138549 B3GNT1 NM_006577.3 9 9.31 -1.24 2.42E-02ILMN_28123 IFIT2 NM_001547.3 7.73 8.03 -1.24 1.62E-04ILMN_16651 ENO3 NM_001976.2 11.61 11.91 -1.24 3.87E-02ILMN_26733 HIST2H2AA NM_003516.2 10.04 10.35 -1.24 8.15E-03ILMN_23954 MSRB3 NM_198080.2 7.38 7.69 -1.24 4.11E-02ILMN_16171 FGF14 NM_175929.1 9.64 9.94 -1.23 2.82E-03ILMN_14234 C6orf48 NM_016947.1 10.55 10.86 -1.23 7.51E-05ILMN_2192 CACNB2 NM_201572.1 7.08 7.38 -1.23 8.35E-04



Konopka_Supplementary_Table_2Genes regulated by both FOXP2 and FOXP2chimp

UpregulatedGeneName Human vs Cntl Pvalue Chimp vs Cntl Pvalue

Fold Change Fold ChangeALDH1A3 1.34 2.56E-03 1.27 1.09E-02BOC 1.23 3.28E-03 1.37 6.12E-05C20orf102 1.27 2.30E-04 1.25 7.70E-04C20orf103 1.27 1.55E-05 1.51 9.93E-10CD3Z 1.25 7.11E-06 1.26 4.72E-06CGNL1 1.85 3.59E-15 1.75 6.74E-14CRABP2 1.72 1.90E-04 2.1 2.85E-06DPYSL3 1.51 2.23E-06 1.24 4.39E-03FRAS1 1.32 8.20E-04 1.51 7.46E-06FRMD3 1.37 5.60E-05 1.49 1.23E-06GNG8 1.47 8.70E-04 1.69 2.30E-05IGSF21 1.33 3.95E-05 1.47 7.65E-07ITGB5 1.53 7.40E-04 1.73 3.37E-05JSRP1 1.25 9.30E-04 1.45 8.53E-07KIAA1161 1.33 2.20E-04 1.4 2.82E-05LBH 1.27 1.14E-03 1.32 1.90E-04NEUROG2 1.65 2.85E-03 2.01 9.88E-05NPPA 1.39 1.77E-06 1.44 4.31E-07PI15 1.25 5.85E-05 1.43 3.58E-08PTPRM 1.24 9.76E-05 1.28 1.27E-05RAFTLIN 1.39 1.25E-10 1.64 1.31E-14RAMP1 1.28 2.09E-05 1.51 6.26E-09RET 1.35 8.05E-05 1.57 2.21E-07RUNX3 1.28 9.53E-03 1.26 1.50E-02SERPINE2 1.35 2.56E-03 1.35 3.38E-03SIX5 1.32 3.73E-08 1.34 2.39E-08SLC6A2 1.23 2.00E-04 1.24 1.60E-04SPOCK 1.64 4.73E-08 1.4 1.81E-05STC2 1.34 4.65E-11 1.64 3.25E-16STX3A 1.27 4.93E-08 1.35 1.07E-09TNS3 1.58 3.40E-05 1.61 1.76E-05VIM 1.44 8.27E-06 1.75 1.03E-08

DownregulatedGeneName Human vs Cntl Pvalue Chimp vs Cntl Pvalue

Fold Change Fold ChangeCBLN4 -1.77 1.61E-12 -1.95 4.30E-14CDH11 -1.38 7.76E-05 -1.62 1.38E-07CDH12 -1.27 1.42E-03 -1.27 1.32E-03CHD5 -1.37 4.51E-08 -1.43 5.27E-09DACH1 -1.39 1.48E-07 -1.35 5.71E-07DYNLT3 -1.41 4.19E-06 -1.54 1.95E-07EGR1 -1.27 1.43E-06 -1.35 2.24E-08IL7 -1.25 8.44E-05 -1.32 6.35E-06KCNT1 -1.45 1.80E-04 -1.62 6.87E-06KIAA0125 -1.64 4.21E-12 -1.93 4.49E-15LMO4 -1.38 1.39E-10 -1.31 1.07E-08MYD88 -1.26 3.20E-04 -1.3 4.77E-05MYOZ3 -1.57 1.44E-03 -1.55 1.89E-03NNAT -3.76 1.60E-04 -3.78 1.40E-04OKL38 -1.27 1.98E-03 -1.28 1.70E-03PMCH -1.47 6.48E-03 -1.32 4.53E-02PNMA3 -1.43 2.01E-03 -1.51 6.40E-04PPP2R2C -1.25 1.72E-02 -1.51 7.76E-05PRKCA -1.33 8.14E-03 -1.32 9.84E-03SCGN -1.24 4.33E-03 -1.27 1.38E-03SIX6 -1.48 4.43E-07 -1.36 3.37E-05ST8SIA1 -1.39 2.22E-06 -1.44 5.08E-07TMEM54 -1.3 2.01E-06 -1.32 1.38E-06VIP -3.12 8.92E-09 -2.93 4.60E-08VSNL1 -1.36 1.10E-05 -1.42 9.53E-07

Table of genes significantly changed with human FOXP2 compared to control cells (Cntl) andFOXP2chimp (Chimp) compared to control cells, but not more than log 0.3 fold change between FOXP2 and FOXP2chimp. Genes had to be changed in any combination of two out of threeindependent cell lines.



Konopka_Supplementary_Table_3Directional changes of differentially expressed genes

Human more upregulated Opposite DirectionsHuman vs Cntl Chimp vs Cntl Human vs Cntl Chimp vs Cntl

FOXP2 13.83 9.38 ABCB4 1.21 -1.06PROM1 1.5 1.15 TFAP2D 1.17 -1.09

EXPH5 1.16 -1.09POPDC2 1.16 -1.08

Chimp more upregulated RUNX1T1 1.16 -1.41Human vs Cntl Chimp vs Cntl ADAMTS9 1.15 -1.19

PRPH 1.08 2.20 FRZB 1.15 -1.15EDNRA 1.19 1.93 LRRC8C 1.15 -1.13IGFBP3 1.17 1.85 HEBP2 1.14 -1.47C6orf117 1.33 1.71 IGFBP4 1.14 -1.11PPP2R2B 1.06 1.65 ZNF608 1.14 -1.10BTBD11 1.16 1.55 EPAS1 1.14 -1.49FLJ46082 1.04 1.49 FSTL5 1.13 -1.13CDKN1A 1.12 1.48 LRRN6A 1.13 -1.20FAM43A 1.02 1.43 PDGFRA 1.13 -1.64FAM43B 1.01 1.42 SYK 1.13 -1.10ENPP2 1.01 1.41 TMEFF2 1.12 -1.11PHACTR2 1.08 1.38 EYA1 1.11 -1.40GLRX 1.02 1.31 ZNF521 1.11 -1.43AMT 1.01 1.28 MORC4 1.09 -1.15CHRNA3 1.01 1.27 SLIT1 1.09 -1.28FLJ11286 1.01 1.27 SH3PXD2B 1.08 -1.15HTR2B 1.01 1.27 TGIF 1.07 -1.34ZNF556 1.01 1.27 SYT4 1.07 -1.36ENO3 1.02 1.27 COL9A1 1.06 -1.18TIMP1 1.02 1.27 L3MBTL3 1.06 -1.16

MFHAS1 1.06 -1.20NPTX2 1.06 -1.17

Human more downregulated RDX 1.06 -1.22Human vs Cntl Chimp vs Cntl TMTC2 1.06 -1.19

MAGEA10 -1.88 -1.09 SMARCA2 1.06 -1.33C7 1.05 -1.20MEIS1 1.05 -1.22ROR2 1.05 -1.57

Chimp more downregulated FLJ20366 1.04 1.27Human vs Cntl Chimp vs Cntl PRNP 1.04 -1.67

GRM8 -1.12 -2.08 RSRC1 1.04 -1.41CDCA7L -1.06 -1.89 ZCCHC12 1.04 -1.29ARHGEF16 -1.05 -1.53 HDAC9 1.02 -1.21DPYD -1.09 -1.43 LRRC4C 1.02 -1.22FOXN4 -1.01 -1.41 AGTR1 1.02 -1.52HIST1H2BH -1.06 -1.40 CCNA1 1.02 -1.28ISLR2 -1.04 -1.35 MGST1 1.01 -1.24ADM -1.01 -1.35 PRICKLE1 1.01 -1.44PCAF -1.06 -1.34 SLC30A3 1.01 -1.73RNF182 -1.06 -1.34 SNCAIP 1.01 -1.48BCAN 0 -1.29 ZNF702 1.01 -1.30EFNB2 0 -1.29 B3GNT1 -1.02 1.22FLJ35409 -1.03 -1.27 ACCN2 -1.03 1.23

ELMO1 -1.03 1.25FGF14 -1.04 1.20MGC33846 -1.04 1.23C6orf48 -1.05 1.17GJA12 -1.05 1.20LRRN5 -1.05 1.30MAN1A1 -1.06 1.17CACNB2 -1.07 1.15IFIT2 -1.07 1.16MAB21L2 -1.07 1.19MSRB3 -1.08 1.14LRRN6C -1.08 1.29TUBA6 -1.08 1.37GPR30 -1.11 1.21HIST2H2BE -1.11 1.17ACTA2 -1.11 1.52DCN -1.12 1.59HIST2H4 -1.13 1.10PCDH17 -1.13 1.39C8orf13 -1.14 1.10ENC1 -1.16 1.12HIST1H2AC -1.16 1.10PTRF -1.16 1.09TMEM100 -1.16 1.37HIST2H2AA -1.17 1.06H2BFS -1.20 1.18ACTG2 -1.21 1.21DSCR8 -1.21 1.04MAOB -1.21 1.27TAGLN -1.29 1.18IRF6 -1.34 1.16

Fold changes in gene expression in cells expressing human FOXP2 compared to control cells(Cntl) versus in cells expressing FOXP2chimp (Chimp) compared to control cells.



Konopka_Supplementary_Table_4Potential FOXP2 binding sites in promoters of differentially expressed genes.

GeneName AATTTG CAAATT [G/A][T/C][A/C]AA[C/T]A T[A/G]TT[T/G][A/G][T/C] A[C/T]AAATA TATTT[A/G]T ACAAAT ATTTGT AATTTGT ACAAATT ATTT AAATABCB4 1 0 3 4 1 2 2 2 0 0 16 14ACCN2 0 1 0 1 0 0 0 0 0 0 2 1ACTA2 0 2 4 2 0 1 1 1 0 1 8 10ACTG2 0 0 3 1 0 0 1 0 0 0 7 5ADAMTS9 0 0 0 0 0 0 0 0 0 0 1 3ADM 0 0 0 0 0 0 0 0 0 0 5 9AGTR1 1 0 3 3 0 2 1 1 0 0 12 10AMT 0 0 2 2 1 1 0 1 0 0 3 2ARHGEF16 0 0 1 1 0 0 0 0 0 0 1 2B3GNT1 2 1 3 2 1 1 0 2 0 0 11 14BCAN 0 0 1 1 1 0 1 1 0 0 7 3BTBD11 0 1 0 0 0 0 1 0 0 0 5 8C6orf117 0 0 0 3 0 1 0 1 0 0 7 5C6orf48 0 1 2 4 1 0 0 2 0 0 14 10C7 0 0 0 1 0 0 0 0 0 0 9 14C8orf13 0 0 0 1 0 0 0 0 0 0 5 2CACNB2 1 2 1 5 0 1 1 1 0 1 22 9CCNA1 0 0 0 1 0 0 0 0 0 0 6 5CDCA7L 0 2 4 4 1 2 0 2 0 0 13 12CDKN1A 0 0 2 1 0 1 0 1 0 0 14 8CHRNA3 1 0 2 1 1 0 0 1 1 0 5 11COL9A1 1 0 3 2 1 0 1 0 0 0 13 9DCN 1 1 4 3 1 0 2 2 0 1 18 19DPYD 2 2 1 3 0 2 1 1 0 1 18 14DSCR8 0 0 4 2 0 1 0 1 0 0 4 8EDNRA 1 0 0 0 0 0 0 2 1 0 5 4EFNB2 0 0 0 0 0 0 0 0 0 0 0 0ELMO1 2 1 5 6 1 1 3 2 1 0 16 12ENC1 0 0 1 1 0 0 0 0 0 0 5 8ENO3 0 0 0 1 0 0 0 0 0 0 1 1ENPP2 0 1 1 0 1 0 1 1 0 0 13 12EPAS1 0 1 1 3 0 2 1 0 0 1 13 10EXPH5 0 0 5 5 0 0 0 1 0 0 7 15EYA1 1 1 4 3 1 0 1 1 0 0 16 15FAM43A 1 0 0 2 0 1 0 1 0 0 7 8FAM43B 0 0 1 1 1 0 1 0 0 0 3 5FGF14 1 0 1 2 1 0 1 1 0 0 15 8FLJ11286 1 0 3 2 0 2 0 0 0 0 8 6FLJ20366 2 1 3 4 1 0 3 1 1 1 13 12FLJ35409 0 0 0 0 0 0 0 0 0 0 6 3FLJ46082 1 0 0 1 0 0 1 0 0 0 6 4FOXN4 0 0 1 1 1 0 1 0 0 0 4 3FOXP2 2 1 5 5 0 2 1 3 2 1 20 19FRZB 0 0 1 0 1 0 0 0 0 0 2 3FSTL5 0 0 2 1 2 0 1 1 0 0 8 10GJA12 0 0 0 0 0 0 0 0 0 0 0 3GLRX 2 0 3 2 0 0 0 1 0 0 10 8GPR30 1 1 2 0 1 0 2 1 1 1 9 13GRM8 1 0 2 3 1 1 1 2 0 0 13 15H2BFS 0 2 1 1 0 0 0 0 0 0 8 7HDAC9 1 2 3 2 1 2 1 2 1 0 16 17HEBP2 2 0 2 11 0 11 0 0 0 0 16 10HIST1H2AC 1 0 0 3 0 0 0 0 0 0 9 8HIST1H2BH 1 0 2 3 1 1 0 0 0 0 18 11HIST2H2AA 1 1 0 1 0 0 0 0 0 0 3 3HIST2H2BE 1 0 0 3 0 0 0 0 0 0 3 5HIST2H4 0 0 1 0 0 0 1 0 0 0 7 8HTR2B 1 2 1 0 0 0 2 0 0 1 13 21IFIT2 0 0 1 1 0 0 0 0 0 0 10 9IGFBP3 0 0 1 4 0 3 0 1 0 0 11 7



Konopka_Supplementary_Table_4 (continued)Potential FOXP2 binding sites in promoters of differentially expressed genes.

IGFBP4 0 0 2 0 1 0 1 0 0 0 2 5IRF6 0 0 3 2 1 2 1 2 0 0 6 3ISLR2 0 1 0 1 0 0 0 0 0 0 3 5L3MBTL3 1 0 2 4 0 1 0 2 0 0 7 6LRRC4C 0 0 0 3 0 3 0 0 0 0 14 0LRRC8C 0 0 3 0 1 0 0 0 0 0 9 11LRRN5 0 1 1 2 0 0 1 1 0 1 4 6LRRN6A 0 0 1 0 0 0 0 0 0 0 0 1LRRN6C 1 1 0 2 0 1 1 2 0 1 24 10MAB21L2 0 0 0 1 0 0 1 0 0 0 14 10MAGEA10 0 0 1 0 0 0 0 0 0 0 3 5MAN1A1 1 0 0 1 0 1 0 1 0 0 5 4MAOB 1 0 0 2 0 0 0 1 0 0 6 4MEIS1 2 2 2 3 0 2 1 1 1 1 15 16MFHAS1 0 0 1 1 0 0 0 0 0 0 6 9MGC33846 0 0 1 0 0 0 0 0 0 0 2 6MGST1 1 2 1 0 1 0 0 0 0 0 10 12MORC4 0 0 3 2 0 2 0 1 0 0 10 6MSRB3 0 0 0 1 0 0 0 0 0 0 8 2NPTX2 1 1 0 0 0 0 1 0 0 1 1 1PCAF 0 0 1 1 0 1 1 0 0 0 6 7PCDH17 0 0 0 2 0 0 0 0 0 0 5 6PDGFRA 0 0 1 1 0 0 0 0 0 0 6 6PHACTR2 1 2 2 4 1 3 1 3 0 1 23 16POPDC2 2 1 1 3 1 1 1 1 0 0 7 8PPP2R2B 2 1 1 3 0 1 1 1 1 1 13 13PRICKLE1 1 1 1 4 1 1 2 2 1 1 11 9PRNP 2 0 4 2 1 1 0 1 0 0 19 15PROM1 0 1 2 0 0 0 0 1 0 0 5 6PRPH 0 0 1 0 0 0 0 0 0 0 1 2PTRF 0 0 2 0 0 0 0 0 0 0 4 11RDX 1 0 1 1 0 0 0 0 0 0 6 8RNF182 1 0 2 4 1 0 0 2 1 0 11 8ROR2 1 1 1 1 1 0 1 2 0 0 7 4RSRC1 2 0 4 4 0 1 0 1 0 0 15 16RUNX1T1 2 1 4 5 2 2 1 2 0 1 19 17SH3PXD2B 0 0 1 0 0 0 0 2 0 0 2 4SLC30A3 1 0 1 1 0 0 0 1 0 0 6 3SLIT1 0 0 1 0 1 0 1 0 0 0 3 4SMARCA2 3 1 2 5 1 1 1 2 2 0 21 20SNCAIP 0 1 1 3 0 1 1 1 0 1 13 11SYK 1 0 1 1 0 0 0 0 0 0 7 6SYT4 2 0 0 2 0 0 0 2 1 0 14 10TAGLN 0 0 0 1 0 0 0 0 0 0 0 3TFAP2D 0 1 2 3 0 2 0 0 0 0 11 10TGIF 1 1 3 2 1 0 1 1 1 0 9 9TIMP1 2 0 1 3 0 1 2 2 1 0 9 6TMEFF2 0 0 1 0 0 0 1 0 0 0 1 2TMEM100 2 1 4 1 1 0 1 1 0 0 6 13TMTC2 0 0 1 0 0 0 0 0 0 0 1 2TUBA6 0 0 0 0 0 0 0 0 0 0 1 1ZCCHC12 0 1 0 2 0 0 0 0 0 0 5 6ZNF521 1 1 3 5 1 0 1 0 0 1 11 7ZNF556 0 0 0 1 0 0 0 0 0 0 3 1ZNF608 1 0 0 2 0 0 0 1 1 0 11 10ZNF702 0 1 4 6 4 2 2 1 0 0 17 9

Promoters were defined as 1000bp upstream of the transcriptional start site of all isoforms of a given gene in Ensemble. Binding sites were derived from the following sources:AATTTG or CAAATT, complete FOXP2 binding site based on crystal structure of DNA binding domain (Stroud et al., Structure, 2006)[G/A][T/C][A/C]AA[C/T]A or T[A/G]TT[T/G][A/G][T/C], forkhead binding domain (Pierrou et al., EMBO, 1994; Overdier et al., MCB, 1994)A[C/T]AAATA or TATTT[A/G]T, FOXP1 or FOXP2 consensus sequence (Wang et al., 2003)ACAAAT, ATTTGT, AATTTGT, ACAAATT, ATTT, AAAT, variations on the FOXP2 binding sequence from (Stroud et al., Structure, 2006), with the shortest sequences denoted as "core" sequences



Konopka_Supplementary_Table_5Gene ontology of differentially expressed genes

UpregulatedCategory Term Count % PValueGOTERM_BP_ALL GO:0032501~multicellular organismal process 25 42.37% 5.07E-05GOTERM_BP_ALL GO:0050789~regulation of biological process 26 44.07% 4.87E-04INTERPRO IPR003591:Leucine-rich repeat, typical subtype 5 8.47% 7.57E-04GOTERM_BP_ALL GO:0065007~biological regulation 27 45.76% 8.84E-04INTERPRO IPR013098:Immunoglobulin I-set 5 8.47% 8.91E-04GOTERM_BP_ALL GO:0007275~multicellular organismal development 17 28.81% 1.30E-03GOTERM_BP_ALL GO:0048856~anatomical structure development 16 27.12% 1.70E-03GOTERM_BP_ALL GO:0048513~organ development 12 20.34% 1.80E-03SMART SM00369:LRR_TYP 5 8.47% 1.84E-03GOTERM_BP_ALL GO:0009653~anatomical structure morphogenesis 11 18.64% 2.25E-03GOTERM_BP_ALL GO:0048731~system development 14 23.73% 2.41E-03GOTERM_BP_ALL GO:0032502~developmental process 20 33.90% 2.47E-03GOTERM_BP_ALL GO:0050794~regulation of cellular process 23 38.98% 3.09E-03UP_SEQ_FEATURE disulfide bond 16 27.12% 5.06E-03GOTERM_BP_ALL GO:0009887~organ morphogenesis 6 10.17% 9.95E-03INTERPRO IPR001611:Leucine-rich repeat 5 8.47% 1.01E-02SP_PIR_KEYWORDS leucine-rich repeat 5 8.47% 1.03E-02UP_SEQ_FEATURE signal peptide 16 27.12% 1.04E-02SP_PIR_KEYWORDS chromosomal rearrangement 5 8.47% 1.05E-02INTERPRO IPR007110:Immunoglobulin-like 6 10.17% 1.23E-02GOTERM_BP_ALL GO:0045055~regulated secretory pathway 3 5.08% 1.25E-02COG_ONTOLOGY Function unknown 4 6.78% 1.31E-02GOTERM_BP_ALL GO:0019222~regulation of metabolic process 16 27.12% 1.56E-02SP_PIR_KEYWORDS tyrosine-specific protein kinase 3 5.08% 1.59E-02INTERPRO IPR013783:Immunoglobulin-like fold 6 10.17% 1.74E-02SP_PIR_KEYWORDS activator 6 10.17% 1.79E-02GOTERM_BP_ALL GO:0007267~cell-cell signaling 7 11.86% 1.82E-02SP_PIR_KEYWORDS Transcription 13 22.03% 1.84E-02UP_SEQ_FEATURE domain:EGF-like 3 5.08% 1.86E-02SP_PIR_KEYWORDS Developmental protein 7 11.86% 2.25E-02SP_PIR_KEYWORDS Secreted 11 18.64% 2.37E-02GOTERM_BP_ALL GO:0031323~regulation of cellular metabolic process 15 25.42% 2.60E-02GOTERM_BP_ALL GO:0003001~generation of a signal involved in cell-cell signaling 3 5.08% 2.62E-02SP_PIR_KEYWORDS disease mutation 11 18.64% 2.63E-02INTERPRO IPR003598:Immunoglobulin subtype 2 4 6.78% 2.85E-02GOTERM_BP_ALL GO:0046903~secretion 5 8.47% 2.87E-02GOTERM_CC_ALL GO:0005667~transcription factor complex 4 6.78% 2.91E-02SP_PIR_KEYWORDS signal 17 28.81% 3.04E-02GOTERM_BP_ALL GO:0019219~regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolic process 14 23.73% 3.04E-02GOTERM_MF_ALL GO:0005488~binding 45 76.27% 3.14E-02INTERPRO IPR000483:Cysteine-rich flanking region, C-terminal 3 5.08% 3.18E-02INTERPRO IPR000372:Leucine-rich repeat, cysteine-rich flanking region, N-terminal 3 5.08% 3.66E-02SP_PIR_KEYWORDS Transcription regulation 12 20.34% 3.69E-02SP_PIR_KEYWORDS egf-like domain 4 6.78% 3.74E-02GOTERM_BP_ALL GO:0010468~regulation of gene expression 14 23.73% 4.06E-02GOTERM_BP_ALL GO:0006139~nucleobase, nucleoside, nucleotide and nucleic acid metabolic process 18 30.51% 4.27E-02SP_PIR_KEYWORDS ubl conjugation 5 8.47% 4.29E-02UP_SEQ_FEATURE glycosylation site:N-linked (GlcNAc...) 17 28.81% 4.32E-02INTERPRO IPR008266:Tyrosine protein kinase, active site 3 5.08% 4.33E-02

DowregulatedCategory Term Count % PValueSP_PIR_KEYWORDS acetylation 8 17.78% 3.61E-04GOTERM_MF_ALL GO:0019888~protein phosphatase regulator activity 3 6.67% 4.51E-03GOTERM_MF_ALL GO:0019208~phosphatase regulator activity 3 6.67% 4.91E-03GOTERM_BP_ALL GO:0048856~anatomical structure development 11 24.44% 1.28E-02GOTERM_BP_ALL GO:0048731~system development 9 20.00% 3.20E-02GOTERM_BP_ALL GO:0032502~developmental process 13 28.89% 3.23E-02GOTERM_BP_ALL GO:0001558~regulation of cell growth 3 6.67% 4.33E-02GOTERM_BP_ALL GO:0048468~cell development 7 15.56% 4.98E-02



Konopka_Supplementary_Table_6Luciferase promoter information.

Number of Forkhead SitesNumber of canonical FOXP2 sites ([A/G][C/T][A/C]AA[C/T]A

Gene Symbol Chromosome Strand Start End (AATTTG or CAAATT) or T[G/A]TT[T/G][G/A][T/C])ACTA2 10 - 90702408 90703345 2 2CDCA7L 7 - 21758652 21759743 2 4GRM8 7 - 126486678 126487590 0 2IGFBP3 7 - 45733923 45734957 0 2PPP2R2B 5 - 146067396 146068457 1 1ROR2 9 - 91791863 91792803 2 2SLC30A3 2 - 27397409 27398508 0 1TAGLN 11 + 116574429 116575369 0 1

Coordinates are from UCSC May 2004 assembly.



Konopka_Supplementary_Table_7Connectivity values for all genes in WGCNA modules.

Fig 3 Network Kme Fig 3 Network KmeSYT4 0.9116 DOC2B 0.5457GRM7 0.8918 BC37295_3 0.5316ZCCHC12 0.8862 IER3IP1 0.5281C7 0.8854 WNT3 0.5261RBPMS2 0.8791 FLJ90231 0.5203ADAMTS9 0.8783 GYPE 0.5058ROR2 0.8774 CRYBB1 0.4869ADM 0.8746 RUNX1T1 0.3812TRIM36 0.8713 UBE2H -0.5045ELF4 0.8582 AHNAK -0.5421ISLR2 0.8562 CDH18 -0.5479C3orf32 0.8528 CAPS -0.5486PDGFRA 0.8526 KIAA1862 -0.5565RDX 0.8330 TNFRSF14 -0.5586AMOT 0.8302 NRTN -0.5631EFNB2 0.8276 EMB -0.5643MGST1 0.8249 NTS -0.5707RUNX1T1 0.8231 IFITM2 -0.5715ZNF702 0.8223 ISG20 -0.5950FRZB 0.8135 BID -0.6051CXCR4 0.8124 GLS -0.6200ZNF521 0.8112 PCDHA4 -0.6215SMAD3 0.8095 TACC2 -0.6258PIWIL1 0.8090 HOXD13 -0.6292FLJ35409 0.8067 C9orf103 -0.6308NDN 0.8041 ARHGEF7 -0.6354ASB9 0.8008 FLJ45909 -0.6400CWF19L2 0.8005 HCST -0.6471METRNL 0.8001 C6orf117 -0.6478C9orf58 0.7937 CSEN -0.6489LRRTM4 0.7918 OVCA2 -0.6575RAB32 0.7879 C9orf4 -0.6580ZNF537 0.7832 SDSL -0.6584CPNE2 0.7830 MATR3 -0.6612TCEAL2 0.7817 NME3 -0.6614SLC25A24 0.7812 GLRX2 -0.6652ALKBH8 0.7789 GBGT1 -0.6688SPSB4 0.7727 SYT1 -0.6716LOX 0.7710 SALL4 -0.6773PCAF 0.7702 PNCK -0.6790SNCAIP 0.7585 MAGEA3 -0.6793IGFBP4 0.7554 PLAGL1 -0.6814RFC3 0.7527 FNDC5 -0.6840RASL11B 0.7457 SGK -0.6868NELL1 0.7439 C1orf85 -0.6893ACSL3 0.7404 GCH1 -0.6898RAI2 0.7401 DDIT4 -0.6899S100A6 0.7361 C9orf111 -0.6932LIG1 0.7326 ABCC3 -0.6955FLJ36748 0.7308 HTR2B -0.7112MTA3 0.7205 FLRT3 -0.7191LRRC8C 0.7177 STEAP3 -0.7219CDCA7L 0.7160 GRIA3 -0.7264HEBP2 0.7156 HIST2H2AA -0.7268TMPO 0.7042 GYG2 -0.7298NCAM1 0.7035 BSCL2 -0.7329POPDC2 0.6994 LOC352909 -0.7343XK 0.6936 RAB31 -0.7411TFAP2D 0.6919 HIST1H4H -0.7479FSTL1 0.6861 PQBP1 -0.7480ICK 0.6849 BCHE -0.7499FLJ14001 0.6830 CPB1 -0.7567PITPNM1 0.6816 MAGEA6 -0.7606SYK 0.6803 ATP6V1G2 -0.7637LRRK1 0.6779 AXUD1 -0.7654MRC2 0.6745 ENO3 -0.7689L3MBTL3 0.6715 FLJ11286 -0.7855STMN4 0.6615 MGC33846 -0.7867RTN4R 0.6596 HIST1H2AE -0.7911KCNQ2 0.6586 EGFR -0.7913PFTK1 0.6556 ACTA2 -0.7979PTPRR 0.6535 GARNL3 -0.7998CNTNAP5 0.6489 RGS16 -0.8000GYPE 0.6423 SYNPR -0.8012TMEFF2 0.6370 GABRA3 -0.8025PPIL6 0.6340 PVRL2 -0.8092HDAC9 0.6333 MAOB -0.8160FBXO27 0.6333 GPR30 -0.8165DECR1 0.6304 PPP2R2B -0.8169HSD17B1 0.6274 TIMP1 -0.8172WDR62 0.6270 ZNF488 -0.8203MSN 0.6162 FLJ46082 -0.8265BCL6B 0.6160 C1orf53 -0.8307NGB 0.6148 WDR22 -0.8379PRTFDC1 0.6108 HIST2H2BE -0.8435HR 0.6105 GLRX -0.8467CCDC71 0.6041 LRRN6C -0.8573SCRG1 0.6037 CHRNA3 -0.8612RBL1 0.6017 DLX5 -0.8793EMID1 0.5963 AMT -0.8857SH3PXD2B 0.5842 ZNF556 -0.9025C10orf39 0.5730 PRPH -0.9152ECT2 0.5716 FAM43A -0.9410TMTC2 0.5683 EBF3 -0.9436KIAA1522 0.5560

Supp Fig 6a Network Kme Supp Fig 6b Network KmeSLC30A3 0.9373 TNS3 0.9266EPAS1 0.9293 FRMD3 0.8635ARHGEF16 0.8778 SLC2A1 0.8525XKRX 0.8770 BTBD11 0.8487BCAN 0.8703 SPOCK2 0.8399PCOLCE2 0.8670 CGNL1 0.8329PRICKLE1 0.8549 IGFBP5 0.8196EYA1 0.8529 STX3A 0.7941GAL 0.8523 ITGB5 0.7778SLIT1 0.8458 KIAA0644 0.7771SMARCA2 0.8429 HOXD10 0.7734KIAA1712 0.8348 ADARB1 0.7693NGFRAP1L1 0.8280 FOXP2 0.7605TLE3 0.8254 KIAA1161 0.7523TEAD2 0.8246 FLJ33790 0.7491FBXL7 0.8239 PMP22 0.7481SPAG6 0.8144 FBLN2 0.7442CHRM3 0.8118 NPPA 0.7364CCNA1 0.8071 PI15 0.7282BAIAP2L1 0.8017 HOXD1 0.7274KCNS1 0.8014 STC2 0.7224RNF182 0.8008 LBH 0.7191FGFR3 0.7980 TNFRSF19 0.6831FLJ37440 0.7930 CDK6 0.6493HERC5 0.7883 KCNG1 0.6483FLJ20130 0.7834 ABHD1 0.6435COL18A1 0.7720 GFRA2 0.6319PDE5A 0.7718 LHX8 0.6251PPP2R2C 0.7713 KIAA1370 0.6234LBX2 0.7694 UNQ830 0.6066LOC285498 0.7672 CYP2J2 0.6053NEK1 0.7607 SAMD4A 0.5926C12orf34 0.7557 KITLG 0.5811SULF2 0.7541 ART5 0.5746SREBF1 0.7536 ACOT11 0.5710ACACB 0.7438 ZNF423 0.5702FOXN4 0.7427 BHMT2 0.5577PFKL 0.7424 FLJ22386 0.5564SLITRK5 0.7399 NCOA7 0.5501KCNQ2 0.7318 DLL1 0.4844ZNF447 0.7258 KIAA1914 0.3594GPR161 0.7227 CALCOCO1 0.3169C20orf160 0.7192 RKHD2 -0.3335EPS8L1 0.7047 PRRG1 -0.5086SRR 0.7012 SKP2 -0.5095MEIS1 0.7003 MT1F -0.5165COL9A1 0.6981 TOP1 -0.5477ADAMTS19 0.6977 OKL38 -0.5990DOCK6 0.6960 MANEAL -0.6491RAB36 0.6918 PNMA6A -0.6575JAG1 0.6913 GLRA2 -0.6642NRM 0.6869 LMO4 -0.6986KCNH8 0.6849 PAPSS2 -0.7154ARHGAP22 0.6789 PANX2 -0.7284SCARA3 0.6730 TBX3 -0.7451OAF 0.6723 CBLN4 -0.7578HSPC047 0.6684 ST8SIA1 -0.8041PRG2 0.6670 PNMA3 -0.8276YPEL1 0.6648 SIX6 -0.8667ITGB3BP 0.6475 NNAT -0.9038DNAJC5G 0.6457PLAUR 0.6402P4HA1 0.6401ZNF704 0.6345CCDC64 0.6343CBR3 0.6311ADAMTS1 0.6278GCGR 0.6272BRUNOL5 0.6221KIAA0961 0.6171CCDC33 0.6001LRRN3 0.5402IFIT2 -0.5533GPC3 -0.6149GNG3 -0.6266HIST1H2AG -0.6344PIGZ -0.6636MXRA8 -0.6696MGC14376 -0.6725CEBPB -0.6778C8orf13 -0.6856FNDC3A -0.6864CACNB2 -0.6912TPST2 -0.6929HIST1H3H -0.6987PCTP -0.7005ACTG2 -0.7072C10orf65 -0.7082BAALC -0.7131TNFRSF1A -0.7243HIST1H2BG -0.7365LRRN5 -0.7370DBC1 -0.7403HIST1H2BK -0.7452FAM43B -0.7469KCNG3 -0.7514TRAF3IP2 -0.7552HIST1H2AC -0.7661SLC31A2 -0.7817CSAG3A -0.7976CAMK4 -0.8063C6orf134 -0.8066RAC2 -0.8092MAGEA2 -0.8192TMEM100 -0.8302DYNC1I1 -0.8391SGNE1 -0.8404FLJ20366 -0.8532H2BFS -0.8569ELMO1 -0.8679FAM112B -0.9385



Konopka_Supplementary_Table_8Differentially expressed genes enriched in specific human fetal brain regions or containing ahuman accelerated highly conserved noncoding sequence (haCNS).

Gene Symbol Fetal Brain Region EnrichmentAGTR1 CerebellumCHRNA3 CerebellumENC1 Perisylvian CortexEXPH5 CerebellumFOXP2 Perisylvian CortexGOLSYN (FLJ20366) Perisylvian CortexHDAC9 Neocortex + HippocampusHIST1H2AC CerebellumLINGO1 (LRRN6A) Perisylvian CortexMAOB HippocampusPRICKLE1 ThalamusPROM1 NeocortexRSRC1 ThalamusSMARCA2 Neocortex

Gene Symbol haCNS caCNSDPYD Yes NoEFNB2 Yes YesFOXP2 Yes YesGRM8 Yes YesLINGO1 (LRRN6A) Yes NoLRRN2 (LRRN5) Yes NoMAN1A1 Yes YesMEIS1 Yes YesPPP2R2B Yes NoRUNX1T1 Yes YesSMARCA2 Yes YesTFAP2D Yes NoZNF608 Yes Yes

The perisylvian cortex and cerebellum, two brain regions with elevated FOXP2 expression, have asignificant enrichment of differentiallyexpressed genes (P=1.1e-04 and P=1.3e-04). Fourteendifferentially expressed genes have a haCNS (P=1.2e-06), and five of these are specific to thehuman lineage, as they do not have a chimpanzee accelerated CNS (caCNS) (P=0.04). Data for comparison is from Johnson et al., Neuron, 2009.



Konopka_Supplementary_Table_9Positive selection of differentially expressed genes.

Human vs. Chimpanzee Human vs. Chimpazee Chimpanzee vs. Rhesus MacaqueUpregulated Ensemble Chimpanzee Sequencing Consortium EnsembleGeneName dN dS dN/dS Ka Ks Ka/Ks dN dS dN/dSADM 0.0000 0.0000 N/A 0.0000 0.0000 N/A 0.0191 0.0848 0.2252FLJ35409 N/A N/A N/A N/A N/A N/A N/A N/A N/AZNF702 (FLJ12985) N/A N/A N/A 0.0038 0.0000 N/A N/A N/A N/AZCCHC12 0.0025 0.0026 0.9615 N/A N/A N/A 0.0163 0.0617 0.2642COL9A1 0.0045 0.0053 0.8491 N/A N/A N/A 0.0151 0.0603 0.2504EXPH5 0.0065 0.0088 0.7386 N/A N/A N/A 0.0316 0.0642 0.4922C7 0.0044 0.0103 0.4272 N/A N/A N/A 0.0193 0.0707 0.2730ZNF608 0.0019 0.0080 0.2375 N/A N/A N/A 0.0029 0.0427 0.0679PCAF 0.0091 0.0426 0.2136 N/A N/A N/A 0.0008 0.0441 0.0181SNCAIP 0.0019 0.0123 0.1545 N/A N/A N/A 0.0107 0.05 0.2140ISLR2 0.0012 0.0084 0.1429 N/A N/A N/A 0.0146 0.0992 0.1472FOXN4 0.0017 0.0137 0.1241 N/A N/A N/A 0.0044 0.1067 0.0412SMARCA2 0.0028 0.0358 0.0782 N/A N/A N/A 0.0004 0.0695 0.0058L3MBTL3 0.0006 0.0092 0.0652 N/A N/A N/A 0.0201 0.1026 0.1959DPYD 0.0009 0.0213 0.0423 N/A N/A N/A 0.0082 0.0395 0.2076LRRC4C 0.0000 0.0104 0.0000 N/A N/A N/A 0.0000 0.0318 0.0000RSRC1 0.0000 0.0069 0.0000 N/A N/A N/A 0.0040 0.0405 0.0988SH3PXD2B (KIAA1295) 0.0116 0.0305 0.3803 0.0145 0.0074 1.9595 0.0163 0.0912 0.1787HEBP2 0.0047 0.0058 0.8103 0.0047 0.0058 0.8103 0.0150 0.071 0.2113MORC4 (FLJ11565) 0.0073 0.0215 0.3395 0.0018 0.0031 0.5806 0.0183 0.055 0.3327FSTL5 (DKFZp566D234) 0.0041 0.0102 0.4020 0.0041 0.0089 0.4607 0.0150 0.0541 0.2773CCNA1 0.0042 0.0093 0.4516 0.0042 0.0093 0.4516 0.0205 0.0671 0.3055EYA1 0.0025 0.0075 0.3333 0.0025 0.0075 0.3333 0.0055 0.0496 0.1109CDCA7L (RAM2) 0.0131 0.0289 0.4533 0.0043 0.0134 0.3209 0.0195 0.0745 0.2617LRRC8C (AD158) 0.0007 0.0033 0.2121 0.0007 0.0022 0.3182 0.0006 0.0372 0.0161MGST1 0.0029 0.0093 0.3118 0.0029 0.0093 0.3118 0.0363 0.0261 1.3908TGIF 0.0060 0.0197 0.3046 0.0060 0.0197 0.3046 0.0541 0.1187 0.4558PROM1 0.0038 0.0146 0.2603 0.0040 0.0145 0.2759 0.0236 0.0703 0.3357ABCB4 0.0022 0.0082 0.2683 0.0019 0.0084 0.2262 0.0244 0.0728 0.3352HDAC9 0.0019 0.0085 0.2235 0.0018 0.0083 0.2169 0.0019 0.044 0.0432SLIT1 (SLIT3) 0.0006 0.0212 0.0283 0.0034 0.0179 0.1899 0.0190 0.171 0.1111AGTR1 0.0013 0.0069 0.1884 0.0013 0.0069 0.1884 0.0042 0.0369 0.1138GRM8 0.0011 0.0061 0.1803 0.0011 0.0063 0.1746 0.0026 0.0411 0.0633PRNP 0.0036 0.0211 0.1706 0.0036 0.0211 0.1706 0.0168 0.1304 0.1288MFHAS1 0.0038 0.0250 0.1520 0.0030 0.0237 0.1266 0.0108 0.0887 0.1218FOXP2 0.0013 0.0205 0.0634 0.0013 0.0110 0.1182 0.0000 0.0329 0.0000PDGFRA 0.0014 0.0124 0.1129 0.0014 0.0125 0.1120 0.0043 0.0481 0.0894ADAMTS9 0.0017 0.0166 0.1024 0.0015 0.0162 0.0926 0.0058 0.0763 0.0760ROR2 0.0055 0.0276 0.1993 0.0024 0.0271 0.0886 0.0079 0.1502 0.0526BCAN 0.0015 0.0138 0.1087 0.0010 0.0131 0.0763 0.0172 0.0908 0.1894TMTC2 (DKFZp762A217) 0.0030 0.0203 0.1478 0.0015 0.0203 0.0739 N/A N/A N/ASYK 0.0008 0.0130 0.0615 0.0009 0.0141 0.0638 0.0043 0.0817 0.0526ARHGEF16 0.0137 0.0454 0.3018 0.0033 0.0518 0.0637 0.0231 0.1922 0.1202PRICKLE1 0.0006 0.0129 0.0465 0.0006 0.0130 0.0462 0.0017 0.0708 0.0240IGFBP4 0.0015 0.0342 0.0439 0.0015 0.0342 0.0439 0.0015 0.126 0.0119EPAS1 0.0557 0.1092 0.5101 0.0005 0.0115 0.0435 0.0217 0.133 0.1632ZNF521 (EHZF) 0.0115 0.0288 0.3993 0.0004 0.0108 0.0370 0.0026 0.0389 0.0668HIST1H2BH 0.0000 0.0533 0.0000 0.0001 0.0636 0.0016 N/A N/A N/AMEIS1 0.0034 0.0099 0.3434 0.0000 0.0051 0.0000 0.0011 0.0228 0.0482POPDC2 0.0013 0.0244 0.0533 0.0000 0.0408 0.0000 0.0200 0.0785 0.2548NPTX2 0.0019 0.0390 0.0487 0.0000 0.0332 0.0000 0.0076 0.1798 0.0423EFNB2 0.0000 0.0197 0.0000 0.0000 0.0197 0.0000 0.0061 0.0288 0.2118FRZB 0.0000 0.0137 0.0000 0.0000 0.0138 0.0000 0.0028 0.0799 0.0350LRRN6A (FLJ14594) 0.0000 0.0228 0.0000 0.0000 0.0220 0.0000 0.0007 0.1591 0.0044RDX 0.0000 0.0119 0.0000 0.0000 0.0124 0.0000 0.0008 0.0425 0.0188RNF182 (MGC33993) 0.0000 0.0118 0.0000 0.0000 0.0118 0.0000 0.0018 0.0595 0.0303RUNX1T1 (CBFA2T1) 0.0000 0.0093 0.0000 0.0000 0.0095 0.0000 0.0448 0.0857 0.5228SLC30A3 0.0000 0.0255 0.0000 0.0000 0.0255 0.0000 0.0046 0.0902 0.0510SYT4 0.0000 0.0078 0.0000 0.0000 0.0080 0.0000 0.0058 0.0341 0.1701TFAP2D (TFAP2BL1) 0.0000 0.0065 0.0000 0.0000 0.0088 0.0000 0.0010 0.0411 0.0243TMEFF2 0.0000 0.0060 0.0000 0.0000 0.0060 0.0000 0.0013 0.0303 0.0429



Konopka_Supplementary_Table_9 (continued)Positive selection of differentially expressed genes.

Human vs. Chimpanzee Human vs. Chimpazee Chimpanzee vs. Rhesus MacaqueDownregulated Ensemble Chimpanzee Sequencing Consortium EnsembleGeneNames dN dS dN/dS Ka Ks Ka/Ks dN dS dN/dSAMT 0.0034 0.0033 1.0303 N/A N/A N/A 0.0118 0.0568 0.2077C6orf117 0.0021 0.0286 0.0734 N/A N/A N/A 0.0050 0.0415 0.1205C6orf48 0.0210 0.0161 1.3043 N/A N/A N/A N/A N/A N/ACDKN1A 0.0000 0.0064 0.0000 0.0000 0.0000 N/A 0.0174 0.0601 0.2895DSCR8 0.0000 0.0000 N/A 0.0000 0.0000 N/A 0.0141 0.0875 0.1611ENO3 0.0022 0.0000 N/A 0.0022 0.0000 N/A 0.0066 0.0805 0.0820FAM43B 0.0012 0.0086 0.1395 N/A N/A N/A 0.0104 0.13 0.0800FLJ46082 0.0000 0.0223 0.0000 N/A N/A N/A 0.0296 0.0969 0.3055H2BFS N/A N/A N/A N/A N/A N/A N/A N/A N/AHIST2H2AA N/A N/A N/A N/A N/A N/A N/A N/A N/AHIST2H4 N/A N/A N/A N/A N/A N/A N/A N/A N/AIFIT2 0.0040 0.0073 0.5479 N/A N/A N/A 0.0086 0.0557 0.1544MGC33846 0.0062 0.0107 0.5794 N/A N/A N/A 0.0167 0.109 0.1532MSRB3 0.0000 0.0052 0.0000 N/A N/A N/A 0.1036 0.2236 0.4633PCDH17 0.0004 0.0137 0.0292 N/A N/A N/A 0.0019 0.0858 0.0221TIMP1 N/A N/A N/A N/A N/A N/A N/A N/A N/AMAGEA10 0.0110 0.0209 0.5263 0.0084 0.0058 1.4483 0.0235 0.067 0.3507PHACTR2 (C6orf56) 0.0092 0.0070 1.3143 0.0093 0.0070 1.3286 0.0179 0.0517 0.3462ZNF556 (FLJ11637) 0.0075 0.0091 0.8242 0.0075 0.0091 0.8242 N/A N/A N/AMAN1A1 0.0027 0.0039 0.6923 0.0029 0.0041 0.7073 0.0713 0.1353 0.5270FLJ20366 0.0029 0.0050 0.5800 0.0033 0.0056 0.5893 N/A N/A N/AENPP2 0.0031 0.0116 0.2672 0.0027 0.0124 0.2177 0.0035 0.076 0.0461CHRNA3 0.0019 0.0125 0.1520 0.0019 0.0125 0.1520 N/A N/A N/AC8orf13 0.0040 0.0297 0.1347 0.0040 0.0297 0.1347 0.0824 0.2142 0.3847LRRN5 (GAC1) 0.0039 0.0183 0.2131 0.0015 0.0116 0.1293 0.0196 0.0904 0.2168HTR2B 0.0021 0.0171 0.1228 0.0021 0.0171 0.1228 0.0115 0.0495 0.2323GJA12 0.0373 0.1020 0.3657 0.0019 0.0174 0.1092 0.0093 0.1915 0.0486FAM43A (FLJ90022) 0.0019 0.0205 0.0927 0.0019 0.0206 0.0922 0.0038 0.1683 0.0226LRRN6C (FLJ31810) 0.0008 0.0141 0.0567 0.0008 0.0141 0.0567 0.0008 0.0711 0.0113MAOB 0.0017 0.0232 0.0733 0.0010 0.0184 0.0543 0.0078 0.0537 0.1453PTRF 0.0061 0.0758 0.0805 0.0013 0.0288 0.0451 0.0130 0.2274 0.0572ENC1 0.0009 0.0209 0.0431 0.0009 0.0209 0.0431 0.0000 0.0354 0.0000ACCN2 0.0000 0.0225 0.0000 0.0000 0.0239 0.0000 0.0023 0.0629 0.0366ACTA2 0.0000 0.0180 0.0000 0.0000 0.0180 0.0000 0.0000 0.079 0.0000ACTG2 0.0000 0.0163 0.0000 0.0000 0.0162 0.0000 0.0000 0.0632 0.0000B3GNT1 0.0000 0.0139 0.0000 0.0000 0.0116 0.0000 0.0069 0.0967 0.0714BTBD11 (FLJ33957) 0.0004 0.0205 0.0195 0.0000 0.0267 0.0000 0.0104 0.1661 0.0626CACNB2 0.0030 0.0131 0.2290 0.0000 0.0104 0.0000 0.0058 0.0582 0.0997DCN 0.0000 0.0087 0.0000 0.0000 0.0027 0.0000 0.0111 0.0338 0.3284EDNRA 0.0000 0.0105 0.0000 0.0000 0.0110 0.0000 0.0054 0.0403 0.1340ELMO1 0.0000 0.0083 0.0000 0.0000 0.0083 0.0000 0.0025 0.0543 0.0460FGF14 0.0000 0.0039 0.0000 0.0000 0.0040 0.0000 0.0000 0.0212 0.0000FLJ11286 0.0031 0.0155 0.2000 0.0000 0.0059 0.0000 0.0068 0.0687 0.0990GLRX 0.0000 0.0174 0.0000 0.0000 0.0175 0.0000 0.0083 0.0424 0.1958GPR30 0.0020 0.0413 0.0484 0.0000 0.0483 0.0000 0.1033 0.6325 0.1633HIST1H2AC 0.0000 0.0210 0.0000 0.0000 0.0210 0.0000 0.0000 0.2104 0.0000HIST2H2BE N/A N/A N/A 0.0000 0.0410 0.0000 N/A N/A N/AIGFBP3 0.0278 0.0581 0.4785 0.0000 0.0335 0.0000 0.0057 0.1089 0.0523IRF6 0.0000 0.0161 0.0000 0.0000 0.0161 0.0000 0.0000 0.0598 0.0000MAB21L2 0.0000 0.0051 0.0000 0.0000 0.0051 0.0000 0.0000 0.0979 0.0000PPP2R2B 0.0000 0.0080 0.0000 0.0000 0.0094 0.0000 0.0009 0.0337 0.0267PRPH 0.0000 0.0050 0.0000 0.0000 0.0060 0.0000 0.0008 0.132 0.0061TAGLN 0.0000 0.0204 0.0000 0.0000 0.0205 0.0000 0.0021 0.0974 0.0216TMEM100 (FLJ10970) 0.0000 0.0249 0.0000 0.0000 0.0250 0.0000 0.0072 0.0747 0.0964TUBA6 0.0000 0.0241 0.0000 0.0000 0.0244 0.0000 N/A N/A N/A

Estimation of proteins undergoing positive selection in humans compared to chimpanzees using a ratio of non-synonymous substitutions (Ka or dN) to synonymous substitutions (Ks or dS). Values were obtained from either the Ensembl database (www.ensembl.org), or from the published draft of the chimpanzee genome (Chimpanzee sequencing and analysis consortium, Nature, 2005, 437(7055): 69-87). Ratios greater than 1.0 indicate positiveselection. Comparisons between chimpanzee and rhesus macaque proteins are also provided from Ensemble to determine whether positiveselection occurred along the human lineage.



Konopka_Supplementary_Table_10Real-time PCR primers.

Gene Symbol Forward Primer (5'-3') Reverse Primer (5'-3')ACTA2 GACCGAATGCAGAAGGAGAT CGGCTTCATCGTATTCCTGTCDCA7L GGAGGATATCACCGAAGAGGA CACTGTCTTGGTGTCGATGGCOL9A1 AACGGTTTGCCTGGAGCTAT TTGTTAAATGCTCGCTGACCDCN TGCTGTTGACAATGGCTCTC GCCTTTTTGGTGTTGTGTCCEDNRA ATCACCGTCCTCAACCTCTG GGTACCATGACGAAGCCAATEPAS1 GTCTGAACGTCTCAAAGGGC ACACCTCCGTCTCCTTGCTCEYA1 CCAATGCCACTTACCAGCTT TTTCCCATCTGAACCTCGACFAM43A AAGGGCTAAAGGGTTGCATT GAGGAGGAGGGGTTCACTTCGRM8 GTGGACATCGTGACAGCACT TTCACGTGGGATTTTCTGTGHEBP2 CACCCAGGCCTTTAGAGTCA GGGCACTAGAAAATCCATCGIGFBP3 GTCAACGCTAGTGCCGTCAG CTTGGGATCAGACACCCGIRF6 CAGATTCCCTGGAAACATGC TTCCATTTAGCTGGGTCAGGMAGEA10 AAGCGAGGTTCTCGTTCTGA GAAAAGAGGGGTTCCCTGTGMAOB CATGAGCAACAAATGCGAC GGCTTCCAGAACAACCACATNPTX TCTGGTGACTTAAAGGCGCT GAGGACGAGAAGTCCCTGCT PCDH17 AGGGACTAATGCAAGCGAGA CTGTCTCTCAGGCTGGCTCTPDGFRA ATTGCGGAATAACATCGGAG GGGTAATGAAAGCTGGCAGAPPP2R2B GTGTGTGTGGAATGGGTCAG ACTTTTCGGGGTTTGAGGATPRNP CGAGCTTCTCCTCTCCTCAC GTTCCATCCTCCAGGCTTCPRPH CCTGGAACTAGAGCGCAAGA CTGGCTCTCCACACTCACCTROR2 GCTTCTGCTCTCAGTGTCCC CTGGCTCCAGAAAATTCAGARUNX1T1 GACGCACTGGCAGTTATCAA GCTTCTCCCAGTCTTTGTGCSLC30A3 CTTGGAGACCACTCGCCTG TCCACAGGTTTGGACTCCTCSLIT1 TGATGACATGAAGGAGCTGG GAAAAGCTTTCCTGGGGATGSYK CAGGCCATCATCAGTCAGAA CGTAGGAGCCGTTGTTGTCTTAGLN GACCAAGAATGATGGGCACT AAGGCCAATGACATGCTTTCTIMP1 TTGACTTCTGGTGTCCCCAC GCTTCTGGCATCCTGTTGTTTMEFF2 CGTCACATTCTGCACCAAAC GGATCAGGATCTGGAGATGGTMEM100 CTTTCCCAGAAGTTGGACGA CCTTGATGGGCTCTTCAGTCZNF521 TGGGATATTCAGGTTCATGTTG TTGGCAGGAGAGTCAAAGGT

12 november 2009 doi:10.1038/nature08549 letters · so far, the transcription factor foxp2...

Documents