analysis of forkhead and snail expression reveals ...forkhead belongs to the group 1/hnf3/foxa...

www.elsevier.com/locate/ydbio

Developmental Biology

Analysis of forkhead and snail expression reveals epithelial–mesenchymal

transitions during embryonic and larval development of

Nematostella vectensis

Jens H. Fritzenwanker1, Michael Saina1, Ulrich Technau*,1

Molecular Cell Biology, Institute for Zoology, Darmstadt University of Technology, 64287 Darmstadt, Germany

Received for publication 22 June 2004, revised 10 August 2004, accepted 12 August 2004

Available online 16 September 2004

Abstract

The winged helix transcription factor Forkhead and the zinc finger transcription factor Snail are crucially involved in germ layer formation

in Bilateria. Here, we isolated and characterized a homolog of forkhead/HNF3 (FoxA/group 1) and of snail from a diploblast, the sea

anemone Nematostella vectensis. We show that Nematostella forkhead expression starts during late Blastula stage in a ring of cells that

demarcate the blastopore margin during early gastrulation, thereby marking the boundary between ectodermal and endodermal tissue. snail,

by contrast, is expressed in a complementary pattern in the center of forkhead-expressing cells marking the presumptive endodermal cells

fated to ingress during gastrulation. In a significant portion of early gastrulating embryos, forkhead is expressed asymmetrically around the

blastopore. While snail-expressing cells form the endodermal cell mass, forkhead marks the pharynx anlage throughout embryonic and larval

development. In the primary polyp, forkhead remains expressed in the pharynx. The detailed analysis of forkhead and snail expression

during Nematostella embryonic and larval development further suggests that endoderm formation results from epithelial invagination,

mesenchymal immigration, and reorganization of the endodermal epithelial layer, that is, by epithelial–mesenchymal transitions (EMT) in

combination with extensive morphogenetic movements. snail also governs EMT at different processes during embryonic development in

Bilateria. Our data indicate that the function of snail in Diploblasts is to regulate motility and cell adhesion, supporting that the triggering of

changes in cell behavior is the ancestral role of snail in Metazoa.

D 2004 Elsevier Inc. All rights reserved.

Keywords: Nematostella; Cnidaria; Forkhead; Snail; Gastrulation; Endoderm; Mesoderm; Epithelial–mesenchymal transition

Introduction

In most Bilateria, the formation of the two inner germ

layers, endoderm and mesoderm, is intimately linked

during the process of gastrulation. In vertebrates, endo-

dermal and mesodermal cells immigrate or invaginate

together as endomesoderm and become separated morpho-

0012-1606/$ - see front matter D 2004 Elsevier Inc. All rights reserved.

doi:10.1016/j.ydbio.2004.08.014

* Corresponding author. Molecular Cell Biology, Institute for Zoology,

Darmstadt University of Technology, Schnittspahnstr. 10, 64287 Darmstadt,

Germany. Fax: +49 6151 166077.

E-mail addresses: [email protected],

[email protected] (U. Technau).1 Present address: Sars International Centre for Marine Molecular

Biology, Thormbhlensgt. 55, N-5008 Bergen, Norway.

logically only later during gastrulation. The evolutionary

origin of the mesoderm is currently a matter of intense

investigation, but still not clear (reviewed in Martindale et

al., 2002; Technau, 2001; Technau and Scholz, 2003).

Some evidence from the two major diploblastic phyla,

Cnidaria and Ctenophora, support the view of an endo-

dermal origin of the mesoderm (Martindale and Henry,

1999; Martindale et al., 2004; Spring et al., 2000, 2002;

Technau and Bode, 1999; Wikramanayake et al., 2003).

However, other molecular data suggest that the third germ

layer arose from the blastopore region with contributions

from both ectoderm and endoderm (Scholz and Technau,

2003; Technau and Bode, 1999; for review, see Technau,

2001; Technau and Scholz, 2003).

275 (2004) 389–402

J.H. Fritzenwanker et al. / Developmental Biology 275 (2004) 389–402390

The evolution of the bilaterian foregut is also debated.

Textbook knowledge postulates that foregut (and mouth)

formation in Protostomes and Deuterostomes is fundamen-

tally different and evolved convergently (Grobben, 1908;

Nielsen, 1995). However, similar expression of conserved

transcription factors in the foregut anlage of basal

deuterostome and protostome ciliary larva challenged this

view and suggested a conserved molecular regulation of

mouth development and homology of the foregut in

Bilateria (Arendt et al., 2001). The foregut is of great

interest because it is the boundary between ectoderm and

endoderm. In insects, both foregut (stomodeum) and

hindgut (proctodeum) are regarded as an ectodermal

derivative because in the adult these structures have a

chitinized cuticula.

One of the crucial conserved genes for mesoderm

formation in Bilateria codes for the zinc finger tran-

scription factor Snail (reviewed by Nieto, 2002). In insects,

snail has been shown to repress the expression of

neuroectodermal genes thereby marking the boundary

between mesodermal and neurogenic region in the

Drosophila embryo (Ip et al., 1992; Leptin, 1991). In

vertebrates, snail function has been implicated in epithe-

lial–mesenchymal transitions of migrating cells of the

developing mesoderm and of the neural crest (Cano et al.,

2000; Carver et al., 2001; Ikenouchi et al., 2003; Linker et

al., 2000; reviewed by Savagner, 2001). Snail has also

been isolated from Podocoryne carnea, a hydrozoan

cnidarian and from the coral Acropora millepora (Hayward

et al., 2004; Spring et al., 2002). Podocoryne snail is

expressed in the entocodon of the developing medusa bud,

suggesting a role in muscle development of the medusa

(Spring et al., 2002), while Acropora snail is expressed in

the endoderm during embryogenesis indicating a role in

germ layer specification (Hayward et al., 2004).

A conserved marker gene for the foregut in Bilateria

codes for the winged helix transcription factor Forkhead.

The founder member forkhead is expressed in the foregut

and hindgut anlage in Drosophila (Weigel et al., 1989).

Forkhead belongs to the group 1/HNF3/FoxA subfamily. In

vertebrates, three highly related HNF3 genes, alpha, beta,

and gamma, exist which differ by the timing and location of

expression (reviewed by Kaestner et al., 1994; Lai et al.,

1993). In particular, HNF-3beta plays a crucial role during

early vertebrate development. In mice and frogs, HNF-3beta

is expressed in the organizer (node) and in the derivatives,

the notochord but also the floor plate (Ang and Rossant,

1994; Dirksen and Jamrich, 1992; Knochel et al., 1992;

Ruiz i Altaba and Jessell, 1992; Sasaki and Hogan, 1993).

HNF-3beta is involved in formation of the dorsoventral

axis, as HNF-3beta �/� mice mutants have defects in the

DV patterning of the neural tube and of the dorsal

mesoderm (Ang and Rossant, 1994; Ruiz i Altaba and

Jessell, 1992; reviewed by Cunliffe and Ingham, 1999;

McMahon, 1994). It also has a conserved role in mesoderm

formation in a dose-dependent manner and acts synergisti-

cally with brachyury to specify axial mesoderm in chordates

(O’Reilly et al., 1995; Shimauchi et al., 2001).

In insects, forkhead plays a conserved role in terminal

patterning and formation of the foregut and hindgut anlage

(Hoch and Pankratz, 1996; Kusch and Reuter, 1999;

Schroder et al., 2000; Weigel et al., 1989). The first

forkhead homolog, from a diploblast, budhead, was isolated

from the hydrozoan Hydra (Martinez et al., 1997). budhead

is expressed in the hypostome, the polyps’ mouth and

appears to have a role in axial patterning (Martinez et al.,

1997). The role of forkhead during cnidarian embryo-

genesis, however, is unknown. Since Hydra embryogenesis

is highly derived and not easily accessible at all stages

(Martin et al., 1997), we turned to a new model organism,

the anthozoan Nematostella vectensis . Anthozoa are

regarded as the basal group among Cnidaria (Bridge et al.,

1992, 1995; Collins, 2002) and embryogenesis in Nem-

atostella is inducible and readily accessible (Hand and

Uhlinger, 1992; Fritzenwanker and Technau, 2002). Here,

we report the isolation and characterization of forkhead and

snail homologs from Nematostella vectensis. Our analysis

shows that forkhead is expressed at the blastopore margin,

that is, the boundary between ectoderm and endoderm and it

marks the presumptive pharynx of the primary polyp. By

contrast, snail has a virtually complementary expression

pattern and marks all ingressing endodermal cells. The

detailed analysis of forkhead and snail expression high-

lights that endoderm formation in this basal cnidarian is

characterized by a relatively complex cellular behavior

involving epithelial–mesenchymal transitions and morpho-

genetic movements.

Materials and methods

Animal culture and induction of gametogenesis

Since Nematostella vectensis lives in brackish water,

animals were kept in 1/3 artificial seawater (Hand and

Uhlinger, 1992) at 188C in the dark and fed five times a

week with brine shrimp naupliae. Induction of gameto-

genesis was carried out as described before (Fritzenwanker

and Technau, 2002). Oocytes were fertilized in vitro. This

resulted in synchronization of development in most embryos

and allowed a detailed staging. To get access to early

embryos, the jelly of the egg packages was dissolved in

cysteine as described (Fritzenwanker and Technau, 2002).

Developmental time until metamorphosis into primary

polyps was roughly 10–12 days at 188C.

Isolation of forkhead and snail from Nematostella

A full-length cDNA clone of Nematostella snail was

isolated in an EST screen from mixed embryonic stages

(U.T. and Thomas Holstein, unpublished). The sequence

was deposited at Genbank (accession number AY651960).

J.H. Fritzenwanker et al. / Developmental Biology 275 (2004) 389–402 391

Embryonic first strand cDNA was used as a template to

isolate a full-length clone of forkhead by PCR with the

following nested degenerated primers and subsequent

RACE: fkh5outer CAYGCNAARCCNCCNTA; fkh3outer

CA NCC RTT YTC RAA CAT RTT; fkh3inner TC NGG

RTG NAR NGT CCA. For 3V RACE of Nematostella

forkhead FKH1: AAGCCGCCCTATTCATATATCTC and

the nested primer FKH4a: CATGGACTTGTTTCCCTAC-

TACA was used. For 5V RACE FKH6c: AGTGTCCAG-

TAACTGCCTTTTC and t h e n e s t e d FKH4b :

GTAGTAGGGAAACAAGTCCATGA was used. For 5VRACE we used Gene Racer kit (Invitrogen); 3V RACE was

performed according to Frohman et al. (1988) with the

appropriate primers. PCR conditions varied depending on the

experiments and can be obtained upon request from the

authors. Fragments of expected size were cloned into TA

cloning vector pGEM-T (Promega) and sequenced. The

resulting full-length cDNAwas reamplified from first strand

cDNA (GenBank accession number AY457634). While this

paper was in preparation, Martindale et al. (2004) inde-

pendently reported the identification of a forkhead and a

snailA homologue from Nematostella vectensis, which are

N95% identical on the nucleic acid level. The differences

probably reflect polymorphic forms of the genes.

In situ hybridization

The procedure of the in situ hybridization was based on

the protocol of Scholz and Technau (2003), with the

following changes. Specimens were fixed in 4% MEMPFA

containing 0.0625% glutaraldehyde for 10 min or 3 h, and

then stored in methanol at �208C. Hybridization was carriedout at 448C for at least 36 h, posthybridization washes were

done in 50% formamide/2� SSC/0.02% TritonX-100 over 8

h by raising the temperature gradually from 478C to 568C. Adetailed protocol can be obtained from the authors.

RT-PCR

Expression analysis was carried out by RT-PCR of oligo-

dT-primed cDNA normalized for the expression of cytosolic

actin with specific primers. The sequences of the primers

were: Actin5: GCTAACACTGTCCTGTCT Actin3:

TGGAAGGTGGACAGGGAA. Fkh1 and Fkh6c primers

were used to amplify a forkhead fragment (see above). The

snailA primers were: SnailA5: CTACGTGTCCCTGGGT-

GC; SnailA3: CCTTCTAGTGATCTGTTTCG.

Results

Isolation of homologs of forkhead and snail from

Nematostella

We performed PCR with degenerate primers and RACE

to obtain a homolog of forkhead. The isolated full-length

clone of Nematostella forkhead is 1774 bp in length

coding for a conceptually translated protein of 286 amino

acids (Fig. 1A). The alignment with Forkhead domains

from a variety of different animals demonstrates the

extremely high degree of conservation (N95% amino acid

identity to vertebrate Forkhead; Fig. 1B). Outside the

Forkhead domain two additional smaller motifs, region II

and region III, are conserved between Nematostella and

vertebrates (Fig. 1C). These domains have been shown to

be involved in transactivation (Pani et al., 1992). In

particular, region II is diagnostic of the HNF-3 subfamily

(Pani et al., 1992).

The phylogenetic analysis by Maximum Likelihood

shows that Nematostella Forkhead belongs to the group 1

as defined by Kaufmann and Knochel (1996), which unites

the subfamilies HNF-3alpha, -beta, and -gamma (Fig. 2).

Group 1 is characterized by several diagnostic residues in

the Forkhead domain, which are fully conserved in

Nematostella. In addition, Nematostella shares one of the

diagnostic residues with the HNF-3beta (FoxA2)-subfam-

ily, but none with the others. It does not contain the

conserved region IV and V, which play a role in

transactivation in vertebrates, but which are also absent

from protostome homologs (Pani et al., 1992; Qian and

Costa, 1995). The analysis also shows that the Hydra

ortholog Budhead (Martinez et al., 1997) is more diverged

than the Nematostella protein (Fig. 2). Interestingly, while

the overall amino acid identity to the Hydra molecule

compares to the mouse homolog (53% and 54%, respec-

tively), the identity of the Forkhead domain to the mouse

homolog HNF3-beta is significantly higher (95% com-

pared to 83% identity to the Hydra Budhead). Thus, taken

together, this analysis suggests that we have isolated an

ortholog of the HNF3, most likely of the HNF3-beta gene

of vertebrates.

A full-length snailA clone was isolated from an EST

screen from mixed embryonic stages (U.T. unpublished

results). Another snail-like gene, termed snailB, has been

independently isolated by PCR and will be reported

elsewhere (Scholz and Technau, unpublished; Martindale

et al., 2004). SnailB shares only a few conserved residues

outside the SNAG and the zinc finger domain (overall

identity 43%) suggesting that the gene duplication was not a

recent event.

The snailA clone is 1066 bp and contains 5VUTR, 3VUTRand a poly A tail and is therefore considered a full-length

clone, coding for a 265 amino acid protein. The zinc

finger domain contains five conserved zinc finger

domains. The first zinc finger is not always present in

different phyla. For instance, it is present in Drosophila

Snail, but absent from mouse Snail (Fig. 3A). Interest-

ingly, the first zinc finger is also absent in the Snail

homologs from two other cnidarians, the coral Acropora

and the hydrozoan Podocoryne (Hayward et al., 2004;

Spring et al., 2002). Besides the zinc finger domains, a

small motif called the SNAG domain at the N-terminus of

Fig. 1. Sequence analysis of Nematostella Forkhead. (A) The schematic drawing of the proteins shows that Nematostella Forkhead is shorter than the mouse

homolog HNF3-beta, but shares three conserved domains, the DNA binding domain region I (Forkhead domain), and two regions (II and III) at the C-terminus

of the activation domain. (B) Alignment of Nematostella Forkhead domain with other animals shows the extremely high degree of conservation between

Nematostella and bilaterian Forkhead proteins. (C) Alignment of region II and region III.


the protein, is also fully conserved in Nematostella Snail

proteins (Fig. 3C). This motif is found in Snail homologs

of most Bilateria, but it is absent from Drosophila Snail

(Fig. 3A). The phylogenetic analysis confirms that the

Nematostella Snail clusters with the bilaterian Snail

proteins and is most likely an ortholog of the Acropora

snail (Fig. 4).

Expression analysis of Nematostella forkhead during

gastrulation

RT-PCR analysis shows that forkhead expression starts

at blastula stage (Fig. 5) and is then maintained

throughout embryonic and larval development until

primary polyps. First localized signals can be detected

by in situ hybridization in small patches of blastodermal

cells at the late blastula stage (around 10 h) marking the

presumptive blastopore shortly before invagination (Figs.

6A, B). The scattered patches of expression shortly later

fuse to form a ring of expression marking the margin of

cells that start to invaginate (Fig. 6C). As gastrulation

proceeds, forkhead becomes more strongly expressed, yet

always constricted to the ectodermal margin of the

blastopore (Figs. 6D, E). The form of the blastopore also

changed from a broad round invagination to a more slit-

like or triangular shape (Figs. 6E, F). However, it should

be noted that the shape of blastopore varies considerably

from embryo to embryo (Figs. 6E–I), yet does not reflect

any developmental defect as N80% of all eggs in an egg

mass develop into primary polyps. Interestingly, in a

significant fraction (60–70%) of early gastrulating

embryos, forkhead expression is excluded from one

portion of the blastopore. In the majority of all asym-

metrically expressing embryos (60%), expression cannot

be detected in one of the longitudinal ends of the slit-like

blastopore (Fig. 6G), however, sometimes expression is

absent from a broad side of the blastopore (Fig. 6H) or

from the tip of the triangular blastopore (Fig. 6F). The

other fraction (30–40%) expresses forkhead in a ring

around the blastopore (Fig. 6F).

Side views of whole mount in situ hybridization of

gastrulating Nematostella embryos show that gastrulation

starts out as an involution of the epithelial layer of the

blastula at one pole (Fig. 7A). At this time, forkhead

expression is restricted to the outer margin of the

blastopore. Yet, shortly later, involuting endodermal cells

that do not express forkhead become bottle-shaped and

seem to loose their epithelial organization (Fig. 7B), start

to detach and migrate through the blastocoel to the other

side of the embryo (Fig. 7C). During that process, the

Fig. 2. Phylogenetic analysis of Forkhead domains using the Maximum

Likelihood program PUZZLE (Schmidt et al., 2002). Note that Nematos-

tella Forkhead clusters with group 1 (groups defined by Kaufmann and

Knochel, 1996). Members of group 5 were used as an outgroup. Numbers

are percent statistical support for the corresponding nodes. JTT was used as

a substitution model, for heterogeneous evolutionary rate the alpha

parameter 8 was used in the gamma rate distribution, 1000 replica were

calculated. Accession numbers of the sequences used in the analysis are as

follows: Mm_fkh-2, CAA50742.1; Dm_FD3, AAA28534.1; Xl_XFD-5/

FoxB2, CAD31848; Mm_fkh4/Foxb2, NP_032049.1; Ce_lin-31,

AAA28104.1; Dm_FD-5, AF02178.1; Hv_budhead, AAO92606.1;

Nv_forkhead, AY457634; Dm_fork head, AAA28535.1; Bm_sgf-1,

BAA07523.1; Dr_axial/foxa2, NP_571024.1; Mm_HNF-3beta,

AAA03161.1; Xl_pintallavis, CAA46290.1; Xl_XFKH1, AAB22027.1;

Mm_HNF-3gamma, CAA52892.1; Hs_FKH H3, AAA58477.1;

Mm_HNF-3alpha, CAA52890.1; Xl_FKH2, AA17050.1.


ectodermal marginal cells of the blastopore that express

forkhead also involute, yet maintain their epithelial

organization (Fig. 7C). The mesenchymal cells that have

migrated to the other side of the blastocoel, start to

reorganize an epithelial layer, the pre-endoderm, and

possibly separated from the ectodermal layer by a thin

mesogloea (Fig. 7D). In the following, endodermal cells

again seem to leave the epithelial sheet and start to fill the

gastrocoel until it forms a complete mass of cells in the

endoderm (Figs. 7E–I). The forkhead expressing ectoder-

mal part of the blastopore, however, that has partly

involuted, maintains the epithelial integrity as judged from

the columnar organization of the cells. After gastrulation,

in the early planula larva, forkhead expression is detected

in a domain that seems to reach from the ectodermal

margin of the blastopore to the endoderm in a restricted

manner (Fig. 7I). In planula larvae of days 4–10 of

development, two patterns can be observed: (i) a pattern

with two stripes in the center of the planula (Figs. 7J, K)

and (ii) a central block of expression with two opposing

bwingsQ of expression (Fig. 7L). It is unclear at present

whether these two patterns reflect two temporally sepa-

rated stages of development or two orthogonal views of

the same pattern.

Forkhead expression and the morphogenetic movements

during metamorphosis

Initiation of metamorphosis is marked by the beginning

reorganization of the endodermal cell mass into an

endodermal epithelial layer. At this point, the forkhead-

expressing cells are located at the inner side of the former

blastopore, yet form a continuum with the ectodermal

layer of the planula. These forkhead-expressing cells mark

the future pharynx of the primary polyp (Fig. 8A).

Epithelialization appears to start at the aboral side of the

forkhead-expressing domain and continues at the lateral

sides towards the oral end. At this early stage, the

endodermal mass close to the presumptive pharynx

organizes into eight radii forming the anlage for the future

mesenteries in adult polyps that are attached to the

pharynx (Fig. 8F). During the process of metamorphosis

the pharynx anlage ingresses, until it even contacts the

inner side of the aboral pole of the larva (Figs. 8A–C).

However, during elongation of the developing primary

polyp and formation of the tentacles this part is pulled up

again towards the oral pole (Fig. 8C–E), until it takes the

final position of the pharynx. We could not detect

significant expression of forkhead in the first pair of

mesenteries, that grow out from two opposing poles of the

blastopore (Figs. 8E–H). An optical cross-section through

the pharynx region shows that forkhead expression

remains restricted to the ectodermal layer of the pharynx

(Fig. 8F), which is the most interior tissue due to the

inverted structure of the pharynx.

Snail expression during gastrulation

Snail is a crucial regulator of gastrulation and other

morphogenetic processes in bilaterian development. We

therefore wished to analyze the expression pattern of the

snail homolog in Nematostella vectensis. Like for fork-

head, first snail expression was detected at the late

blastula stage (Fig. 5), however, in a contiguous patch of

cells that marks the presumptive endoderm (Fig. 9). The

comparison with the early ring-like expression pattern of

forkhead suggests that the snail patch is in the center of

the forkhead ring. During gastrulation, snail is exclu-

sively expressed in immigrating endodermal cells. In

contrast to the forkhead-expressing cells, the snail-

expressing cells loose their epithelial organization during

gastrulation and start immigrating into the blastocoel

(Figs. 9D, E) until they form the pre-endoderm (Fig. 9F).

In the planula, snail remains expressed in the endoderm,

yet excluded from the forkhead expressing pharynx

anlage (Figs. 9G, H). Finally, snail expression is

maintained at somewhat lower level in the primary polyp

in the endoderm (Figs. 5; 9I).

Fig. 3. Sequence analysis of Nematostella Snail. (A) The schematic drawing of the proteins shows that Nematostella Snail contains five zinc fingers (I–V) and

the conserved N-terminal SNAG domain. The SNAG domain is missing in the Drosophila homolog, while the first zinc finger is lacking in Acropora and

mouse Snail homologs. (B) Alignment of Nematostella Snail zinc finger domain with other animals shows the extremely high degree of conservation between

Nematostella and bilaterian Snail proteins. (C) Alignment of the SNAG domain. Abbreviations: Nv, Nematostella vectensis; Dm, Drosophila melanogaster.


Forkhead forms a synexpression group with brachyury in

Nematostella

We recently isolated a brachyury homolog, Nembra1,

from Nematostella (Scholz and Technau, 2003). In verte-

brates, forkhead and brachyury act synergistically in defining

the dorsal mesoderm (O’Reilly et al., 1995). To compare the

expression pattern of forkhead and brachyury in Nematos-

tella, we therefore reexamined brachyury expression in more

detail. Fig. 10 shows that the spatio-temporal expression

pattern of Nembra1 is virtually identical to that of forkhead.

Brachyury expression starts out in few spots of cells at the late

blastula stage and later marks the ectodermal part of the

blastopore throughout gastrulation. In the late planula larva,

Nembra1-expressing cells become internalized and mark the

future pharynx and mesenteries. Thus, brachyury and fork-

head form a synexpression group in Nematostella vectensis,

raising the possibility that they might act together in the

Fig. 4. Phylogenetic analysis of Snail zinc finger domains using the

Maximum Likelihood program PUZZLE (Schmidt et al., 2002). Note, that

Nematostella SnailA clusters with Snail homolog from Acropora within the

Snail subfamily. The Snail-related zinc finger protein Scratch was used as

an outgroup. JTT was used as a substitution model, for heterogeneous

evolutionary rate the alpha parameter 8 was used in the gamma rate

distribution, 1000 replica were calculated. Accession numbers of the

sequences used in the analysis are as follows: Scratch Drosophila,

AAA91035; Scratch Homo, Q9BWW7; Worniu Drosophila, AAF12733;

SnailB Nematostella, AAQ23385; escargot Drosophila, P25932; Snail

Branchiostoma, AAC35351; Snail Lytechinus, AAB67715; Snail3 Homo,

XP_370995; Snail Podocoryne, CAD21523; Sna1 Zebrafish, NP_571141;

slug Xenopus, Q91924; Snail Xenopus, P19382; Sna2 Patella, AAL12167;

Sna1 Patella AAL06240; SnailA Acropora, AAS99630; SnailA Nematos-

tella , AY651960; Snail Anopheles , XP_317196; Snail Drosophila ,

AAL90312.


regulation of gastrulation and metamorphosis and in the

formation of pharynx and mesenteries.

Fig. 5. Temporal expression profile of Nematostella forkhead and snail by

RT-PCR. RNA from defined stages was prepared and the cDNA normalized

with Actin, EF-2, Hsp70 (not shown). UE (unfertilized eggs); B (10 h

Blastula); G (28 h Gastrula); 3dP (3 day Planula larva); 6dP (6 day Planula

larva); PP (primary polyp). The experiment was carried out in three

replicates with identical results.

Discussion

A homolog of forkhead/HNF3/beta and snail in the

diploblast Nematostella vectensis

Since the identification of the founder member from

Drosophila (Weigel et al., 1989), a large number of related

genes have been isolated from a wide range of species.

These forkhead genes form a large family of 10–15

subfamilies (Kaestner et al., 2000; Kaufmann and Knochel,

1996), with diverse functions in development (reviewed by

Carlsson and Mahlapuu, 2002; Gajiwala and Burley, 2000;

Kaestner et al., 1994; Kaufmann and Knochel, 1996; Lai et

al., 1993; McMahon, 1994). All share a highly conserved

DNA binding motif of 110 amino acids, the Forkhead

domain. Ten groups of the Forkhead protein family were

defined on the basis of several diagnostic residues

(Kaufmann and Knochel, 1996). In a refined analysis of

chordate sequences, 15 different subfamilies of Fox (fork-

head box) genes have been defined (Kaestner et al., 2000).

Group 1 (which corresponds to FoxA) is characterized by

five diagnostic residues in the Forkhead domain (A9, L43,

Q51, N92, C98). Since these residues are all conserved in

the isolated forkhead clone from Nematostella, we con-

clude that we have isolated a member of group 1 forkhead

genes. Group 1 is further subdivided into four subgroups,

group 1a–d, which have two to four characteristic residues.

Nematostella Forkhead shares one (T7) of two diagnostic

residues of group 1a (T7, F46), but none of the residues

characteristic for the other subgroups. In addition, Nem-

atostella Forkhead has two short conserved motifs at the

C-terminus, called regions II and III. Phylogenetic analysis

of Forkhead domains from several organisms further

supports a close relationship of Nematostella Forkhead to

group 1, although a clear clustering with group 1a is not

statistically significant (Fig. 2). Hence, if no other Fork-

head proteins of the group 1 exist in Nematostella, the

gene presented in this paper may closely resemble the

evolutionary predecessor of group 1 molecules. Among

these, group 1a proteins (i.e., HNF3-beta in rodents and

frogs) have retained most of these ancestral features.

Nematostella forkhead is, however, unlikely to represent

the precursor of all forkhead genes, since several other

forkhead genes have been isolated which clearly cluster

with specific subfamilies (U.T. unpublished). Thus, Nem-

atostella forkhead is a homolog of group 1 forkhead genes

and most closely resembles HNF3-beta.

The detailed sequence analysis of the zinc finger motif

of the Nematostella Snail homolog clearly shows that it

belongs to the Snail subfamily of Zinc finger transcription

factors. Interestingly, despite a considerable degree of

conservation, the first zinc finger is not present in mouse

Snail, and in the Snail homologs from two other

cnidarians, Podocoryne and Acropora (Hayward et al.,

2004; Spring et al., 2002). This shows that this zinc finger

was independently lost during evolution and may not be

Fig. 6. View on the blastopore of gastrulating Nematostella embryos. (A–D) 20–22 h blastula; (E–F) 25–30 h gastrula. Note that forkhead marks the future

blastopore and remains expressed around the blastopore. (F–H) Arrows indicate the side of lacking forkhead expression at the blastopore. Scale bar is 100 Am.


functionally relevant in all species. By contrast, the four

C-terminal zinc finger domains are always strongly

conserved in all animals examined. The comparison with

the neural-specific Scratch protein shows that the zinc

finger domains II and V most likely provide the

specificity to the molecule, since they contain specific

residues diagnostic of Snail proteins and distinct of

Scratch which are all conserved in Nematostella SnailA

(Fig. 3B). By comparison, zinc finger domains III and IV

of Snail and Scratch proteins are virtually identical,

suggesting that they are only characteristic of Snail-related

proteins (Fig. 3B).

Forkhead and snail expression reveal

epithelial–mesenchymal transitions during gastrulation

Animals of different phyla gastrulate by at first glance

very different cellular mechanisms, such as epithelial

invagination and epiboly, multipolar and polar immigra-

tion and delamination (reviewed in Technau and Scholz,

2003). The precise mechanism appears to depend on

different parameters, for instance, egg size and amount of

yolk (Arendt and Nubler-Jung, 1997). Different species of

the phylum Cnidaria gastrulate by all possible mechanisms

mentioned above (reviewed in Tardent, 1978). In early

descriptions of the embryogenesis of Nematostella, gas-

trulation was described as an invagination process (Hand

and Uhlinger, 1992). The detailed analysis of forkhead

expression during gastrulation and metamorphosis reveals

now that the formation of the endodermal layer is in fact

more complex. Gastrulation starts out as an invagination

of the blastodermal epithelium, yet cells of the inner part

of the blastopore, that is, the presumptive endodermal

cells shortly later detach from the epithelium, migrate

through the blastocoel and attach on the inner side of

blastodermal epithelium to form an epithelial layer, which

we call a pre-endodermal layer. The postgastrula planula

larva, however, is filled by mesenchymal endodermal cells

that appear to have detached from the pre-endodermal

(epithelial) layer. Only during metamorphosis this mass of

cells reorganizes into the definitive endodermal layer by a

process that is not yet understood. Hence, gastrulation in

Nematostella occurs by a combination of epithelial

invagination and immigration. The formation of the

definitive endodermal epithelium is a result of cycles of

epithelial–mesenchymal transitions (EMT).

EMT has been described for instance during gastrulation

and neural crest development in vertebrates. It is charac-

terized by the expression of the zinc finger transcription

factor snail (or the closely related slug gene, respectively),

which regulates the expression of specific cell adhesion

proteins, such as E-cadherin, notch and of marker genes

Fig. 7. Side view on gastrulae and planulae-expressing forkhead. (A) initiation of gastrulation at 26 h of development; (B) endodermal cells start immigrating

(arrow); (C) immigrated endodermal cells attach to the blastocoel roof; (D) formation of a pre-endodermal layer (arrow); (E) closure of the blastopore and

detachment of endodermal cells from pre-endodermal layer as well as from the blastopore (arrow); (F–H) continuous filling of the blastocoel with endodermal

cells; (I–L) disintegration of epithelial organization of forkhead-expressing cells during early through late planula stage. Note, the lappet-like expression

domains (K) that mark the future first pair of mesenteries. Scale bar is 100 Am.


for migratory cells, such as RhoB and HNK-1 (Cano et al.,

2000; Carver et al., 2001; del Barrio and Nieto, 2002;

Timmerman et al., 2004; reviewed in Nieto, 2002;

Savagner, 2001). In line with this, Nematostella snailA is

exclusively expressed in immigrating endodermal cells

during gastrulation (Martindale et al., 2004; this study).

This expression seems to be conserved at least in

Anthozoans, as the snailA homolog from the coral

Acropora millepora is also expressed in presumptive

endodermal cells during gastrulation (Hayward et al.,

2004). EMT was previously proposed as the ancestral

function of snail genes in Bilateria (Lespinet et al., 2002;

Nieto, 2002). Our data support and extend this idea,

suggesting that the original role of snail genes in a

diploblast eumetazoan ancestor was to govern EMT during

endoderm formation. This basic cellular function was then

apparently reused for similar cellular processes during the

development of bilaterian embryos, that is, in mesoderm

and neural crest formation in vertebrates (Knecht and

Bronner-Fraser, 2002; Langeland et al., 1998; Thisse et al.,

1995; reviewed in Nieto, 2002; Technau and Scholz, 2003)

or during EMT of ectodermal derivatives in mollusks

(Lespinet et al., 2002).

The columnar organization of the forkhead-expressing

tissue suggests that the epithelium even remains intact when

this region is involuted at the early planula stage. This

reflects the fact that the pharynx in sea anemones is

internalized, but of ectodermal origin. Thus, the internali-

zation of the ectodermal pharynx anlage occurs already

during late gastrulation (i.e., at the early planula stage). The

Fig. 8. Forkhead expression during metamorphosis. (A) formation of endodermal epithelium in early metamorphosing planula. Forkhead expressing pharynx

anlage is internalized; (B) further retraction of pharynx anlage towards aboral pole; (C) Amphora stage of metamorphosing planula with maximally retracted

pharynx anlage; (D) elongation of developing primary polyp at the aboral pole and begin of differentiation of pharyngeal mesenteries; (E) finished elongation

of late metamorphosing planula larva and final position of pharynx; (F) cross-section through late metamorphosing planula stage showing the forkhead-

expressing pharynx with the slit-like mouth opening and the eight anlage for the mesenteries attached to the pharynx; (G) primary polyp showing forkhead

expression in the pharynx; (H) close up of (G) showing that forkhead expression is restricted to the ectodermal lining of the inverted pharynx. Note the

boundary between ectoderm and endoderm (arrow). Scale bar is 100 Am.


stable forkhead-expressing domain allows to further follow

the larval development. During metamorphosis, the pharynx

anlage becomes transiently located at the aboral pole by

extensive morphogenetic movements, yet with elongation of

the body it retracts and adopts its final position in the

primary polyp. In summary, gastrulation and metamorphosis

in Nematostella, a basal representative of the Cnidaria, is

characterized by a relatively complex combination of

epithelial invagination, EMT, immigration, and epithelial

morphogenetic movements. It seems obvious that such

complex processes require a highly regulated genetic

control, which remain to be revealed by future work.

Evolutionary considerations: forkhead, brachyury, and the

blastopore

The evolution of the bilaterian gut has been studied by

comparing the expression pattern of specific marker genes

from a variety of organisms. It appears that a conserved

cassette of developmental genes, mostly transcription

factors, is expressed in fore- and hindgut primordia in all

or most bilateria (reviewed in Lengyel and Iwaki, 2002).

These include the transcription factors caudal, brachyury,

and forkhead and the signalling molecule wingless. All four

genes are expressed in the blastopore in vertebrates and

many insects, where they specify the derivatives of the

blastopore, the foregut, and the hindgut (in Drosophila, the

amnioproctodeal and the stomodeal invagination). While

comparative data on caudal expression in different organ-

isms are still scarce, at least brachyury, forkhead and

wingless appear to have overlapping expression domains in

most animals studied, hence they form an evolutionarily

conserved synexpression (Niehrs and Pollet, 1999) group,

suggesting that they might act in concert to specify a

homologous structure in a wide range of animals. For

instance, in the cnidarian Hydra, homologs of brachyury,

Wnt3a, and forkhead have overlapping spatio-temporal

expression domains in the hypostome, which correspond

to the organizer of the polyp (Hobmayer et al., 2000;

Martinez et al., 1997; Technau and Bode, 1999). Similarly,

in Nematostella embryos, brachyury and forkhead are

coexpressed at the ectodermal margin of the blastopore

during gastrulation (Scholz and Technau, 2003; this paper).

A comparative analysis of expression patterns of these two

genes shows that they are co-expressed in all animals

analyzed (reviewed in Lengyel and Iwaki, 2002; Technau,

Fig. 9. Snail expression during gastrulation and metamorphosis. (A–C) front view on blastopore. (D–F) side view, posterior (oral) side oriented to the right. (A,

B) Late blastula stages with contiguous patch of snail-expressing cells. (C) gastrula stage. (D) early gastrula stage. (E) mid-gastrula stage. (F) late gastrula

stage. (G) early planula stage. (H) late planula stage (I) primary polyp. Stars mark the pharynx anlage (G–I), which does not express snail. Note snail is

exclusively expressed in endodermal cells and complementary to forkhead. Scale bar is 100 Am.


2001; Zaret, 1999). This suggests a close functional

relationship of these two genes during animal development

throughout metazoan evolution. Although a direct inter-

action of the two proteins has not been demonstrated to date,

Fig. 10. Brachyury expression during Nematostella development. (A) Late blastul

slit-like blastopore; (D) 5-day planula with ectodermal and endodermal brachyury

pharyngeal mesenteries. Note that brachyury and forkhead expression domains a

in Xenopus , they act synergistically to form dorsal

mesoderm, in particular the notochord (O’Reilly et al.,

1995). Thus, forkhead and brachyury are an evolutionarily

ancient synexpression group in Eumetazoa.

a stage; (B) side view on early gastrula; (C) front view on late gastrula with

expression; (E) early primary polyp showing expression in the developing

re virtually indistinguishable. Scale bar is 100 Am.


Forkhead expression in particular is surprisingly con-

served among metazoans. Together with brachyury, it

marks the future blastopore and its derivatives, that is,

foregut and hindgut. For instance, in hemichordates and

echinoderms, forkhead is expressed in the vegetal plate

cells before gastrulation, later in the involuting endoderm,

and finally most strongly in the stomodeum anlage and the

proctodeum of the Tornaria and Pluteus larva, respectively

(Harada et al., 1996; Taguchi et al., 2000). Hence, in these

lower deuterostomes, expression appears ectodermally

restricted (if proctodeum and stomodeum are defined as

ectodermal structures). Yet, at least in chordates, forkhead

expression is not germ layer specific, but rather region-

and organ-specific. In mice, the forkhead homolog HNF-

3beta is expressed in the visceral endoderm, the node,

(which gives rise to axial mesoderm, the notochord) and

the floor plate (Ang and Rossant, 1994; Sasaki and Hogan,

1993; Weinstein et al., 1994). In the urochordates and

protochordates (Amphioxus and Ascidians), the forkhead

homolog is also expressed in gastrulating endoderm, the

notochord and the floor plate (Corbo et al., 1997; Olsen

and Jeffery, 1997; Shimauchi et al., 1997, 2001; Shimeld,

1997; Terazawa and Satoh, 1997). This suggests a close

association of endoderm and the dorsal mesoderm, the

notochord. In line with this, the notochord has been

proposed to be a derivative of the archenteron roof in

lower vertebrates, based on classical embryology (e.g.,

Siewing, 1969).

Much less information is available from Protostomes.

However, in several species the expression domains are

strikingly similar: in the Ecdysozoa, such as Drosophila, and

Tribolium and C. elegans forkhead marks and is essential for

the developing fore- and hindgut before and during

gastrulation (Gaudet and Mango, 2002; Schrfder et al.,

2000; Weigel et al., 1989). Among the Lophotrochozoa,

expression of forkhead has been studied in the mollusc

Patella vulgata. Strikingly, forkhead is expressed in the

endoderm and anterior mesoderm, deriving from the anterior

edge of the blastopore (Lartillot et al., 2002). At larval

stages, forkhead is most strongly expressed in the stomo-

deum and somewhat weaker in the endoderm, reminiscent of

the situation of vertebrates, where forkhead is also expressed

in the prechordal plate (Filosa et al., 1997). Based on our

expression data of forkhead in Nematostella vectensis, we

propose that forkhead has an ancestral role in defining the

blastopore and one derivative, the ectodermally derived

pharynx. The evolutionary conservation of the synexpres-

sion group of brachyury, forkhead and several other genes

suggest an establishment and coevolution of a cassette of

conserved transcription factors in the blastopore during early

metazoan evolution (reviewed in Lengyel and Iwaki, 2002;

Scholz and Technau, 2003; Technau, 2001). Since forkhead

and other node-specific genes also play important roles in

dorsal–ventral axis formation in vertebrates, we propose that

the blastopore evolved as an organizer for axis formation and

mesoderm formation during early metazoan evolution.

Acknowledgments

We would like to thank Thomas Holstein for critically

reading the manuscript. This work was supported by the

DFG (Te-311/1-3).

References

Ang, S.L., Rossant, J., 1994. HNF-3 is essential for notochord formation in

mouse development. Cell 78, 561–574.

Arendt, D., Nqbler-Jung, K., 1997. Dorsal or ventral: similarities in fate

maps and gastrulation patterns in annelids, arthropods and chordates.

Mech. Dev. 61, 7–21.

Arendt, D., Technau, U., Wittbrodt, J., 2001. Evolution of the bilaterian

larval foregut. Nature 409, 81–85.

Bridge, D., Cunningham, C.W., Schierwater, B., DeSalle, R., Buss, L.W.,

1992. Class-level relationships in the phylum Cnidaria: evidence from

mitochondrial genome structure. Proc. Natl. Acad. Sci. U. S. A. 89,

8750–8753.

Bridge, D., Cunningham, C.W., DeSalle, R., Buss, L.W., 1995. Class-level

relationship in the phylum Cnidaria: molecular and morphological

evidence. Mol. Biol. Evol. 12, 679–698.

Cano, A., Perez-Moreno, M.A., Rodrigo, I., Locascio, A., Blanco, M.J.,

del Barrio, M.G., Portillo, F., Nieto, M.A., 2000. The transcription

factor Snail controls epithelial–mesenchymal transitions by repressing

E-cadherin expression. Nat. Cell Biol. 2, 76–83.

Carlsson, P.,Mahlapuu,M., 2002. Forkhead transcription factors: key players

in development and metabolism. Dev. Biol. 250, 1–23.

Carver, E.A., Jiang, R., Lan, Y., Oram, K.F., Gridley, T., 2001. The mouse

snail gene encodes a key regulator of the epithelial–mesenchymal

transition. Mol. Cell. Biol. 21, 8184–8188.

Collins, A.G., 2002. Evaluating multiple alternative hypotheses for the

origin of Bilateria: an analysis of 18S rRNA molecular evidence. Proc.

Natl. Acad. Sci. U. S. A. 95, 15258–15463.

Corbo, J.C., Erives, A., Di Gregorio, A., Chang, A., Levine, M., 1997.

Dorsoventral patterning of the vertebrate neural tuve is conserved in

a protochordate. Development 124, 2335–2344.

Cunliffe, V.T., Ingham, P.W., 1999. Switching on the notochord. Genes

Dev. 164, 3–6.

del Barrio, M.G., Nieto, M.A., 2002. Overexpression of Snail family

members highlights their ability to promote chick neural crest

formation. Development 129, 1583–1593.

Dirksen, M.L., Jamrich, M., 1992. A novel, activin-inducible, blastopore

lip-specific gene of Xenopus laevis contains a fork head DNA-binding

domain. Genes Dev. 6, 599–608.

Filosa, S., Rivera-Perez, J.A., Gomez, A.P., Gansmuller, A., Sasaki, H.,

Behringer, R.R., Ang, S., 1997. Goosecoid and HNF-3b genetically

interact to regulate neural tube patterning during mouse embryogegesis.

Development 124, 2843–2854.

Fritzenwanker, J.H., Technau, U., 2002. Induction of gametogenesis in the

basal cnidarian Nematostella vectensis (Anthozoa). Dev. Genes Evol.

212, 99–103.

Frohman, M.A., Dush, M.K., Martin, G.R., 1988. Rapid production of full-

length cDNAs from rare transcripts: amplification using a single gene-

specific oligonucleotide primer. Proc. Natl. Acad. Sci. U. S. A. 85,

8998–9002.

Gajiwala, K., Burley, S.K., 2000. Winged helix proteins. Curr. Opin. Struct.

Biol. 10, 110–116.

Gaudet, J., Mango, S.E., 2002. Regulation of organogenesis by the

Caenorhabditis elegans FoxA protein PHA-4. Science 15, 2470–2482.

Grobben, K., 1908. Die systematische Einteilung des Tierreichs. Verh.

Zool. -Bot. Ges. Wien. 58, 491–511.

Hand, C., Uhlinger, K.R., 1992. The culture, sexual and asexual


reproduction, and growth of the sea anemone Nematostella vectensis.

Biol. Bull. 182, 169–176.

Harada, Y., Akasaka, K., Shimada, H., Peterson, K.J., Davidson, E.H.,

Satoh, N., 1996. Spatial expression of a forkhead homologue in the sea

urchin embryo. Mech. Dev. 60, 163–173.

Hayward, D.C., Miller, D.J., Ball, E.E., 2004. Snail Expression during

Embryonic Development of the Coral Acropora: Blurring the Diplo-

blast/Triploblast Divide?

Hobmayer, B., Rentzsch, F., Kuhn, K., Happel, C.M., von Laue, C.C.,

Snyder, P., Rothbacher, U., Holstein, T.W., 2000. WNT signalling

molecules act in axis formation in the diploblastic metazoan Hydra.

Nature 407, 186–189.

Hoch, M., Pankratz, M.J., 1996. Control of gut development by fork head

and cell signaling molecules in Drosophila. Mech Dev. 58, 3–14.

Ikenouchi, J., Matsuda, M., Furuse, M., Tsukita, S., 2003. Regulation of

tight junctions during the epithelium–mesenchyme transition: direct

repression of the gene expression of claudins/occludin by Snail. J. Cell

Sci. 116, 1959–1967.

Ip, Y.T., Park, R.E., Kosman, D., Yazdanbakhsh, K., Levine, M., 1992.

Dorsal-twist interactions establish snail expression in the

presumptive mesoderm of the Drosophila embryo. Genes Dev. 6,

1518–1530.

Kaestner, K.H., Hiemisch, H., Luckow, B., Schqtz, G., 1994. The HNF-3

gene family of transcription factors in mice: gene structure, cDNA

sequence, and mRNA distribution. Genomics 20, 377–385.

Kaestner, K.H., Knfchel, W., Martinez, D.E., 2000. Unified nomenclature

for the winged helix/forkhead transcription factors. Genes Dev. 14,

142–146.

Kaufmann, E., Knfchel, W., 1996. Five years on the wings of fork head.

Mech. Dev. 57, 3–20.

Knecht, A.K., Bronner-Fraser, M., 2002. Induction of the neural crest: a

multigene process. Nat. Rev., Genet. 3, 453–461.

Knfchel, S., Lef, J., Clement, J., Klocke, B., Hille, S., Koster, M., Knfchel,W., 1992. Activin A induced expression of a fork head related gene in

posterior chordamesoderm (notochord) of Xenopus laevis embryos.

Mech. Dev. 38, 157–165.

Kusch, T., Reuter, R., 1999. Functions for Drosophila brachyenteron and

forkhead in mesoderm specification and cell signalling. Development

123, 3991–4003.

Lai, E., Clark, K.L., Burley, S.K., Darnell, J.E., 1993. Hepatocyte nuclear

factor 3/fork head or bwinged helixQ proteins: a family of transcription

factors of diverse biologic function. Proc. Natl. Acad. Sci. U. S. A. 90,

10421–10423.

Langeland, J.A., Tomsa, J.M., Jackman, W.R., Kimmel, C.B., 1998. An

amphioxus snail gene: expression in paraxial mesoderm and neural

plate suggests a conserved role in patterning the chordate embryo. Dev.

Genes Evol. 208, 569–577.

Lartillot, N., Le Gouar, M., Adoutte, A., 2002. Expression patterns of fork

head and goosecoid homologues in the mollusc Patella vulgata support

the ancestry of the anterior mesendoderm across Bilateria. Dev. Genes

Evol. 212, 551–561.

Lengyel, J.A., Iwaki, D.D., 2002. It takes guts: the Drosophila hindgut as a

model system for organogenesis. Dev Biol. 243, 1–19.

Leptin, M., 1991. Twist and snail as positive and negative regulators during

Drosophila mesoderm development. Genes Dev. 5, 1568–1576.

Lespinet, O., Nederbragt, A.J., Cassan, M., Dictus, W.J., Van Loon, A.E.,

Adoutte, A., 2002. Characterisation of two snail genes in the gastropod

mollusc Patella vulgata. Implications for understanding the ancestral

function of the snail-related genes in Bilateria. Dev. Genes Evol. 212,

186–195.

Linker, C., Bronner-Fraser, M., Mayor, R., 2000. Relationship between

gene expression domains of Xsnail, Xslug, Xtwist and cell move-

ment in the prospective neural crest of Xenopus. Dev. Biol. 224,

215–225.

Martin, V.J., Littlefield, C.L., Archer, W.E., Bode, H.R., 1997. Embryo-

genesis in hydra. Biol. Bull. 192, 345–363.

Martindale, M.Q., Henry, J.Q., 1999. Intracellular fate mapping in a basal

metazoan, the ctenophore Mnemiopsis leidyi, reveals the origins of

mesoderm and the existence of indeterminate cell lineages. Dev. Biol.

214, 243–257.

Martindale, M.Q., Finnerty, J.R., Henry, J.Q., 2002. The Radiata and the

evolutionary origins of the bilaterian body plan. Mol. Phylogenet. Evol.

24, 358–365.

Martindale, M.Q., Pang, K., Finnerty, J.R., 2004. Investigating the origins

of triploblasty: dmesodermalT gene expression in a diploblastic animal,

the sea anemone Nematostella vectensis (phylum Cnidaria; class,

Anthozoa). Development 131, 2463–2474.

Martinez, D.E., Dirksen, M.-L., Bode, P.M., Jamrich, M., Steele, R.E.,

Bode, H.R., 1997. Budhead, a Fork Head/HNF-3 homologue, is

expressed during axis formation and head specification in Hydra. Dev.

Biol. 192, 523–536.

McMahon, A.P., 1994. Mouse development. Winged-helix in axial

patterning. Curr. Biol. 4, 903–905.

Niehrs, C., Pollet, N., 1999. Synexpression groups in eucaryotes. Nature

402, 483–487.

Nielsen, C., 1995. Animal Evolution. Interrelationships of the Living Phyla.

Oxford Univ. Press, Oxford.

Nieto, M.A., 2002. The snail superfamily of zinc-finger transcription

factors. Nat. Rev., Mol. Cell Biol. 3, 155–166.

Olsen, C.L., Jeffery, W.R., 1997. A forkhead gene related to HNF-3b is

required for gastrulation and axis formation in the ascidian embryo.

Development 124, 3609–3616.

O’Reilly, M.A., Smith, J.C., Cunliffe, V., 1995. Patterning of the mesoderm

in Xenopus: dose-dependent and synergistic effects of Brachyury and

Pintallavis. Development 121, 1351–1359.

Pani, L., Overdier, D.G., Porcella, A., Qian, X., Lai, E., Costa, R.H., 1992.

Hepatocyte Nuclear Factor 3b contains two transcriptional activation

domains, one of which Is novel and conserved with the Drosophila

Fork Head protein. Mol. Cell. Biol. 12, 3723–3732.

Qian, X., Costa, R.H., 1995. Analysis of hepatocyte nuclear factor-3b

protein domains required for transcriptional activation and nuclear

targeting. Nucleic Acids Res. 23, 1184–1191.

Ruiz i Altaba, A., Jessell, T.M., 1992. Pintallavis, a gene expressed in the

organizer and midline cells of frog embryos: involvement in the

development of the neural axis. Development 116, 81–93.

Sasaki, H., Hogan, B.L.M., 1993. Differential expression of multiple fork

head related genes during gastrulation and axial pattern formation in the

mouse embryo. Development 118, 47–59.

Savagner, P., 2001. Leaving the neighborhood: molecular mechanisms

involved during epithelial–mesenchymal transition. BioEssays 23,

912–923.

Schmidt, H.A., Strimmer, K., Vingron, M., von Haeseler, A., 2002. TREE-

PUZZLE: maximum likelihood phylogenetic analysis using quartets

and parallel computing. Bioinformatics 18, 502–504.

Scholz, C.B., Technau, U., 2003. The ancestral role of Brachyury:

expression of Nembra1 in the basal cnidarian Nematostella vectensis

(Anthozoa). Dev. Genes Evol. 212, 563–570.

Schrfder, R., Eckert, C., Wolff, C., Tautz, D., 2000. Conserved and

divergent aspects of terminal patterning in the beetle Tribolium

castaneum. Proc. Natl. Acad. Sci. 97, 6591–6596.

Shimauchi, Y., Yasuo, H., Satoh, N., 1997. Autonomy of ascidian fork

head/HNF-3 gene expression. Mech. Dev. 69, 143–154.

Shimauchi, Y., Chiba, S., Satoh, N., 2001. Synergistic action of HNF-3 and

Brachyury in the notochord differentiation of ascidian embryos. Int. J.

Dev. Biol. 45, 643–652.

Shimeld, S.M., 1997. Characterisation of amphioxus HNF-3 genes:

conserved expression in the notochord and floor plate. Dev. Biol.

183, 74–85.

Siewing, R., 1969. Lehrbuch der vergleichenden Entwicklungsgeschichte

der Tiere. Paul Parey, Hamburg.

Spring, J., Yanze, N., Middel, A.M., Stierwald, M., Groger, H., Schmid, V.,

2000. The mesoderm specification factor twist in the life cycle of

jellyfish. Dev. Biol. 228, 363–375.

Spring, J., Yanze, N., Josch, C., Middel, A.M., Winninger, B., Schmid, V.,


2002. Conservation of Brachyury, Mef2, and Snail in the myogenic

lineage of jellyfish: a connection to the mesoderm of bilateria. Dev.

Biol. 244, 372–384.

Taguchi, S., Tagawa, K., Humphreys, T., Nishino, A., Satoh, N., Harada, Y.,

2000. Characterization of a hemichordate fork head/HNF-3 gene

expression. Dev. Genes Evol. 210, 11–17.

Tardent, P., 1978. Coelenterata. Cnidaria. VEB Gustav Fischer, Jena.

Technau, U., 2001. Brachyury, the blastopore and the evolution of the

mesoderm. BioEssays 23, 788–794.

Technau, U., Bode, H.R., 1999. HyBra1, a Brachyury homologue, acts

during head formation in Hydra. Development 126, 999–1010.

Technau, U., Scholz, C.B., 2003. Origin and evolution of endoderm and

mesoderm. Int. J. Dev. Biol. 47, 531–539.

Terazawa, K., Satoh, N., 1997. Formation of the chordamesoderm in the

amphioxus embryo: analysis with Brachyury and fork head/HNF-3

genes. Dev. Genes Evol. 207, 1–11.

Thisse, C., Thisse, B., Postlethwait, J.H., 1995. Expression of snail2, a

second member of the zebrafish snail family, in cephalic mesendoderm

and presumptive neural crest of wild-type and spadetail mutant

embryos. Dev. Biol. 172, 86–99.

Timmerman, L.A., Grego-Bessa, J., Raya, A., Bertran, E., Perez-Pomares,

J.M., Diez, J., Aranda, S., Palomo, S., McCormick, F., Izpisua-

Belmonte, J.C., de la Pompa, J.L., 2004. Notch promotes epithelial–

mesenchymal transition during cardiac development and oncogenic

transformation. Genes Dev. 18, 99–115.

Weigel, D., Jqrgens, G., Kqttner, F., Seifert, E., J7ckle, H., 1989. Thehomeotic gene fork head encodes a nuclear protein and is

expressed in the terminal region of the Drosophila embryo. Cell

57, 645–658.

Weinstein, D.C., Ruiz i Altaba, A., Chen, W.S., Hoodless, P., Prezioso,

V.R., Jessel, T.M., Darnell, J.E., 1994. The winged-helix transcription

factor HNF-3 beta is required for notochord development in the mouse

embryo. Cell 78, 575–588.

Wikramanayake, A.H., Hong, M., Lee, P.N., Pang, K., Byrum, C.A., Bince,

J.M., Xu, R., Martindale, M.Q., 2003. An ancient role for nuclear beta-

catenin in the evolution of axial polarity and germ layer segregation.

Nature 426, 446–450.

Zaret, K., 1999. Developmental competence of the gut endoderm: genetic

potentiation by GATA and HNF3/Fork head proteins. Dev. Biol. 209,

1–10.

analysis of forkhead and snail expression reveals ...forkhead belongs to the group 1/hnf3/foxa...

Documents