ANTISENSE-MEDIATED RESISTANCE

TO Agrobacterium vitis

by

MOHAMED FOKAR, B.S.Ag., M.S.

A DISSERTATION

IN

AGRONOMY

Submitted to the Graduate Faculty of Texas Tech University in

Partial Fulfillment of the Requirements for

the Degree of

DOCTOR OF PHILOSOPHY

Approved

Accepted

December, 1998

ACKNOWLEDGMENTS

I wish to express my sincere gratitude to my major professor Dr. Richard

E. Durham for giving me the opportunity to work in his laboratory, his invaluable

support, guidance and encouragement throughout these years. I am also

grateful to Dr. Randy Allen for hosting me in his laboratory and providing me with

his technical expertise.

I would like to express my appreciation to Dr. Michael San Prancisco, Dr.

randall Jeter and Dr. Terry Wheeler for serving in my committee and for their

critical reading and editing for this dissertation. My thanks to Dr. Roy Michelle for

his advice and support.

Many thanks to post-doctorates, fellow graduate students and student

assistants for their help and interaction during this period including: Kim Pittcock,

David Boone, Ashley Baisanger, Pokar Ali, Eli Boroda, Tahhan Jaradat, Teresa

Burns, Dr. WonHee Kang, Dr. Ousama Zaghmout, Sundus Lodhi, Sheryl Schake

and Dr. Virginia Roxas.

I would like to thank my friend saeed Obaid, Saeed Pathallah, Dr. Alkul

and Dr. Kaddour for their sincere friendship and unending support. Their

friendship and generosity was a source of support and peace for me.

I will never be able to express the full extent of my gratitude and love to

my mother Alami Izza and my father Pokar Bouchaib. They provided so much

moral and financial support to me and to my family, that I could never be able to

11

pay back. I especially thank my father for instilling in me the love for science, the

relativity in thinking and the respect of nature. I have always looked to his

immense dedication to the family and to his strength of character, and I hope I can

fellow in his footsteps.

Special thanks to my brothers and sisters: Mustafa, saida, Yassir, Aziza,

and Ali for their love and support. I extend my sincere appreciation to my wife

Khadija for her understanding, sacrifices, and support. I would also like to thank

my daughter Aicha and son Hamza for their love.

Pinnaly, I would like to dedicate this dissertation to the one that got me

interested in science at an early age, and remains my source of inspiration and

support since. To my father, I dedicate this work and to him I pledge my sincere

respect and love.

Ill

TABLE OF CONTENTS

ACKNOWLEDGMENTS ii

ABSTRACT vii

LIST OP TABLES ix

LIST OP PIGURES x

CHAPTERS

I. LITERATURE REVIEW 1

1.1 Historical overview of Agrobacfer/tym-plant interaction 1

1.2 Agrobacterium vitis 4

1.3 A. vitis is a grapevine pathogen 6

1.4 The plant-Agrobacter/(7/77 interaction 10

1.4.1 Attachment and signal perception 10

1.4.2 Activation of virulence genes 12

1.4.3 T-DNA processing 16

1.4.4 T-DNA transfer 19

1.4.5 Integration of T-DNA 23

1.4.6 T-DNA expression and tumor formation 25

1.4.6.1 Auxins 26

1.4.6.2 Cytokinins 30

1.5 Objectives and Rationale 32

1.6 References 34

IV

I. BIOCHEMICAL AND MOLECULAR CHARACTERIZATION O?AGROBACTERIUM VITIS STRAINS COLLECTED NEAR LUBBOCK, TEXAS 55

2.1 Introduction 55

2.2 Materials and Methods 58

2.2.1 Isolation of A. vitis. bacteria 58

2.2.2 Biochemical characterization 58

2.2.3 Pathogenicity assay 59

2.2.4 Molecular characterization 60

2.2.4.1 Isolation of Total DNA 60

2.2.4.2 Isolation of Ti plasmid 61

2.2.4.3 Homology study 62

2.2.4.4 PCR analysis 63

2.3 Results and Discussion 64

2.3.1 Isolation and biochemical characterization of A. vitis 64

2.3.3 Pathogenicity test 68

2.2.4. Molecular characterization of A. vitis 71

2.4 References 75

III. ANTISENSE RNA MEDIATED RESISTANCE EXPRESSION TO GROWN GALL IN TOBACCO 92

3.1 Introduction 92

3.2 Materials and Methods 95

3.2.2 Construction of chimeric iaaM and iaaH antisense 95

3.2.2.1 Isolation of iaaM and iaaH genes 95

3.2.2.2 TA Cloning 95

3.2.2.3 Construction of iaaM and /aaH antisense constructs 96

3.2.3 Development of Transgenic Tobacco 97

3.2.3.1 Transformation of Agrobacterium cells 97

3.2.3.2 Agrobacfer/t/m-mediated tobacco transformation 98

3.2.4 Characterization of Transgenic Tobacco Plant 99

3.2.4.ITobacco DNA and RNA Extraction 99

3.2.4.2 Reverse transcriptase polymerase chain reaction 101

3.2.4.3 Evaluation of tobacco plant expressing antisense iaaM

and /aaH genes 101

3.3 Results and Discussion 103

3.4 References 108

IV. CONCLUSIONS 120

APPENDICES

A:SELCTIVEMEDIAPORAGROBACTRIUMBIOTYPING 122

B: BIOCHEMICAL TESTS 124

C: LIST OP CROWN GALL SAMPLES, HOST AND LOCATION 126

D: TRANSFORMATION AND TISSUE CULTURE MEDIA 127

VI

ABSTRACT

Agrobacterium vitis is the causal organism of crown gall in grapevine.

Infection is particularly severe in areas that experience winter damage to the

vine. Improving resistance to A. vitis will require a detailed knowledge about this

organism.

In this study, 18 grapevine isolates of A. wY/s were obtained from different

vineyards around Lubbock, Texas. Isolates were subjected to a phenotypic

characterization using several biochemical tests. Isolates were also evaluated

for host range, tumor morphology and opine utilization and the oncogenic regions

of the T-DNA were compared at the molecular level by Southern hybridzation.

Although all isolates were able to metabolize tartarte and grow on Roy-sasser

media, there was high variability based on other biochemical tests. This

variability was also observed in terms of tumor morphology and opine utilization.

Southern hybridization analysis, however, showed that the oncogenic regions of

A. vitis isolates have strong homology with previously characterized

Agrobacterium T-DNA genes. This study suggests that the local isolates were

probably of clonal origin.

Tobacco was used as a model to test whether transgenic plants wit T-

DNA auxin biosynthetic genes in an antisense orientation would block tumor

morphology. The expression of iaaM antisense RNA resulted in an

approximately 45% reduction in the number of tumors. The iaaM antisense also

Vll

affected tumor morphology by reducing gall size. Plants expressing iaaH

antisense had fewer tumors than the control, but more than 60% of samples

formed roots when infected with Agrobacterium. The incomplete suppression of

tumor formation may be due to the presence of other loci on the T-DNA that are

also involved in auxin biosynthesis. Although a complete inhibition of

tumorgenesis was not achieved, the fact that both tumor frequency and

morphology changed, indicated that further manipulation of phytohormone genes

using antisense technology may result in complete resistance to Agrobacterium

tumefaciens species in transgenic plants.

Vlll

LIST OP TABLES

2.1 List of Agrobacterium isolates 81

2.2 Responses of Agrobacfer/tym strains to biochemical tests 82

2.3 Virulence of Agrobacfer/iy/r? strains on selected host 83

3.1 Tumor size, number, and frequency of tumor in transgenic and wild type tobacco plants after infection by Agrobacterium tumefaciens I l l

3.2 Reduction in tumor size and number due to the expression of the antisense iaaM and iaaH genes in tobacco 112

IX

LIST OP PIGURES

1.1. Overview of the Agrobacter/ivm-plant interaction 11

1.2. Auxin biosynthesis pathway in Agrobacterium tumefaciens xi9

2.1. Tumor induced by Agrobacter/um strains on tobacco 84

2.2. Tumor induced by Agrobacterium strains on tomato 85

2.3. Tumor induced by Agrobacterium strains on tobacco 86

2.4. Tumor induced by Agrobacterium strains on grape 87

2.5. Agarose gel electrophoresis showing Ti plasmids of Agrobacter/i//T7 strains 88

2.6. Southern hybridization analysis of Eco Rl digest of Ti plasmid using pGV201 probe 89

2.7. Southern hybridization analysis of Eco Rl digest of Ti plasmid

using pGV153 probe 90

2.8. PCR amplification of 260 bp fragment from A. tumefaciens 91

3.1. Strategy for the development of the antisense iaaM construct 113

3.2. Strategy for the development of the antisense /aaH construct 114

3.3. PCR amplification of phytohormone genes from the Ti plasmid of Agrobacterium tumefaciens 115

3.4. Total RNA and Northern blot analysis of iaaM and iaaH

antisense in tobacco 116

3.5. RT-PCR analysis of/aa/W and /aaH antisense transcripts 117

3.6. Tumor morphology induced by Agrobacterium tumefaciens on tobacco leaf tissue 118

3.7. Tumor morphology induced by Agrobacterium tumefaciens on trangenic tobacco leaf tissue 119

CHAPTER I

LITERATURE REVIEW

1.1 Historical overview of Aarobacter/tvm-plant interaction

Crown gall is a plant disease characterized by a tumor growth. The term

gall refers to tumorous neoplastic growth of plant tissue occurring at a wound site

on the plant and crown signifies that galls were often observed at the base of the

plant stem. The first reported occurrence of crown gall was in Europe in the mid

1800's (Owens, 1928). The causative agent of the disease remained unknown

untill Cavara (1897) showed that crown gall in grape is induced by a bacterium.

However, some other reports implicated fungi as the cause of the disease

(Toumy, 1900). It was in 1907, that Smith and Townsend presented evidence

that the causative agent of crown gall was a bacterium. This bacterium was

called Agrobacterium tumefaciens (Smith and Townsend) Conn. It is a soil-

inhabiting. Gram-negative rod-shaped bacterium with a wide range of hosts

among higher plants including many dicotyledonous plants and some non-

graminaceous monocots (Suseelan et al., 1987; Grimsley, 1990). One study

estimated that at least 600 plant species from 331 genera are susceptible to

infection by A. tumefaciens (DeCleene and DeLey, 1976). Because of its broad

host range, crown gall is a world-wide problem.

This disease attacks nursery stocks, young plantings, and mature trees,

shrubs and lianas leading to serious economic losses. The annual financial

losses due to crown gall in the U.S. were last estimated to be $23 million on fruits

and nuts alone (Kennedy and Alcron, 1980). With the increased acreages of fruit

and nuts crops during last two decades, the economical losses due to crown gall

are probably higher than the previous estimation.

Agrobacterium tumefaciens induces tumorous growth after attachment

and invasion at the wound site of a sensitive host. Once formed, tumor tissue

retains its phenotype even in the absence of the inciting bacteria. Tumor can be

maintained indefinitely in an axenic culture (White and Braun, 1941; Braun,

1958). Biochemical studies revealed the existence of a unique nitrogenous

substance in the tumor tissue (Liorel, 1956; Morel, 1956). Later, these

compounds were identified as unusual amino acids and named "opines" (Petit et

al., 1970). In 1969, Kerr isolated a virulent biovar 1 strain from galls that were

induced by a mixed culture of an avirulent biovar 1 strain and virulent biovar 2

strain. This finding not only eliminated virulence as a basis for Agrobacterium

classification but also clearly implicated the virulence factor as a mobile entity. In

a search to determine the genetic basis of Agrobacterium virulence, Braun

(1959) suggested that a cytoplasmic entity or particle could be responsible for the

virulence and that this entity may or may not be under chromosomal control.

Later on, researchers from different laboratories found that a large plasmid was

required for virulence and this plasmid was denoted Ti plasmid for tumor-

inducing plasmid (Van larebeke et al., 1974; Watson et al., 1975; Zaenen et al.,

1974;).

The discovery of the TI plasmid was a very important event in determining

the mechanisms of Agrobacterium infection. It also triggered a cascade of

questions and hence more advances. In 1977, Chilton and co-workers provided

evidence that the Ti plasmid is the virulence factor. In their experiments, they

detected hybridization between Ti palsmid DNA and DNA isolated from axenic

gall tissue. Later studies showed that tumorous tissue contains a fragment of the

Ti plasmid, called the transferred DNA (T-DNA) (Chilton et al., 1980; Yadav et al.,

1980). Among the genes that reside on the T-DNA are genes coding for auxin

and cytokinin biosynthesis (Akiyoshi et al., 1984; Thomashow et al., 1984). The

expression of these genes induces a hormonal unbalance, which causes

uncontrolled cell growth. The other major T-DNA genes code for opines (Guyon

et al., 1980). The catabolism of opines is limited to the inciting bacteria, giving it

a survival advantage.

The Agrobacterium -plant interaction is a very unique system. It provides

the opportunity to manipulate the genome of many plants. These advances

contributed tremendously in the birth of a new field, plant genetic engineering,

which relies upon transgenic plants. One of the remarkable implications of this

field is the birth of a new industry, plant biotechnology. This industry is

revolutionizing the way crop improvement is achieved.

Agrobacterium also provides a model system for other plant host-

pathogen interactions. Por example, iaaM and iaaH genes of Pseudomonas

syringae pv. Savastanoi are highly similar to the auxin biosynthesis genes of

Agrobacterium (Yamada et al., 1985). Agrobacterium tumefaciens and human

rickettsial pathogen Rochalimaea quintana share 93% sequence identity in their

16S ribosomal RNA's. They also share a striking similarities in the way they

interact with their hosts (Weisburg et al., 1985).

1.2 Agrobacterium vitis

The genus Agrobacterium belongs to the alpha subdivision of the class

Proteobacteria. It is a member of the Rhizobiaceae family and it is closely

related to the Rhizobium, Phyllobacterium and rickettsiae (Holmes and Robert,

1981; Moore at al., 1988; Young and Citosvsky, 1991). Ochman and Wilson

(1987) reported that the divergence between Agrobactrerium and Rhizobium took

place approximately 250 million years ago. Strains of A. tumefaciens have been

divided into three biovars based on selected physiological and biochemical

characteristics. Biovar 3 was originally identified when Panagoupoulos isolated

Agrobacterium strains responsible for crown gall on grapevines in Greece

(Panagoupoulos and Psallidas, 1973). Some of the isolates were identified as

neither biotype 1 or 2. Later the new isolates were called biovar 3 (Kerr and

Panagoupoulos, 1977). Because of the strong association between biovar 3 and

grapevines, Ophel and Kerr (1990) renamed biovar 3 as Agrobacterium vitis.

Agrobacterium is divided into five species based on their Ti plasmid

characteristics, A. tumefaciens, A. radiobacter, A. rhizogenes, A. rubi, and A. vitis

(Often et al., 1992). One of the unique characteristics of A. vitis is its ability to

produce endo-polygalacturonase and p-1,4-endoglucanase enzymes (Bishop et

al., 1988; Ophel and Kerr, 1990) and its limited host range (Burr and Khatz,

1983). Kerr and Pangopoulos (1977) first described A. vitis from grapevine and

reported that these strains could only infect a limited number of hosts. Most A.

vitis strains are naturally limited to grapevines, whereas most of the other strains

have a wide host range (Anderson and Moore, 1979). There are several

biochemical tests used to separate between various biotypes. These are

chromosomally encoded traits. A. vitis can be distinguished by its ability to use

tartrate, citrate and malonate; the inability to use erythritol, melezitose, propionic

acid, and mucic acid; a negative 3-ketolactose reaction and ability to grow in 2%

NaCI (Moore et al., 1988). A. vitis can also be effectively distinguished from

biovar 2 strains because of its growth on potato medium supplied with 0.08%

calcium carbonate (Bouzar and Jones, 1992).

Unlike other Agrobacterium species A. vitis can grow on tartrate.

Grapevines are known to contain high levels of tartrate (Ruffner, 1982). Szegedi

(1985) was able to distinguish A. vitis from other Agrobacterium strains by their

tartrate utilization properties. Tartrate utilization may represent an adaptation to

grow in grape tissue. This gives a survival advantage to A. vitis over other

strains. This can also implicate tartrate's role in the narrow natural host range of

A. vitis. Early work has demonstrated that the tartrate-utilizing capacity is

encoded by a plasmid (Gallie et al., 1984). In 1992 Szegedi and co-workers

found that several A. vitis strains contain a large plasmid encoding tartrate

utilization, as shown by transfer to A. tumefaciens recipient strain UBAPP2 by

conjugation. However, a recent study showed that in limited-host-range strains

with a small T-DNA A region (small TA) of A. vitis such as AB3, the tartrate

utilization is under two functional tartrate utilization (TAR) regions. One is on a

cryptic plasmid (pTr) and the other is on the pTi plasmid (Often et al., 1995).

Recently. Dr. Otten's group in Strasbourg, Prance, has functionally characterized

the TAR regions. They found that each TAR region codes for the following

factors: a regulatory LysR-like protein, a tartrate permease, a tartrate

dehydrogenase (TDH), a potential reducatase which may catalyze the second

tartrate degradation step, and a pyruvate kinase required for optimal grov^h on

tartrate. Another TDH copy is present to the right of the TAR region, for which

the function is still unknown (Often, 1997).

1.3 A. vitis is a grapevine pathogen

Crown gall is a common disease on grape and is mainly caused by A. vitis

(Tarbah and Goodman, 1986). Burr and Katz (1983) were able to isolate virulent

A. vitis and other avirulent Agrobacterium strains from the rhizosphere of

grapevine plants. The predominance of A. vitis in grape was demonstrated long

ago when Cavara (1897) isolated crown-gall-inducing bacteria from diseased

grapevine canes. Also, reports from Greece (Panagopoulous and Psallis, 1973),

Hungary (Sule,1978) and the united states (Burr and Hurwitz,1981; Burr and

Katz, 1983) have identified A. vitis as the predominant strain associated with

grapevines.

Reports of the presence of crown gall associated with grapes are

numerous (Galloway, 1889; Hedgcock, 1910). Historically, crown gall disease

contributed to the destruction of many vineyards in Europe (Owens, 1928) and is

widely distributed in temperate zones. A. vitis caused great losses in New York

vineyards, especially on cold-sensitive cultivars (Burr, 1978). Ophel et al. (1988)

reported that A. vitis was present in grapevines grown in South Australia. Later

reports indicated that A. vitis bacteria were present at different levels in rootstock

and scion material from New South Wales, Victoria, and Western Australia

(Gillings and Ophel-Keller, 1995). In general, Agrobacterium overwinters in soil,

where it can exist for many years as a saprophyte (Agrios, 1988). Once a

susceptible plant is wounded due to frost or cultural practices, Agrobacterium

takes advantage of this condition to invade the plant cells and eventually cause

tumor growth. Structurally, crown galls first appear as small, spongy and watery

overgrowths on the stem or roots, which is formed mainly of parenchymatous

tissue. As the tumor grows, it develops into curled and distorted masses of

woody cells, and as the peripheral material tissue decay, the tumor tissue turns

dark brown or black (Hedgcock, 1910; Agrios, 1988). There are two forms of

galls that are associated with grapevines. The first and most frequent is root

galls. This form of galls is predominantly found during early stages of plant

development. It is characterized by a spherical, fleshy overgrowth from the roots

of young plants propagated from cuttings or at the intersection of scion and

rootstock in grafted plants (Burr, 1978). The other form is called cane galls, also

known as aerial galls. This form is frequently found on mature vines along the

line of the point of a wound injury. Aerial galls are more associated with freezing

injury (Lewitt, 1972) and can extend from the crown area to the main and lateral

canes (Burr, 1978). They are also associated with bad management practices,

such as internal injuries due to improper trellising and pruning (Lehoczky, 1978).

Crown gall on grapevine is a serious disease. It can hinder vine growth

and cause cane death if the vine is severely galled. Vines with galls are less

vigorous than non-infected plants and are susceptible to freezing and desiccation

(Chamberlain, 1962).

In addition to crown gall disease, A. vitis induces electrolyte leakage and

strong necrotic lesions on the roots of grapevine (Burr et al., 1988 ; Strover et al.,

1997). This is because A. vitis produces the extracellular enzymes

polygalacturonase (PG) and endoglucanase that degrade root epidermal tissue

(Ophel and Kerr, 1990; Rodriguez-Palenzula et al., 1991). Certain A. vitis strains

induce only a necrotic response in grape stems (Yanofsky et al., 1985a, 1985b;

Pu and Godman, 1992). This response is not related to the PG enzyme but to

the sensitivity of grapevine to high levels of auxin. These enzymes are normally

produced by pectolytic plant pathogens (Collmer and Keen, 1986). McGuire et

al. (1991) was able to isolate PG from necrotic lesions on grape roots induced by

A. vitis. They also reported that PG was produced by Ti-plasmid-carrying strains

8

as well as TMucking strains (McGuire et al., 1991). This suggested that the PG

is encoded by a chromosomal located locus. Mutational analysis revealed that

the pheA locus is involved in PG production (Brisset et al., 1991; Rodriguez-

Palenzula et al., 1991). An A. vitis mutant carrying a Tn5 insertion in the pheA

gene failed to form necrotic lesions, poorly attached to the plant cell and

produced small abnormal tumors. These observations suggest a broader role of

the pheA gene in tumorgenesis. Herlache et al. (1997) sequenced the A. vitis

pheA gene and found that the predicted protein is significantly similar to the

polygalacturonases of Erwinia caractovora and Ralstonia solanacearum. In the

same study, they reported that PheA protein is accumulated mainly in the

periplasm of the bacterium and it is able to produce dimers, trimers and

monomers from polygalacturonic acid (Herlache et al., 1997). Such compounds

are probably used to stimulate the virulence system of A. vitis, since galacturonic

acid has been reported to activate virulence gene of Agrobacterium tumefaciens

(Ankenbauer and Nester, 1990).

The necrotic lesions induced by A. vitis on the roots of grapevine were

shown to be hormonally mediated. Deng et al. (1995) generated mutants by

transposon mutagenesis from a necrosis inducing strain A281 and found that at

least two genes, tms1 and 6b, are responsible for the necrogenesis (Deng et al.,

1995). Both genes are known for their involvement in biosynthesis and

modulation of auxin (Thomashow et al., 1984; Hooykass et al., 1988). The ability

of A. vitis to live in the vascular system of symptomless plants make its control

very difficult to achieve (Tarbah and Goodman, 1986), and vegetative

propagation without proper indexing can result in great loss of vine.

1.4 The o\an{-Aarobacterium interaction

The molecular basis of the Agrobacterium interaction with its host can be

divided into six separate stages: Attachment and signal perception, activation of

virulence genes, T-DNA processing, T-DNA transfer, integration of T-DNA, and

finally T-DNA expression and tumor formation. Figure 1.1 shows an overall

summary of these stages.

1.4.1 Attachment and signal perception

In general, the attachment step is a prerequisite for many host-pathogen-

interactions. Animal viruses and bacterial pathogens, for example, require

specific binding sites on the host cell surface to initiate infection. Agrobacterium

is similar to other microbes in this aspect. The infection process starts when

bacteria are attracted to a wound site and bind to the plant cell (Douglas et al.,

1985; Matthysse, 1987; Thomashow et al., 1987). The attachment process is a

very important step in achieving a compatible interaction. Competition over the

plant cell binding sites between virulent and avirulent strains of bacteria inhibits

tumor formation (Lippincott and Lippincott, 1969).

Using scanning electron microscopy, Matthysse et al. (1981) and

Matthysse (1983) showed that A. tumefaciens binds to carrot suspension cells

10

3. T-DNA processing

5. Nuclear Targeting

VitCl

2b. Transcription/Translation of Vir proteins

4. Transport to plant

6. integration into Genome and Expression of" Oncogenes

AGROBACTERIUM DICOT PLANT CELL

Pig. 1.1. Overview of the Agrodactent/m-plant Interaction. Modified from Heath etal., (1995)

11

within 30 minutes and that the number of attached bacteria increase over an

eight-hour period. In the same experiment, long curving cellulose fibrils

projecting from the bacterial cell surfaces were detected. Their role is not a

major one in the attachment step, since cellulose-deficient mutants can attach to

plant cells. It appears that they help the bacteria attach tightly to the plant host

cell after the initial attachment takes place (Binns and Thomashow, 1988).

Several chromosomally located genes have been implicated in attachment

of the bacteria. Mutation analysis showed that cyclic-p-1,2-glucan plays a major

role in the attachment process. Mutations at the chvA and chvB loci render the

bacteria avirulent due to their inability to attach to the plant cells (Douglas et al.,

1982, 1985). Biochemical analysis showed that these mutants could not

synthesize cyclic-p-1,2-glucan (Puwanesarajh et al., 1985). Another

chromosomally encoded gene is exoC which codes for proteins involved in the

synthesis and transport of cyclic-p-1,2-glucan and extracellular polysaccharide

(Puwanesarajh et al., 1985; Cangelosi et al., 1987).

1.4.2 Activation of virulence genes

Pollowing the attachment of the bacterial cell on the plant cell, the

virulence genes are activated through a well-defined signal transduction

pathway. The wrgenes on the Ti plasmid are present as a virulence regulon.

The virA, B, C, D, E, F, G, H, and J operons are required for successful plant

12

transformation (Stachel and Nester, 1986). Although the roles of most operons

have been determined, no jnfomiatlon on the function of virF, virH and virJ is

known.

The wounded plant cells divide faster than normal cells in an attempt to

repair the wound. Accompanying this process is a release of phenolic

compounds, such as acetosyringone, sinaplnic acid and simple sugars which act

as signal molecules that activate the two-component regulatory system under the

control of virA and virG (Cangelosi et al.. 1990; Stachel et al., 1985; Charles et

al.. 1992). The wrgenes are expressed at very low levels until induced by plant

phenolic compounds (Stachel et al., 1986a). VirA and VirG are essential for

plant transformation and they are similar to other bacterial two-component

regulatory proteins that sense environmental conditions (Parkinson and Kofoid,

1992). VirA Is the environmental sensor and VirG is the response regulator or

transcriptional activator (Stachel and Nester, 1986).

The VirA protein Is a histidine protein kinase with two transmembrane

spanning regions identified as TM1 and TM2 (Winans et al., 1989). However, it

is present as a homodimer In the Inner membrane (Pan et al., 1993). The simple

sugars bind to the periplasmic galactose binding protein ChvE (Cangelosi et al.,

1990; Huang et al., 1990) which In turn interacts with VirA at the periplasmic

domain that is held intact by TM1 and TM2 (Cangelosi et al., 1990). The

periplasmic domains of VirA and the Tar protein in Escherichia coli, which senses

and promotes chemotaxis toward sugars, share high sequence homology

13

(Melchers et al., 1989). This observation led to the hypothesis that the

periplasmic domain of VirA binds directly to acetosyringone (Melchers et al.,

1989). However, the deletion of the VirA periplasmic domain did not result in a

loss of wrgene induction by acetosyringone (Melchers et al., 1989; Shimoda et

al., 1990). This shows that the VirA periplasmic domain is not necessary for

induction by acetosyringone, but is very important to enhance induction by

certain sugars in cooperation with ChvE (Shimoda et al., 1990; Cangelosi et al.,

1990). Phenolic compounds, however, bind VirA directly via the linker domain

adjacent to the second transmembrane domain (Lee et al., 1995). The binding of

inducer molecules stimulates VirA to autophosphorylate at a conserved histidine

residue (His-474). The phosphate is then transferred to an aspartate residue

(Asp-52) on VirG . The compounds secreted by the plant increase the

expression of VirA five- to ten-fold (Winans et al., 1988; Rogowsky et al., 1987).

In 1947, Braun reported that A. tumefaciens would induce tumors only at

temperatures below 32 °C. To explain this observation, Jin and co-workers

(1993) noted that VirA is inactive at temperatures higher than 32 °C due to the

fact that the autophosphorylation of VirA does not occur (Jin et al., 1993). In the

same study, Jin noted that a virG mutant strain, which induce wrgenes without

VirA, is also unable to transform host plants at temperatures above 32 °C,

indicating that other Vir proteins may also be temperature-sensitive.

VirG contains two domains, a DNA-binding domain and a receiver domain

(Winans et al., 1994). At the C-terminus, is a helix-turn-helix DNA-binding

14

domain which binds to the 12-bp conserved sequences, known as wr boxes,

located upstream of each of the wr operons (Jin et al., 1990; Powell et al., 1990;

Powell and Kado, 1989). The N-terminal domain is the phosphorylated site. The

phosphate is transferred to an aspartate residue (Asp-52). This residue is very

important in the process of phosphorylation and hence in the activation of vir

genes. A mutation that changes an aspargine at position 54 to an aspartic acid

resulted in wrG constitutive expression (Jin et al., 1993; Sheeren-Groot et al.,

1994).

In addition to VirA and VirG regulating virulence, there are also several

chromosomal genes involved in wrgene regulation. One of them is the ros gene

that encodes a repressor of the promoter region of the wrC and virD operons

(D'Souza-Ault et al., 1993), which are transcribed in opposite directions. In the

absence of Ros, wrC and virD are constitutively expressed (Close et al., 1987).

Unlike VirG, Ros protein binds to the targeted sequences using its zinc-finger

DNA-binding domain (Cooley et al., 1991 and D'Souza-Ault et al., 1993). The

VirG and Ros binding sites overlap in the promoter region. Once activated, VirG

overcomes the repression by Ros. Another important chromosomal locus is

miaA, which encodes t-RNA: isopentenyl transferase activity. Mutations at miaA

decrease expression of wrgenes by two- to ten-fold (Gray et al., 1992). In

addition, ivr, acvB , and chvG/chvl chromosomal genes have also been

implicated in wr activation (Mantis and Winans, 1993; Metts et al., 1991).

15

However, their specific role in the process of transformation remaines unknown.

Prom the present data, it appears that chromosomally encoded virulence genes

are important and may play a major role in the process of signaling, transducing,

and activating the Ti wrgenes.

1.4.3 T-DNA processing

The T-DNA is flanked by 25-bp imperfect repeat called the T-DNA border

regions (Yadav et al., 1982; Baker et al., 1983). Different Ti plasmids have T-

DNA with different compositions. Por example, the T-DNA in the nopaline-Ti

plasmids is a single stretch flanked by a left border (LB) and right border (RB)

(Willmitzer et al., 1983; Wang et al., 1984). On the octopine-type Ti plasmid, the

T-DNA has multiple border sequences, which split the T-DNA into right region

(TR), central region (TC) and left region (TL) (Stachel and Nester, 1986). The

TR region is 7.8 kb and encodes genes involved in opine synthesis; the TC is 1.5

kb of unknown function and the TL is 13 kb and encodes auxin and cytokinin

biosynthesis (Hooykaas and Schilperoort, 1992). Mutational analysis showed

that the right border is required for virulence, while the left border was not

essential. When the right border was inverted, virulence was reduced

dramatically and nearly all the Ti plasmid was transferred instead of the T-DNA

(Citovsky et al., 1992a; Zambryski, 1992).

Pollowing wrgene induction, T-DNA borders are recognized by the

VirD1A/irD2 complex. VirDI and VirD2 are endonucleases that introduce a site-

16

and strand-specific nick in the bottom strand of the right border between the third

and fourth base pairs (Yanofsky et al., 1986; Jasper et al., 1994). In vitro studies

have shown that VirD2 is able to introduce a nick in the bottom strand of the right

border (Jayaswal et al., 1987; Jasper et al., 1994), and VirDI has type I

topoisomerase activity and is able to relax a supercoiled DNA (Ghai and Das,

1989). At least in vitro, the nicking reaction needs only VirD2 to process single-

stranded templates (Pansegrau et al., 1993; Jasper et al., 1994) but requires the

addition of VirDI to process double-stranded templates (Vogel and Das, 1994;

Scheiffele et al., 1995). Over-expression of VirDI and VirD2 in A. tumefaciens

increased plant transformation efficiency and tumor size on Kalanchoe

daigremontiana and Daucus carota L. (Wang et al., 1990).

Nicks occur within four hours after wrgene activation (Jayaswal et al.

1987). These nicks serve as the initiation and termination sites for T-strand

production (Albright et al., 1987; Veluthambi et al., 1988). The nicked strand of

the right border provides the 3' hydroxyl group for replication initiation, and the

top strand provides a template. The release of the T-strand has been

hypothesized to take place by DNA replication and strand displacement (Stachel

et al.,1986b; Albright et al., 1987). Pollowing the nicking, the tyrosine-29 residue

of VirD2 covalently binds to the 5' end of the T-strand giving the T-DNA complex

a polar character (Pilichkin and Gelvin, 1993; Zupan and Zambryski, 1995).

Site-directed mutagenesis manipulation in which each tyrosine in VirD2 was

changed to a glycine showed that the tyrosine-29 residue is required for

17

endonuclease activity and it Is very important in the DNA-protein complex (Vogel

and Das, 1992a).

The VirCI is another virulence factor thought to interact with VirD2.

During T- strand processing, VirCI binds to an upstream site adjacent to the right

T-DNA borders called "overdrive" which increases tumorigenicity (Peralta and

Ream, 1985; Peralta et al., 1986; Toro et al.,1989). Mutants with insertion

mutations in VirCI and VirC2 have weak virulence, which is also a characteristic

of strains with deleted overdrive sequences (Ji et al., 1988). Toro et al., (1989)

showed that VirCI binds with very high affinity to overdrive in a gel retardation

assay. The same group also suggested a possible interaction between VirD2,

VirCI and other bacterial factors during T-strand transfer (Toro et al., 1989).

VirCI was found to increase T-strand production from the octopine Ti plasmid in

E. CO//when VirDI and VirD2 are limiting (De Vos and Zambryski, 1989). There

are also speculations that bacterial housekeeping proteins of DNA repair, like

helicases, may be involved in the T-strand production (Jinsong and Citovsky,

1996).

It is important to note the striking similarities between VirDI A/irD2 with the

TraJ and Tral proteins encoded by lncPRP4 plasmid found in a pathogenic

Pseudomonas strain (Kado, 1994; LessI and lanka, 1994). IncP RP4 is a

conjugative broad-host-range plasmid that can be transferred to Gram-negative

bacteria, Gram-positive bacteria and to yeast (LessI and Lanka, 1994). Similar to

VirDI A/irD2, Tral/TraJ are required for site-and strand-specific cleavage of the

18

origin of transfer (ohT) of RP4 (Pansegrau and Lanka, 1991). Surprisingly. VirD2

can process the IncP plasmid oriT in vitro, but Tral is unable to process a T-DNA,

which suggests a higher specificity of Tral to Its sequences (Pansegrau et al.,

1993). Another report indicated that VirD4 and VirB proteins can complement

TraG and Tra2 proteins during conjugation between Agrobacterium cells of

another plasmid called IncQ RSP1010, (LessI and Lanka, 1994). All of these

results show significant similarities between T-DNA transfer and bacterial

conjugation.

1.4.4 T-DNA transfer

The process of T-DNA transfer involves many membranes and cellular

spaces before the T-DNA enters the plant nucleus. The role of virB, virE and

virD in T-DNA transfer has been well documented. The gene products of virB

and virD form a putative channel, while wrE encodes a single-stranded binding

protein that coats the T-DNA strand preventing nucleolytic degradation.

The VirB is the largest wroperon (10.2 Kb) with 11 open reading frames

(Thompson et al., 1988; Kuldau et al., 1990; Shirasu et al., 1990). Beijersbergen

et al. (1994) studied the localization and topology of virB proteins and found that

most contain cleavable signal sequences or hydorophobic domains. Several

other studies have focused on individual VirB proteins using phoA fusions,

immunoblots and sequence analysis (Manoil et al., 1990; Shirau and Kado, 1993;

Pernandez et al., 1996a). VirBI and VirB2 are localized to both the inner and

19

outer membranes (Shirasu and Kado, 1993; Thorstenson et al., 1993). VirB3 are

mainly localized to the outer membrane (Shirasu and Kado, 1993). VirB4 and

VirB11 are localized to the inner bacterial membrane and are thought to provide

energy for T-DNA strand transfer. VirB4 has a nucleotide-binding site (Shirasu

and Kado, 1993), and VirB11 is both an ATPase and a protein kinase (Christie et

al., 1989). Mutation in wrBII eliminating the nucleotide- binding site caused an

avirulent phenotype (Stephens et al., 1995), suggesting a major role of VirB11 in

T-DNA transport. VirB5 is a periplasmic protein, and VirB6 is an inner membrane

protein with five transmembrane loops (Beijersbergen et al., 1994). VirB7 is a

membrane-associated lipoprotein with its amino terminus anchored to the outer

membrane and its carboxyl domain in the periplasmic space (Pernandez et al.,

1996a). VirB8, VirB9 and VirBI 0 have been localized to the inner and outer

membrane or both depending upon the fractionation method used (Shirasu and

Kado, 1993;Thorstenson et al., 1993; Thorstenson and Zambryski, 1994). Other

studies have shown that there are a lot of interactions between different VirB

proteins. Por example, VirB9 is required for VirBI 0 complex formation and

stability (Beaupre et al., 1996), and VirB9 accumulation requires the production

of VirB8, the stability of which depends on a disulfide cross-link to VirB7 (Berger

and Christie, 1994; Pernandez et al., 1996b; Spudich et al., 1996). It is important

to note that VirB proteins function as a complex that forms a multiproteln channel

structure. This is very similar to other protein-protein interactions involved in the

20

formation of virulence-associated P pili in Gram-negative bacteria (Kuehn et al.,

1993). In a series of elegant experiments, Pullner and collaborators (1996)

showed that pili were present on Agrobacterium cells when grown at low

temperature, and that these pili required the presence of virB2-11 and virD4

genes. The virB1 gene was required for pilus assembly and conjugative transfer.

These results add more evidence that the T-DNA transfer from bacteria to the

plant cell may mimic the naturally occurring conjugative plasmid transfer between

bacteria.

Zupan and Zambryski (1995) suggested that the transfer of the T-DNA

strand is likely to be as a single-stranded DNA-protein complex in order to

preserve its integrity. Besides VirB operon proteins, the other proteins most

important at this phase are encoded by the wrE operon. The wrE operon

encodes two proteins, VirEI and VirE2. Both VirE proteins are required for

tumorigenesis (Winans et al., 1987; McBride and Knauf, 1988). VirE2 is located

mainly in the cytoplasm, but may exist in the inner or outer membrane and

periplasm (Christie et al. 1988). This protein is a single-stranded DNA binding

(SSB) protein without sequence specificity (Christie et al., 1988; Citovsky et al.,

1989) but with high affinity to only single-stranded DNA (Sen et al., 1989). It

completely coats the T-DNA strand preventing nucleolytic degradation and is

believed to extend the ssDNA to a narrow diameter thus facilitating its transfer

via membrane channels. Using electron microscopy and in vitro VirE2-ssDNA

binding kinetics, Citovsky et al. (1989) estimated that the molecular mass of the

21

T-DNA complex is around 50,000 kD, with a length of 3600 nm and a width of 2

nm, and that it contains approximately 600 molecules of VirE2. These data

suggest that the T-DNA complex is a very stable structure and it is likely to be

unaccessible to external nucleolytic activity. Whether SSB proteins bind to

ssDNA inside the bacterial cell or inside the plant cell is still not clear. However,

recent data suggest that both T-strand and VirE2 proteins are transported

independently into the plant cell. Pirst, Citovsky reported that transgenic plants

expressing VirE2 restore virulence of a VirE2-mutant (Citovsky et al., 1992b).

Second VirEI is implied to have a functional role in transporting VirE2 from the

bacterial cell into the plant cell. In this study a VirEI-deficient mutant with normal

VirE2 expression and T-DNA strand was avirulent; however, when coinoculated

with a strain having normal amounts of VirEI and VirE2 but lacking a T-DNA

strand, it became virulent (Sundberg et al., 1996).

Once the T-DNA strand enters the plant cell, it is targeted to the cell

nucleus. The VirD2 protein contains three putative nuclear localization signals

(NLSs) of the protein sequence K-R/K-X-R/K (Herrera-Estrella et al., 1990). One

NLS is located at the N-terminus and the other two in the C-terminus of VirD2.

The deletion of the N-terminal NLS did not affect the transfer of the T-DNA to the

nucleus, which indicates its minor role in this process. However, deletion of both

C-terminal NLSs inhibited the transfer of the T-DNA and subsequently blocked

the tumor formation (Howard et al., 1992; Shurvinton et al., 1992; Rossi et al.,

1993; Narasimhulu et al., 1996). These data suggest that the VirD2 protein,

22

which is covalently linked to the 5' end of T-DNA strand is a major player in

targeting the T-DNA strand to the nucleus. Other studies have also implicated

VirE2 in the process of nuclear targeting. Using VirE2-GUS fusions, VirE2 was

localized in the plant nucleus (Citovsky et al., 1992b). The same experiment also

identified two functional NLSs within the VirE2 molecule. Citovsky et al. (1994)

found that transgenic plants expressing a mutant VirE2 that is unable to bind

ssDNA but retains both NLSs were relatively resistant to wild-type

Agrobacterium. This shows that the mutant VirE2 competed with the incoming T-

strand complex for nuclear transport. Direct evidence that the VirE2 protein is

involved in nuclear uptake was provided by Zupan et al. (1996). They

microinjected a complex of VirE2 and fluorescently labeled ssDNA and labeled

ssDNA alone into stamen hair cells of Tradescantia virginiana and monitored the

localization of the complex by epifluorescence microscopy. They found that

ssDNA alone remained in the cytoplasm, while the VirE2-ssDNA complex was

localized in the plant cell nucleus.

1.4.5 Integration of T-DNA

Once inside the nucleus, the T-DNA is dissociated from the T-complex

and is integrated into the plant genome. The mechanism by which the physical

integration takes place is not well understood. Also, It is not clearly known yet

whether the integration requires a double-stranded DNA intermediate.

23

Mapping studies have shown that T-DNA can be inserted into any site on

the plant chromosome (Ambros et al., 1986; Chyi et al., 1986). Although several

studies have suggested that integration preferentially occurs at transcriptionally

active sites (Herman et al. 1990; Koncz et al. 1989), no specific sequences have

been identified as a preferential site of T-DNA integration.

Since T-DNA does not encode proteins allowing its integration like

retroviruses and transposons, it is likely that either transported proteins from the

bacterium or plant factors enable integration. Recent data suggest that VirD2

and VirE2 may be involved in the integration process (Tinland et al., 1995). In

this study, an Agrobacterium strain with a wrD2 mutation was used to infect

tobacco seedlings. T-DNA strand integration by the mutant was less than 1% of

the wild type. This difference was attributed to the fact that the 5' end of the

integrated DNA was truncated and highly rearranged.

VirD2 has a motif very common to many recombinases (Argos et al.,

1986). The mutant used in the Tinland et al. (1995) study had a mutation at this

motif Rossi et al. (1996) investigated the role of VirE2 on T-DNA integration

using the same procedure as Tinland et al. (1995). They found that VirE2

influenced the T-DNA integration and was required for integration fidelity at the 3'

but not the 5' end of the T-strand molecule (Rossi et al., 1996). Shurvinton et al.

(1992) studied in detail the early transcription of T-DNA in plant nuclei and found

a short amino acid sequence downstream of the VirD2 NLS which they

designated the co domain. This domain was later found to be necessary for T-

24

DNA integration (Narasimhulu et al., 1996). Whatever the case, the integration

of T-DNA is thought to be achieved by illegitimate recombination (Gheysen et al.,

1991). However, homologous recombination can occur when large sequences of

homology exist between the T-DNA and integration site (Offringa et al., 1990).

Homologous recombination was also the mode of T-DNA integration following

infection of yeast (Bundock et al., 1995). These results suggest that the way T-

DNA integrates into the host DNA is dependent on the host genome structure

and organization.

1.4.6 T-DNA expression and tumor formation

The observation that axenic crown gall tumors could be cultured in vitro

without exogenous phytohormones, led to the speculation that Agrobacterium

altered the hormonal balance of the infected plant tissue (Braun, 1958). In his

pioneering work, Braun (1958) showed that tumors exhibited auxin-like growth

effects. Subsequent studies confirmed Braun's work and provided more

evidence on the role of auxin and cytokinin and their metabolism in tumor

formation (Morris, 1986, 1987).

Unlike other steps, tumor formation is controlled and regulated by genes

encoded by T-DNA. The T-DNA genes are expressed using plant cell's

polymoreses. However, the expression levels vary among the different T-DNA

genes (Langridge et al., 1989; Leisner and Gelvin, 1989; Mitra and Ann, 1989).

Beside phytohormone genes, the T-DNA also contains a set of genes required

25

for the production of opines. Opines are modified amino acids and sugar

derivatives, used as carbon and nitrogen sources by Agrobacterium. This gives

a survival advantage to the inciting Agrobacterium over all other soil microbes

(Guyon et al., 1980; Tempe and Goldmon, 1982; Petit et al., 1983).

Using transposon mutagenesis, Garfinkel et al. (1981) identified two

important loci within T-DNA that control tumor morphology: tms (tumor

morphology shooty) and fmr (tumor morphology rooty). Mutations in the tms

locus induced tumors with shoot-like teratomas, while mutation in the tmr locus

induced tumors with roots. The comparison of these observations with the

pioneering work of Skoog and Miller (1957) suggested the role of auxin and

cytokinin. Skoog and Miller (1957) showed that a high cytokinin/auxin ratio will

promote shoot formation, a low ratio will promote root formation and intermediate

ratio induces an unorganized callus. Later, Akiyoshi et al. (1983) showed that

the levels of auxin and cytokinin were much higher in tumors caused by wild type

compared to tumors induced by tms mutants or fmr mutants. These results

provided evidences that crown gall tumors are the result of hormonal unbalance.

1.4.6.1 Auxins

The T-DNA of the octopine Ti plasmid is divided into separate TR-DNA

and TL-DNA regions (Thomashow et al., 1980). Transcriptional and genetic

analysis of T-DNA from various octopine plasmids revealed that eight

polyadenylated mRNA's are transcribed from the TR-DNA region and five from

26

TL-DNA (Gelvin et al., 1982; Willmitzer et al.,1982 ,1983). Baker et al. (1983)

sequenced the entire T-DNA from an octopine Ti plasmid and showed that there

are two open reading frames (ORP) within the tms (tms1 and tms2) locus and

one within the fmr locus. It was also found that tms1 encodes a large ORP and

tms2 encodes a smaller ORP. These ORP's are oriented in opposite directions

(Baker etal., 1983).

In 1984, Inze et al. suggested that the tms1 and tms2 (also referred to as

iaaM and iaaH, respectively) products are involved in a pathway-like process,

which may involve a diffusable intermediate. Basically, they coinfected a plant

host with two A. tumefaciens strains, one with a mutation in iaaM and the other

with a mutation in the iaaH gene. The resulting tumors were similar to a-wild-

type induced tumor (Inze et al., 1984). To identify the diffusable intermediate,

Thomashow and coworkers expressed the iaaH and iaaM genes in E.coli and

found that iaaH encodes an enzyme that converts indole-3-acetamide (lAM) to

indole-3-acetic acid (lAA) (Thomashow et al., 1984), while iaaM encodes an

enzyme that converts L-tryptophan to lAM (Thomashow et al.,1986). The gene

product of /aa/W was called tryptophan 2-monooxygenase, and the iaaH product

was called indoleacetamide hydrolase.

Later on, other researchers confirmed these findings independently

(Schroder et al.,1984; Van Onckelen et al., 1986), and the auxin biosynthesis

pathway was established as a two-step process in which the iaaM and iaaH

genes act sequentially to convert tryptophan to lAM and then to indole-3-acetic

27

acid (Thomashow et al. 1986). The first step, which is catalyzed by tryptophan 2-

monooxygenase, involves oxidative decarboxylation of tryptophan; then lAM is

hydrolyzed by indoleacetamide hydrolase to produce lAA (Kosuge et al., 1983).

Pigure 1.3 shows the chemical pathway of auxin synthesis by Agrobacterium.

It is important to note that auxin biosynthesis and its role in pathogenesis

is not unique to Agrobacterium strains. Another pathogen, Pseudomonas

savastanoi, induces tumorous overgrowths on oleander and olive plant.

Pseudomonas savastano has the same auxin biosynthesis pathway (Hutcheson

and Kosuge, 1985). Contrary to Agrobacterium, auxin production in

Pseudomonas savastanoi occurs in the bacterium, but the genes involved are

highly homologous to the iaaM and iaaH from T-DNA (Yamada et al., 1985).

Agrobacterium rhizogenes is known to induce hairy roots in transformed tissue.

This is due to the presence of a pathogenic Ri plasmid that carries genes

homologous to the auxin biosynthetic loci of the Ti plasmid (Huffman et al., 1984;

Cardarelli et al., 1987). Auxin production is also involved in the symbiotic

interaction between Rhizobium species and their hosts (Morris 1986). However,

its biological activity is still unclear. The genetic conservation of auxin

biosynthetic genes among different species may suggest how the T-DNA and

auxin-mediated pathogenicity of Agrobacterium tumefaciens have evolved.

28

Tryptophan H NH

CHCHCOOH H

lndole-3-acetamide

Tryptophan 2-monooxygenase

CHC // \

O

NH H

lndole-3-acetic acid

Indoleacetamide hydrolase

CHC // \

O

OH

Pig. 1. 3. Auxin biosynthesis pathway in Agrobacterium tumefaciens.

29

1.4.6.2 Cytokinins

Biochemical and genetic analysis has revealed that the tmr gene (also

called ipt) is responsible of cytokinin production (Akiyoshi et al., 1984; Barry et

al., 1984; Buchmann et al., 1985). The tmrgene encodes an

isopentenyltransferase enzyme which catalyzes the addition of an isopentenyl

side chain to the N position of 5'-adenosine monophosphate to yield iso-

pentenyladenosine monophosphate. This product is a precursor for cytokinin

biosynthesis (Taya et al., 1978; Chen and Melitz, 1979).

Many studies have shown the importance of cytokinin in pathogenesis.

Cytokinin may maintain a healthy plant tissue (Miller, 1971) and increase nutrient

mobilization in the host (Angra-Sharma and Mandahar, 1993), which in turn

allows favorable conditions for pathogen proliferation (Mahadevan, 1984; Angra-

Sharma and Mandahar, 1993). Paini et al. (1985) reported that crown gall

tissues have an unusually high and very diverse endogenous cytokinin level.

The same group identified over 15 cytokinins in crown gall (PaIni et al., 1985). It

is not yet clear whether these cytokinins are similar to those produced by normal

tissues. When /pf was inactivated, the isopentenyl transferase activity was lost

and tumor production required an exogenous supply of cytokinin for growth in

vitro (Ooms et al., 1981; Morris et al., 1982; Binns, 1983; Akiyoshi et al., 1984).

Similar to auxins, cytokinins are also involved in other microbe-plant

interactions. Por example they are produced by Pseudomonas savastanoi during

the pathogenic interactions with their host. Surico et al. (1984) reported that in

30

addition to lAA, cytokinins were also produced by P. savastanoi pv. savastanoi io

induce galls on olive and oleander. In 1986, Morris et al. isolated a plasmid

localized gene from P. savastanoi pv. savastanoi denoted (ptz) that encodes for

cytokinin biosynthesis. The ptz gene has a high functional homology with ipt

from Agrobacterium tumefaciens. Cytokinin is also involved in club root

(root gall) disease caused by Plasmodiophora brassicae. These types of galls

have been shown to contain extremely high amounts of auxin and cytokinins

(Dekhujzen and Overeem, 1971; Butcher et al., 1974). Galls in maize caused by

Ustilago maydis contain abnormally high level of cytokinin compare to healthy

plants (Mills and van Staden, 1978).

Beside the iaaM, iaaH and ipt genes, two other T-DNA genes, gene 6b

and gene5 are believed to be involved in accentuating the activity of auxin and

cytokinin (Leemans et al., 1982). Agrobacterium mutants at 6b gene induce

abnormal tumors on certain plants (Ream et al., 1983). Hooykaas et al. 1988

reported that 6b gene can affect the activity of both auxin and cytokinin, and

therefore, they suggested that it can be considered as an one gene. Tinland et

al. (1989, 1990) found an auxin activity associated with 6b gene. However,

others have shown that it reduces cytokinin activity (Spanier et al., 1989).

Although a mutation at gene5 have no significant effect on tumor morphology, it

appears to underscore the effect of mutations at iaaH or iaaM genes (Leemans

etal., 1982). In 1991, Korber et al. suggested that gene5 modulates the auxin

response by the autoregulated production of an auxin antagonist.

31

1.5 Obiectives and Rationale

The grape industry in Texas is important to the state economy. In 1996,

the total economic impact generated by grape industries was estimated to be

$104.6 million. It also supported over 2,220 Texas jobs (Dodd etal., 1996). One

of the active and growing viticultural areas is the Texas High Plains. It

represents 42% of the total Texas grape production (Dodd et al., 1996). It is also

expected that grape acreage will significantly increase during next decade

(Mitchell, 1998).

One of the economically important pathogen associated with grape is

Agrobacterium vitis. Among all fruit and nut crops, grapes showed the highest

economic losses due to Agrobacterium (Kennedy and Alcron, 1980). A. vitis is

also a problem in the Texas High Plains region, especially after severe freezing

temperatures. A total destruction of several vineyards was accredited to A. vitis

in the Texas High Plains (Mitchell, 1998). Due to its systemic nature, A. vitis is

very difficult to control. Usually, replanting is the only solution when infestation is

severe, and since the disease is soil-borne, abundant inoculum exists for

infestation of the new transplants. Therefore, an effective approach to control A.

vitis is needed.

The objectives of this study were:

1. To characterize the predominant pathogenic A. vitis strains associated with

grapes in the Texas High Plains region.

32

2. To use tobacco as a model system to test whether transgenic plants with T-

DNA auxin biosynthetic genes in an antisense orientation would block tumor

formation.

33

1.6 References

Agrios, G. 1988. Plant Pathology. 3rd edition. Academic Press. New York, pp.558-564.

Akiyoshi, D., Morris, R., Hinz, R., Mischke, B., Kosuge, T., Garfinkel, D., Gordon M., and Nester, E. 1983. Cytokinin/auxin balance in crown gall tumors is regulated by specific loci in the T-DNA. Proc. Natl. Acad. Sci. 80:407-411

Akiyoshi, D., Klee, H., Amasino, R., Nester, E., and Gordon, M. 1984. T-DNA of Agrobacterium tumefaciens encodes an enzyme of cytokinin biosynthesis. Proc. Natl. Acad. Sci. USA 81:5994-5998.

Albright, L.M., Yanofsky, M.P., Leroux, B., Ma, D., and Nester, E. 1987. Processing of the T-DNA of Agrobacterium tumefaciens generates border nicks and linear, single-stranded T-DNA. J. Bacteriol. 169:1046-1055

Ambros, P., Matzke A., and Matzke M.1986. Localization of Agrobacterium rhizogenes T-DNA in plant chromosomes by in situ hybridization. EMBO J. 5:2073-2077.

Anderson A . and Moore L. 1979. Host specificity in the genus Agrobacterium. Phytopathology 69:320-323

Angra-sharma, R., and Mandahar, C. 1993. Involvement of carbohydrates and cytokinins in pathogenicity of Helminthosporium carbonum. Mycopathologia 121:91-98.

Ankenbauer, R.G., and Nester, E.W. 1990. Sugar mediated induction of Agrobacterium tumefaciens virulence genes: Structural specificity and activities of monosaccharides. J. Bacteriol. 172:6442-6446.

Argos, P., Landy, A., Abremski, K., Egan, J., Haggard-Ljungquist, E., Hoess, R., Khan, M., Kalionis, B., Narayana, S., Pierson III, L., Sternberg, N., and Leong, J. 1986. The integrase family of site-specific recombinases: regional similarities and global diversity. EMBO J. 5:433-440.

Baker, R.P., Idler, K.B., Thompson, D.V., and Kemp, J.D. 1983. Nucleotidesequence of the T-DNA region from Agrobacterium tumefaciens octopine Ti plasmid pTi15955. Plant Mol. Biol. 2: 335-350

Barry, G., Rogers, S., Praley, R., and Brand, L. 1984. Identification of a cloned cytokinin biosynthetic gene. Proc. Natl. Acad. Sci. USA 81: 4776-4780.

34

Beaupre, C , Dale, E., and Binns, A. 1996. Interaction between VirB membrane proteins involved in the movement of DNA from Agrobacterium tumefaciens into plant cells. J. Bacteriol.

Beijersbergen, A., Smith, S., and Hooykaas, P. 1994. Localization and topology of VirB proteins of Agrobacterium tumefaciens. Plasmid 32:212-218.

Berger, B. and Christie P. 1994. Genetic complementation analysis of the Agrobacterium tumefaciens virB operon: wr82 through virB11 are essential virulence genes. J. Bacteriol. 176:3646-3660.

Binns, A.N., and Thomashow, M.P. 1988. Cell biology of Agrobacterium infection and transformation of plants. Annu. Rev. Microbiol. 42:575-606

Binns, A. 1983. Host and T-DNA determinants of cytokinin autonomy in tobacco cells transformed by Agrobacterium tumefaciens. Planta 158:272-279

Bishop, A., Katz, B., Burr, T., Kerr, A., and Ophel, K. 1988. Pectolytic activity in Agrobacterium tumefaciens. (Abstr.) Phytopathology 78:1551.

Bouzar, H., and Jones, J. 1992. Distinction of biovar 2 strains of Agrobacterium from other chromosomal groups by differential acid production. Letters in Applied Microbiology 15:83-85.

Braun, A. 1947. Thermal studies on the factors responsible for tumor initiation in crown gall. Am. J. Bot. 34:234-240

Braun, A. 1958. A physiological basis for autonomous growth of the crown-gall tumor cell. Proc. Natl. Acad. Sci. USA 44: 344-349

Braun, A. 1959. A demonstration of the recovery of the crown-gall tumor cell with the use of complex tumors of single-cell origin. Proc. Natl. Acad. Sci. USA 45:932-938.

Brisset, M. N., Rodriguez-Palenzula, P., Burr, T.J. and Collmer, A. 1991. Attachment, chemotaxis, and multiplication of Agrobacterium tumefaciens biovar 1 and biovar 3 on grapevine and pea. Appl. Environ. Microbiol. 57:3178-3182.

Buchmann, I., Marner, P., Schroder, G., waffenschmidt, S., and Schroder, J. 1985. Tumor genes in plants: T-DNA encoded cytokinin biosynthesis. EMBO J. 4:853-859

35

Bundock, P., den Dulk-Ras, A., Beijersbergen. A., and Hooykass, P. 1995. Trans Kingdom T-DNA transfer from Agrobcaterium tumefaciens to Sacchromyces cen/isae. EMBO. J. 14:3206-3214.

Burr, T. J., Bishop, A. L., Katz. B. H., Blanchard, L. M., and Bazzi, C. 1988. A root-specific decay of grapevine caused by Agrobacterium tumefaciens and A. racf/obacfer biovar 3. Phytopathology 77: 1424-1427.

Burr, T. and Katz, B.I 983. Isolation of Agrobacterium tumefaciens biovar 3 from grape gall and sap, and from vineyard soil. Phytopathology 73:163-165

Burr, T., and Hurwitz, B. 1981. Occurrence of Agrobacterium radiobacter pv. tumefaciens (Smith and Townsend) Conn, biotype 3 on grapevine on New York State. Phytopathology 71:206. (Abstr.)

Burr, T. 1978. Crown gall of grapevine. Vinifera Wine Growers J. 5:131-133

Butcher, D., El-Tigani, S., and Ingram, D. 1974. The role of indole glucosinolates in the club root disease of the cruciferae. Physiol. Plant Pathol. 4:127-140.

Cangelosi, G., Ankenbauer, R. and Nester E.1990. Sugars induce the Agrobacterium virulence genes through a perplasmic binding protein and a transmembrane signal protein. Proc. Natl. Acad. Sci USA 87:6708-6712

Cangelosi, G., Hung L., Puvanesarajah, V., Stacey, G., Ozga, D., Leigh, J. and Nester, E.I987. Common loci for Agrobacterium tumefaciens and Rhizobium meliloti exopolusaccharide synthesis and their roles in plant infections. J. Bacteriol. 169:2086-2091.

Cardarelli, M., Spano, L., Mariotti, D., Mauro, M., Van Sluys, M., and Costantino, P. 1987. The role of auxin in hairy root induction. Mol. Gen. Genet. 208:457-463.

Cavara, P. 1897. Tuberculosis of vine. Staz. Sprim. Agrar. Ital. Modena 30:483-487.

Chamberlain, G. 1962. The occurrence of areal crown gall of grape vines in Niagara Peninsula of Ontario, Canada. Can. Plant Dis. Surv. 42:208-211

Charles, T., Jin, S., and Nester E., 1992. Two component sensory transduction synthesis in phytobacteria. Ann. Rev. Phytopathol. 30:463-484.

Chen, C, and Melitz, D. 1979. Cytokinin biosynthesis in a cell-free system from cytokinin autotrophic tobacco tissue cultures. PEBS lett. 107:15-20.

36

Chilton, M., Drummond, M., Merlo, D., Sciaky, D., Montoya, A., Gordon, M., and Nester, E. 1977. Stable incorporation of plasmid DNA into higher plant cell: the molecular basis of crown gall tumorigenesis. Cell 11: 263-271

Chilton, M., Saiki, R., Yadav, N., Gordon, M., and Quetier, P. 1980. T-DNA from Agrobacterium Ti plasmid is in the nuclear DNA fraction of crown gall tumor cells. Proc. Natl. Acad. Sci. USA 77: 4060-4064.

Christie P., Ward, J., Gordon, M., and Nester, E. 1989. A gene required for transfer of T-DNA to plants encodes an ATPase with autophosphorylating activity. Proc. Natl. Acad. Sci. USA 86: 9677-9681.

Christie, P., Ward, J., Winans, S. and Nester, E. 1988. The Agrobacterium tumfaceins virE2 gene product is a single-stranded DNA-binding protein that associates with T-DNA. J. Bacteriol. 170: 2659-2667

Chyi, Y., Jorgensen, R., Goldstein, S., Tanksely S., and Loaizafigueroa, F. 1986. Locations and stability of Agrobacter/tym-mediated T-DNA insertions in the Lycopersicon genome. Mol. Gen. Genet. 204:64-69.

Citovsky, V., Wong, M., and Zambryski, P. 1989. Cooperative interaction of Agrobacterium VirE2 protein with single stranded DNA: Implications for the T-DNA transfer process. Proc. Natl. Acad. Sci. USA 86: 1193-1197.

Citovsky, V., Mclean, G., Greene, E., Howard, E., Kuldau, G., Thorstenson, Y., Zupan, J., and Zambryski, P. 1992a. Agrobacfer/t/m-plant cell interaction: Induction of wrgenes and T-DNA transfer: In Molecular Signals in Plant microbe Communications, D.P.S. Verma, ed ( Boca Raton, PL: CRC Press), pp. 169-198.

Citovsky, V., Zupan, J., and Zambryski, P. 1992b. Nuclear localization of Agrobacterium Vir E2 protein in plant cells. Science 256, 1803-1805.

Citovsky, V., Zupan, J., and Zambryski, P. 1994. Nuclear import of Agrobacterium VirD2 and VirE2 proteins in maize and tobacco. Proc. Natl. Acad. Sci. USA 91: 3210-3214.

Close, T., Rogowsky, P., Kado, C, Winans, M., Yanofsky and Nester, E.I987. Dual control of Agrobacterium tumefaciens Ti plasmid virulence genes. J. Bacteriol. 169:5113-5118

Collmer, A., and Keen, N. T., 1986. The role of pectic enzymes in plant pathogenesis. Ann. Rev. Phytopathology 24:383-409.

37

Cooley, M., D'souza, M. and Kado, C. 1991. The wrC and virD operons of the Agrobacterium Ti plasmid are regulated by the ros chromosomal gene: analysis of the cloned ros gene. J. Bacteriol. 173:2608-2616

DeCleene, M., and DeLey J. 1976. The host range of crown gall. Bot. Rev. 42:389-466.

Dekhujzen, H., and Overeem, T. 1971. the role of cytokinin in clubroot formation. Physiol. Plant Pathol. 1:151-161.

Deng, W.; Pu, X., Goodman, R.N., Gordon, M.P., and Nester, E.W. 1995. T-DNA genes responsible for inducing a necrotic response on grapevines. MPMI. 4:538-548.

De Vos, G. and Zambryski, P. 1989. Expression of Agrobacterium nopaline specific VirDI, VirD2 and VirCI proteins and their requirment for T-strand production in E. coli. Mol. Plant-Microbe Interactions 2:43-52

Dodd, T., Michaud, M and Hood, D. 1996. A profile of the Texsa wine and wine grape industry. Research report No. 96-11, December, 1996. Texas Wine Marketing Research Institute. Texas Tech University.

Douglas, C , Staneloni, R., Rubin, R., and Nester, E. 1985. Identification and genetic analysis of an Agrobacterium tumefaciens chromosomal virulence region. J. Bacteriol. 161:850-860.

Douglas, C , Halperin, W. and Nester, E. 1982. Agrobacterium tumefaciens mutants affected in attachment to plant cells. J. Bacteriol. 152:1265-1275.

Douglas, C , Ataneloni, R., Rubin, R. and Nester, E.I985. Identification and genetic analysis of an Agrobacterium tumefaciens chromosomal virulence region. J. Bacteriol. 161:850-860.

D'Souza-Ault, M., Cooley, M. and Kado, C. 1993. Analysis of Ros repressor of Agrobacterium virC and virD operons: molecular intercommunication between plasmid and chromosomal genes. J. Bacteriol. 175:3486-3490.

Pernandez, D., Dang, T., Spudich, G., Zhou, X., Berger, B., and Christie, J. 1996a. The Agrobacterium tumefaciens. virBT gene product, a proposed component of the T-complex transport apparatus, is a membrane associated lipoprotein exposed at the periplasmic surface. L. Bacteriol. 178:3156-3167.

38

Pernandez, D., Spudich, G., Zhou, X., and Christie, P. 1996b. The Agrobacterium tumefaciens V\rB7 lipoprotein is required for stabilization of VirB proteins during assembly of the T-DNA complex transport apparatus. J. Bacteriol. 178, 3168-3176

Pilichkin, S. and Gelvin. 1993. Pormation of a putative relaxation intermediate during T-DNA processing directed by the Agrobacterium tumefaciens VirDI, D2 endonuclease. Mol. Microbiol. 8:915-926.

Pullner, K., Lara, J., and Nester, E. 1996. Pilus assembly by Agrobacterium T-DNA transfer genes. Science 273:1107-1109.

Gallie, D., Hagiya, M., and Kado, C. 1984. Analysis of Agrobacterium tumefaciens plasmid pTiC58 replication region with a novel high-copy number deravative. J. Bacteriol.

Galloway, B. 1889. Black-knot of the grape. USDA Bot. Div. Bull. 8:63.

Garfinkel, D., Simpson, R., Ream L., White, P., Gordon, M.n and Nester E. 1981. Genetic analysis of Crown gall: a fine structure map of the T-DNA by site directed mutagenesis. Cell 27: 143-153.

Gelvin, S., Thomashow, M., McPherson, J., Gordon, M., and Nester, E. 1982. Sizes and map positions of several plasmid-DNA-encoded transcripts in octopine-type crown gall tumors. Proc. Natl. Acad. Sci. USA 79: 76-80.

Ghai, J., and Das, A. 1989. The virD operon of Agrobacterium tumefaciens Ti plasmid encodes a DNA-relaxing enzyme. Proc.Natl. Acad. Sci. USA

Gheysen, G., Villarroel, R. and Van Montagu, M. 1991. Illegitimate recombination in plants: a model for T-DNA integration. Genes Dev. 5:287-297.

Gillings, M., and Ophel-Keller, K. 1995. Comparison of strains of Agrobacterium vitis from grapevine source areas in Australia. Australian Plant Pathology 24:29-37.

Gray, J., Wang, J., and Gelvin, S. 1992. Mutation of the miaA gene of Agrobacterium tumefaciens results in reduced wrgene expression. J. Bacteriol. 174: 1086-1098.

Grimsley, N.1990. Agreinfection. Physiol. Plant. 79:147-153.

39

Guyon, P., Chilton, M., Petit, A., and Tempe, J. 1980. Agropine in "null-type" crown gall tumors: Evidence for generality of the opine concept. Proc. Natl. Acad. Sci. USA 77: 2693-2697.

Heath, J.D., Charles, T.C., and Nester, W.E. 1995. Ti plasmid and chromosomally Encoded Two-component Systems Important in Plant Cell Transformation by Agrobacterium Species. In Two component Signal Transduction, Edited by James A. Horch and Thomas J. Silhavy. pp 367 385. American Society for Microbiology, Washington, D.C.

Hedgcock, G.I 910. Pield studies of the crown gall of the grape. Bur. of plant Ind., USDA Bull. 131:21-23

Herlache, T. C , Hotchkiss, JR. A T., Burr, T. J., and Collmer, A., 1997. Charcterization of the Agrobacterium vitis pheA gene and comparison of the encoded polygalacturonase with homologous enzymes from Erwinia carotovora and Ralstonia solancearum. Applied and Envir. Microbiol. 63:338-346.

Herman, L., Jacobs. A., Van Montagu M. and Depicker, A. 1990. Plant chromosome/marker gene fusion assay for study of normal and truncated T-DNA integration events. Mol. Gen. Genet. 224:248-256.

Herrera-Estrella, A., Van Montagu, M., and Wang, K. 1990. A bacterial peptide acting as a plant nuclear targeting signal: the amino-terminal portion of Agrobacterium VirD2 protein directs a p fusion protein into tobacco nuclei. Proc. Natl. Acad. Sci. USA 87: 9534-9537

Holmes, B., and Roberts, P. 1981. The classification and nomenclature of Agrobacteria. J. Appl. Bacteriol. 50:443-467.

Hooykaas, P., den Dulk-Ras, H., and Schilperoort, R. 1988. The Agrobacterium tumefaciens T-DNA gene 6b is an one gene. Plant Mol. Biol. 11: 791

Hooykaas, P. and Schilperoort. 1992. Agrobacterium and plant genetic engineering [published erratum appears in Plant Mol. Bio. 1992]. Plant Mol. Biol. 19:15-38

Howard, E., Zupan, J., Citovsky, V. and Zambryski, P. 1992. The VirD2 protein of A. tumefaciens contains a C-terminal bipartie nuclear localization signal: implications for nuclear uptake of DNA in plant cells. Cell 68:109-118

40

Huang, Y., Morel, P., Powell, B. and Kado, C . 1990. VirA, a coregulator of Ti specific virulence genes, is phosphorylated in vitro. J. Bacteriol. 172:1142-1144.

Huffman, G., White, P., Gordon, M., and Nester, E. 1984. Hairy root inducing plasmid: Physical map and homology to tumor-inducing plasmids. J. Bacteriol. 157:269-276.

Hutcheson, S., and Kosuge, T. 1985. Regulation of 3-indoleacetic acid production in Pseudomonas syringae pv. savastonoi. Purification and properties of tryptophan -2- monooxygenase. J. Biol. Chem. 260:6281-6287.

Inze, D., Pollin, D., Van Lijsebettens M., Simoens, C, Genetello, C, Van Montagu M., and Schell, J. 1984. Genetic analysis of the individual T-DNA genes of Agrobacterium tumefaciens; further evidence that two genes are involved in indole-3-acetic acid synthesis. Mol. Gen. Genet. 194:265-274.

Jasper, P., Koncz, C, Schell, J, and Steinbiss, H. 1994. Agrobacterium T-strand production in vitro: Sequence-specific cleavage and 5' protection of single stranded DNA templates by purified VirD2 protein. Proc. Natl. Acad. Sci. USA 91: 694-698.

Jayaswal, R., Veluthambi, K., Gelvin, S. and Slightom, J. 1987. Double-stranded cleavage of T-DNA and generation of single-stranded T-DNA molecules in E. coli by a wrD-encoded border-specific endonuclease from Agrobacterium tumefaciens. J. Bacteriol. 169:5035-5045.

Ji, J., Martinez, A., Dabrowski, M., Veluthambi, K., Gelvin S., and Ream, W. 1988. The overdrive enhancer sequence stimulates production of T strands from the Agrobacterium tumefaciens tumor-inducing plasmid. In : Staskawicz, B. Ahlquist, P. and Yoder, O. (ed.). Molecular biology of plant pathogen interactions. UCLA Symposium Mol. Cell. Biol. Alan R. Liss, New York

Jin, S., Sond, Y., Deng, W., Gordon, M. and Nester, E. 1993. the regulatory VirA protein of Agrobacterium tumefaciens does not function at elevated temperatures. J. Bacteriol. 175:6830-6835

Jin, S., Roltsch, T., Ankenbauer, R., Gordon, M. and Nester, E. 1990. The VirA protein of Agrobacterium tumefaciens is autophosphorylated and is essential for the vir gene regulation. J. Bacteriol. 172:525-530.

41

Jinsong, S. and Citovsky, V. 1996. Agrobacterium-Plant cell DNA transport:: have virulence Proteins, will travel. Plant cell. 8:1699-1710.

Kado, C. 1.1994. Promiscuous DNA transfer system of Agrobacterium tumefaciens: role of the virB operon in sex pilus assembly and synthesis. Molec. Microbiol. 12:17-22.

Kennedy, B. and Alcron, S. 1980. Estimates of U.S. crop loses to prokaryotic plant pathogens. PI. Disease 64:674-676.

Kerr, A. 1969. Transfer of virulence between strains of Agrobacterium. Nature 208: 1175-1176.

Kerr, A., and Pangopoulos C. 1977. Biotypes of Agrobacterium radiobacter var tumefaciens and their biological control. Phytopath. Z. 90:172-179.

Koncz, C , Martini, N., Mayerhofer, R., Koncz-Kalman, Z., Korber, H., Redei, G., and Schell, J. 1989. High frequency T-DNA-mediated gene tagging in plants. Proc. Natl. Acad. Sci.USA 86: 8467-8471.

Korber, H., Strizhov, N., Staiger, D., Peldwish, J., Olsson, O., Sandberg, G., Palme, K., Schell, J., and Koncz, C. 1991. T-DNA gene 5 of Agrobacterium modulates auxin response by autoregulated synthesis of a growth hormone anatagonist in plants. EMBO J. 10:3983-3991.

Kosuge, T., Comai, L., and Glass, N. 1983. Virulence determinants in plant pathogen interactions. In Plant Molecular Biology. (R.B. Goldbert, ed), pp.167-177. Alan R. Liss, New York.

Kuehn, M., Ogg, D., Kihiberg, J., Slonim, L., Plemmer, K., Bergfors, T., and Hultgern, S. 1993. Structural basis of pilus subunit recognition by the PapD chaperone. Science 262: 1234-1241.

Kuldau, G., DeVos, G., Owen, J., McCaffrey, G., and Zambrtski, P. 1990. The virB operon of Agrobacterium tumefaciens pTiC58 encodes 11 open reading frames. Mol. Gen. Genet. 221:256-266.

Langridge, W., Pitzgerald, K., Koncz, C, Schell, J., and Szalay, A. 1989. Dual promoter of Agrobacterium tumefaciens mannopie synthase genes is regulated by plant growth hormones. Proc. Natl. Acad. Sci. USA 86:3219-3223.

42

Lee, Y., Jin, S., Sim, W. and Nester, E. 1995. Genetic evidence for direct sensing of phenolic cpmpounds by the VirA protein of Agrobacterium tumefaciens. Proc. Natl. Acad. Sci. USA 92: 12245-12249.

Leemans, J., Deblaere, R., Willmitzer, R., DeGreve, H. Hernalsteens, J., Van Montagu, M., and Schell, J. 1982. Genetic identification of functions of TL DNA transcripts in octopine crown galls. EMBO J. 1:147-152.

Lehoczky, J. 1978. Root system of the grapevine as a reservoir of Agrobacterium tumefaciens cells, pp. 239-243. In Proc. 4**" Int. Conf Plant Path. Bact., Anger.

Leisner, S., and Gelvin, S. 1989. Multiple domains within the upstream activator sequence of the octopine synthase gene. Plant cell 1:925-936.

LessI, M. and lanka, E. 1994. Common mechanisms in bacterial conjugation and Ti-mediated T-DNA transfer to plant cells. Cell 77:321-324

Lewitt, J. 1972. Responses of plants to Environmental Stress, (ed) Academic Press. 697pp New York.

Liorel, C. 1956. Sur la mise en evidence d'un acide amine nonidentifie particulier aux tissues de crown-gall. Bull Soc. Pr. Physiol. Veg. 2:76.

Lippincott, J., and Lippincott, B. 1969. Bacterial attachment to a specific wound site is an essential stage in tumor induction by Agrobacterium tumefaciens. J. Bacteriol. 97:620-628.

Mahadevan, A., 1984. Growth regulators. Microorganisms and diseased plants. Oxford and IBA Publishing, New Delhi, India pp. 465-466.

Manoil, C , Mekalanos, J., and Beckwith, J. 1990. Alkaline phosphatase fusions: sensors of subcellular location. J. Bacteriol. 172:515-518.

Mantis, N. and Winans, S. 1993. The chromosomal response regulatory gene chvl of Agrobacterium tumefaciens complements an E. coli phoB mutation and is required for virulence. J. Bacteriol. 175:6626-6636.

Matthysse, A. 1983. Role of bacterial cellulose fibrils in Agrobacterium tumefaciens infection. J. Bacteriol. 154:906-915.

Matthysse. A. 1987. Characterization of nonattaching mutants of Agrobacterium tumefaciens. J. Bacteriol. 169:313-323.

43

Matthysse, A., Holmes, K., and Gurliz, R. 1981. Elaboration of cellulose fibrils by Agrobacterium tumefaciens during attachment to carrot cells. J. Bacteriol. 145:583-595.

McBride, K. and Knauf, V. 1988. Genetic analysis of the wrE operon of the Agrobacterium Ti plasmid pTiA6. J. Bacteriol. 170:1430-1437.

McGuire, R.G., Rodriguez-Palenzula, P., Collmer, A., and Burr, T.J. 1991. Polygalacturonase production by Agrobacterium tumefaciens biovar 3. Appl. Environ. Microbiol. 57:660-664.

Melchers, L., regensburg, T., Bourret, R., Sedee, N., Schilperoort, R., and Hooykaas. 1989. Menbrane topology and functional analysis of the sensory protein VirA of Agrobacterium tumefaciens. EMBO J. 8:1919 1925.

Metts, J., West, J., Doares, S., and Matthysse, A. 1991. Characterization of three Agrobacterium tumefaciens avirulent mutants with chromosomal mutations that affect induction of vir genes. J. Bacteriol. 173: 1080-1087.

Miller, C. 1971. Cytokinin production by mycorrhizal fungi. In Ectomycorrhizae (E.Hacskagho, ed.) pp. 168-174. U.S. Porest Service. North America Conference on Mycorrhizae (1969) Proceedings. Wasgington, DC.

Mills, L., and van Staden, J. 1978. Extraction of cytokinins from maise smut tumors form maize and Ustilago maydis cultures. Physiol. Plant Pathol. 13:73-80.

Mitchell, R. Texas Tech University. 1998. Personal Communication

Mitra. A., and An, G. 1989. Three regulatory elements comprise the upstream promoter region of the octopine synthase gene. Mol. Gen. Gent. 215:294-299.

Moore, L., Kado, C, and Bouzar, H. 1988. Gram-negative bacteria. A. Agrobacterium. pp 16-36. In: Laboratory Guide for Identification of Plant Pathogenic Bacteria. 2"^ ed. N.W. Schaad, ed. American Phytopathological Society, St. Paul, MN.

Morel, G. 1956. Metabolism de L'arginine par les tissus de crown gall de topinambour. Bull. Soc. Pr. Physiol. Veg. 2:75.

Morris, R. 1986. Genes specifying auxin and cytokinin biosynthesis in phytopathology. Ann. Rev. Plant Physiol. 37:509-538.

44

Morris, R. 1987. Genes specifying auxin and cytokinin biosynthesis in prokaryotes. in: Plant Hormones and their role in plant growth and development (P.J. Davis, ed) pp. 636-655.

Morris, R., Powell, G., Beaty, J., Durely, R., Homes, N., Liea, L., and MacDonald, S. 1986. Cytokinin biosynthetic genes and enzymes form Agrobacterium tumefaciens and other plant-associated prokryotes. In: Plant Grov^h Substances (M. Bopp, ed.) pp. 185-186. Springer-Verlag, Berlin.

Morris, R., Akiyoshi, D., MacDonald, E., Morris, J., Regier, D., and Zaerr, B. 1982. Cytokinin metabolism in relation to tumor induction by Agrobacterium tumefaciens. In: plant Growth substances (P.P. wareing,ed) pp. 175-183. Academic Press. London.

Narasimhulu, S., Deng, X., Sarria, R., and Gelvin. 1996. Early transcription of Agrobacterium T-DNA genes in tobacco and maize. Plant cell 8:22701 22704.

Ochman, H., and Wilson, A. 1987. Evolution in bacteria: Evidence for a universal substitution rate in cellular genomes. J. Mol. Evol. 26:74-86.

Offringa, R., DeGroot, M., Haagsman, H., Does, M., Van den Elzen. P., and Hooykaas, P. 1990. Extrachromosomal homologous recombination and gene targeting in plant cells af[er Agrobacterium mediated transformation. EMBO. J. 9:3077-3084.

Ooms, G., Hooykaas, J., Moolenaar, G., and Schilperoort, R, 1981. Crown gall plant tumors of abnormal morphology induced by Agrobacterium tumefaciens carrying mutated octopine Ti plasmids; analysis of T-region DNA function. Gene 14:33-50.

Ophel, K., and Kerr, A. 1990. Agrobacterium vitis - new species for strains of Agrobacterium biovar 3 from grapevines. Int. J. Syst. Bacteriol. 40:236-241.

Ophel, K., Burr, T., Magarey, P., and Kerr, A., 1988. Detection of Agrobacterium tumefaceins biovar 3 in south Australian grapevine propagation material. Australian Plant Pathology 17:61066.

Often, L. 1997. http://ibmp.u-strasbq.fr/dep4/equ1/d4 equi res9195.html. pp. 1-3. May 10^^ 1997.

45

Otten, L., Crouzet, P., Salomone, J., DeRuffray, P., and Szegedi, E. 1995. Agrobacterium vitis strain AB3 harbors two independent tartrate utilization systems, one of which is encoded by the Ti plasmid. Mol. Plant-microb Interact 1: 138-146.

Otten, L., Canaday, J., Gerard, J., Pournier, P., Crouzet, P., Paulus, P. 1992. Evolution of Agrobacteriua and their Ti plasmids - A Review. Mol. Plant-Microb Interact. 4: 279-287.

Owens, C. 1928. Principles of Plant Pathology, pp. 182-189. John Wiley and Sons, New York.

PaIni, L., Tay, S., Nandi, S., Pianca, D., deKlerk, G., Wong, O., Letham, D., and Macleod, J. 1985. Cytokinin biosynthesis in plant tumor tissues. Biol, plant 27:195-203.

Pan, S., Charles, T., Jin, S., Wu, Z., and Nester, E. 1993. Performed dimeric state of the sensor protein VirA is involved in plant-Agrobacter/tvm signal transduction. Proc. Natl. Acad. Sci. USA 90: 9939-9943.

Panagopoulous, C, and Psallidas, P. 1973. Characteristics of Greek isolates of Agrobacterium tumefaciens (E.P. Smith and Townsend) Conn. J. appl. Bacteriol. 36: 233-240.

Pansegrau, W., and Lanka, E. 1991. Common sequence motifs in DNA relaxases and nick regions from a variety of DNA-transfer systems. Nucleic Acids Res. 19:3455.

Pansegrau, W., Schoumacher, W., Hohn, B., and lanka, E. 1993. Site-specific aleavage and joining of single stranded DNA by VirD2 protein of Agrobacterium tumefaciens Ti plasmid: analogy to bacterial conjugation. Proc. Natl. Acad. Sci. USA 90: 11538-11542.

Parkinson, J., and Kofoid, E. 1992. Communication modules in bacterial signaling proteins. Annu. Rev. Genet. 26:71-112.

Peralta, E., and Ream, W. 1985. T-DNA border sequences required for crown gall tumorigenesis. Proc. Natl. Acad. Sci. USA 82: 5112-5116.

Peralta, E. Hellmiss, E., and Ream, W. 1986. Overdrive, a T-DNA transmission enhancer on the Agrobacterium tumor-inducing plasmid EMBO J. 5:1137-1142.

46

Petit, A., David, C , Dahl, G., Ellis, J., and Guyon, P. 1983. Purther extention of the opine concept: plasmids in Agrobacterium rhizogenes cooperate for opine degradation. Mol. Gen. Genet. 190:204-

Petit, A., Delhaye, S., Tempe, J., and Morel, G. 1970. Recherches sur les guanidines des tissus de crown gall. Mise en evidence d'une relation biochemique specifique entre les souches d'argobacterium tumefaciens. C.R. Acad. Sci. Paris 281:467-469.

Powell, B., Rogowsky, P., and Kado, C. 1989. VirG of Agrobacterium tumefaciens plasmid pTiC58 encodes a DNA-binding protein, Mol. Microbiol, 3:411:

Powell, B., and Kado, C. 1990. Specific binding of VirG to the wr box requires a C-terminal domain and exhibits a minimum concentration threshold, Mol. Microbiol., 4: 2159:

Pu, X. A., and Goodman, R. N. 1992. Induction of necrogenesis by Agrobacterium tumefaciens on grape explants. Physiol. Mol. Plant Pathol. 41:241-254.

Puwanesarajh, V., Schell, P., Stacy, G., Douglas, C, and Nester, E. 1985. Role for 2-linked-beta-D-glucan in the virulence of Agrobacterium tumefaciens. J. Bacteriol. 164:102-106.

Ream, L., Gordon, M., and Nester, W. 1983. Multiple mutations in the T-regions of the Agrobacterium tumefaciens tumor inducing plasmid. Proc. Natl. Acad. Sci. USA 80: 1660-1664.

Rodriguez-Palenzula, P., Burr, T.J., and Collmer, P. 1991. Polygalcturonase is a virulence factor in Agrobacterium tumefaciens biovar 3. J. Bacteriol. 173: 6547-6552.

Rogowsky, P., Close, T., Chimera, J., Shaw, J., and Kado, C. 1987. regulation of the vir genes of Agrobacterium tumefaciens plasmid pTiC58. J. Bacteriol. 169:5101-5102.

Rossi, L., Holn, B., and Tinland, B. 1993. The VirD2 protein of Agrobacterium tumefaciens carries nuclear localization signals important for transfer of T DNA to plants. Mol. Gen. Gent 239:345-353.

Rossi, L., Hohn, B., and Tinland, B. 1996. Integration of complete transferred DNA units is dependent on the activity of virulence E2 protein of Agrobacterium tumefaciens. Proc. Natl. Acad. Sci. USA 93: 126-130.

47

Ruffner, H.P. 1982. Metabolism of tartaric and malic acids in Vitis. vitis 21:247-259.

Scheiffele, P., Pansegrau, W., and Lanka, E. 1995. Initiation of Agrobacterium tumefaciens T-DNA processing. Purified proteins VirDI and VirD2 catalyze site- and strand-specific cleavage of superhelical T-DNA border in vitro. J. Biol. Chem. 270:1269-1276.

Schroder, G., waffenschmidt, S., weiler, E., and Shroder, J. 1984. The T-region of the Ti plasmids codes for an enzyme synthesizing indole-3-acetic acid. Eur. J. Biochem. 138:387-391.

Sen, P., Pazour, G., Anderson, D., and Das, A. 1989. Cooperative binding of Agrobacterium tumefaciens V\rE2 protein to single-stranded DNA. J. Bacteriol. 171:2573-2580.

Sheeren-Groot, E., Rodenberg, K., Dulk-Ras, A., Turk, S., and Hooykaas, P. 1994. Mutational analysis of the transcriptional activator VirG of Agrobacterium tumefaciens. J. Bacteriol. 176:6418-6426.

Shimoda, N., Toyoda -Yamamoto, A., Nagamine, J., Usami, S., Katayama, M., Sakagami, Y., and Machida, Y. 1990. Control of expression of Agrobacterium wr-genes by synergistic actions of phenolic signal molecules and monosaccharides. Proc. Natl. Acad. Sci. USA 87: 6684 6688.

Shirasu, K., and Kado, C. 1993. Membrane localization of the Ti plasmid VirB proteins involved in the biosynthesis of pilin-like conjugative structure on Agrobacterium tumefaciens. PEMS Microbiol, let. 111:287-294.

Shirasu, K., Morel, P., and Kado, C. 1990. Characterization of the wrB operon of an Agrobacterium tumefaciens Ti plasmid nucleotide sequence and protein analysis. Mol. Microbiol. 4:1153-1163.

Shurvinton, C, Hodges, E., and Ream, W. 1992. A nuclear localization signal and the C-terminal omega sequence in the Agrobacterium tumefaciens VirD2 endonuclease are important for tumor formation. Proc. Natl. Acad. Sci. USA 89: 11837-11841.

Skoog, P., and Miller, C. 1957. Chemical regulation of growth and organ formation in plant tissue cultured in vitro. Symp. Soc. Exp. Biol. 11:118 131.

48

Smith, E., and Townsend, C. 1907. A plant-tumor of bacterial origin. Science 25:671-673.

Spanier, K., Schell, J., and Schreier, P. 1989. Afunctional analysis of T-DNA gene 6b: the fine tuning of cytokinin effects on shoot development. Mol. Gen. Genet 219:209-216.

Spudich, G., Pernandez, D., Zhou, X., and Christie. 1996. Intermolecular disulfide bonds stabilize VirB7 homodimers and VirB7/VirB9 heterodimers during biosynthesis of the Agrobacterium tumefaciens T-complex transport apparatus. Proc. Natl. Acad. Sci.USA 93: 7512-7517.

Stachel, S., and Nester, E. 1986. The genetic and transcriptional organization of the wr region of the A6 Ti plasmid of Agrobacterium tumefaciens. EMBO J. 5:1445-1454.

Stachel, S., Messens, E., Van Montagu, M., and Zambryski, P., 1985. Identification of the signal molecules produced by wounded plant cells that activate T-DNA transfer in Agrobacterium tumefaciens. Nature 318:624-629.

Stachel, S., Nester, E., and Zambryski, P. 1986a. A plant cell factor induces Agrobacterium tumefaciens vir gene expression. Proc. Natl. Acad. Sci. USA 83: 379-383.

Stachel, S., Timmerman, B., and Zambryski, P. 1986b. Generation of single stranded T-DNA molecules during the initial stages of T-DNA transfer from Agrobacterium tumefaciens fo plant cells. Nature 322:706-712.

Stephens, K., Roush, C, and Nester, E. 1995. Agrobacterium tumefaciens VirB11 protein requires a consensus nucleotide-binding site for function in virulence. J. Bacteriol. 177:27-36.

Strover, E. W., Swatz, H., J., and Burr, T., J. 1997. Agrobacterium wY/s-lnduced electrolyte leakage in crown gall susceptible and resistant grape gentoypes. Am.J. Enol. Vitic, 2: 145-149.

Sule, S. 1978. Biotypes of Agrobacterium tumefaciens in Hungary. J. Appl. Bact. 44:207-213

Sundberg, C , Meek, L., Carroll, K., Das, A., and Ream, W. 1996. VirEI protein mediates export of the single-stranded DNA-binding protein VirE2 from Agrobacterium tumefaciens into plant cells. J. Bacteriol. 178:1207-1212.

49

Surico, G., Comal, L., and Kosuge T. 1984.Pathogenicity of strains of Pseudomonas syringae pv. savastanoi and their indoleacetic acid deficient mutants on olive and oleander. Phytopathology 74:490-493.

Suseelan. K., Bhagwat, A., Mathews, H., Bhatia, C, 1987. Agrobacterium tumefcaiens induces tumor formation on some tropical dicot and monocot plants. Curr. Sci. 56: 888-889.

Szegedi, E., Otten, L., and Czako, M. 1992. Diverse types of tartrate plasmids in Agrobacterium tumefaciens biotype III strains. Mol. Plant-Microbe Interact. 5:435-438.

Szegedi, E. 1985. Host range and specific L(+) tartrate-utilization of biotype 3 of Agrobacterium tumefaciens. Acta Phytopatholol. Acad. Sci. Hung. 20:17-22.

Tarbah, P., and Goodman, R. 1986. Rapid detection of Agrobacterium tumefaciens in grapevine propagating material and the basis for an efficient indexing system. Plant Dis. 75:634-637.

Taya, Y., Tanaka, Y., and Nishimura, S. 1978. 5'-AMP is a direct precursor of cytokinin in Dictystedium discoideum. Nature 271:545-547.

Tempe, J., and Goldmon, A. 1982. "Occurrence and biosynthesis of opines." in Molecular Biology of Plant Tumor (ed) G. Khal and Schell. 1982. New Work: Academic Press.

Thomashow, M., Nutter, R., Montoya, A., Gordon, M., and Nester, E. 1980. Integration and organization of Ti plasmid sequences in grown gall tumors. Cell 19: 729-733.

Thomashow. L., Reeves, S., and Thomashow, M. 1984. Crown gall oncogenesis: Evidence that a T-DNA gene from the Agrobacterium Ti plasmid pTiA6 encodes an enzyme that catalyzes synthesis of indoleacetic acid. Proc. Natl. Acad. Sci. USA 81:5071-5075.

Thomashow, M., Hugly. S., Buchholz, W., and Thomashow, L. 1986. Molecular basis for the auxin-independent phenotype of crown gall tumor tissue. Science 231-616-618.

Thomashow, M., Karlinsey, J., Marks, J., and Hurlbert, R. 1987. Identification of a new virulence locus in Agrobacterium tumefaciens that affects polysaccharide composition and plant cell attachment. J. Bacteriol 169:3209-3216.

50

Thompson, D., Melchers, L., Idler, K., Schilperoort, A., and Hooykaas, P. 1988. Analysis of the complete nucleotide sequence of the Agrobacterium tumefaciens virB operon. Nucleic Acids Res. 16:4621-4636.

Thorstenson, Y., and Zambryski, P. 1994. The essential virulence protein VirB8 localizes to the inner membrane of Agrobacterium tumefaciens J Bacteriol. 176:1711-1717.

Thorstenson, Y., Kuldau, G., and Zambryski, P. 1993. Subcellular localization of seven wrB proteins of Agrobacterium tumefaciens: implications for the formation of a T-DNA transport structure. J. Bacteriol. 175: 5233-5244.

Tinland, B., Huss, B., Paulus, P., Bonnard, G., and Otten, L. 1989. Agrobacterium tumefaciens 6b genes are strain-specific and affect the activity of auxin as well as cytokinin genes. Mol. Gen. Genet 219:217-224.

Tinland, B., Rohfritsh, O., Michler, P., and Otten, L. 1990. Agrobacterium tumefaciens T-DNA gene 6b stimulates rol-induced root formation, permits growth at high concentrations and increases root size. Mol. Gen. Genet 223:1-10.

Tinland, B., Schoumacher, P., Gloeckler, V , Bravo-Angel, A., and Hohn, B. 1995. the Agrobacterium tumefacins virulence D2 protein is responsible for precise integration of T-DNA into the plant genome. EMBO J. 14, 3585 3595.

Toro, N., Datta, A., Carmi, O., Young, C, PrustI, R., and Nester, E. 1989. The Agrobacterium tumefaciens VirCI gene product binds to overdrive, a T DNA transfer enhancer. J. Bacteriol. 171:6845-6849.

Toumy, J. 1900. An inquiry into the cause and nature of crown gall. Arizona Ag. Exp. Sta. Bui. 33:3-64.

Van larebeke, N., Engler, G., Holsters, M., Van den Elsacker, S., Zaenen, I., Schilperoort, R., and Schell, J. 1974. Large plasmid in Agrobacterium tumefaciens essential for crown gall inducing activity. Nature 252:169-170.

Van Onckelen, H., Prinsen, E., Inze, D., Rudelshein, P., Van Lijsebettens, M., Pollin, A., Schell, J., Van Montagu, M., and De Greef, J. 1986. Agrobacterium T-DNA gene codes for tryptophan 2-monooxygenase activity in tobacco crown gall cells. PEBS Lett. 198:357-360.

51

Veluthambi, K., Ream, W., and Gelvin, S. 1988. Virulence genes, borders and overdrive generate single-stranded T-DNA molecules from the A6 Ti plasmid of Agrobacterium tumefaciens. J. Bacteriol. 170:1523-1532.

Vogel, A., and Das, A. 1992. Mutational analysis of Agrobacterium tumefaciens virD2: tyrosine 29 is essential for endonuclease activity. J. Bacteriol 174:303-308.

Vogel, A., and Das, A. 1994. Mutational analysis of Agrobacterium tumefaciens pTiA6 virD1: identification of functionally important residues. Mol. Microbiol. 12:811-817.

Wang, K., Herrera-Estrella, A., and Van Montagu, M. et al. 1990. Overexpression of virD1 and wrD2 genes in Agrobacterium tumefaciens enhances T complex formation and plant transformation. J. Bacteriol. 172:4432-4440.

Wang, K., Herrera - Estrella, A., Van Montagu, M., and Zambryski, P. 1984. Right 25 terminus sequence of the nopaline T-DNA is essential for and determines direction of DNA transfer from Agrobacterium to plant genome. Cell 38:455-462.

Watson, B., Currier, T., Gordon, M., Chilton, M., and Nester, E. 1975. Plasmid required for virulence of Agrobacterium tumefaciens. J. Bacteriol. 123:255-264.

Weisburg, W., Woese, C, Dobson, M., and Weiss, E. 1985. A common origin of rickettsiae and certain plant pathogens. Science 230:556-558.

White, P., and Braun, A. 1941. Grown gall production by bacteria-free tumor tissue. Science 94:239-241.

Willmitzer, L., Sanchez-Serrano, J., Bushchfeld, E., and Schell, J., 1982. DNA form Agrobacterium rhizogens is transferred to and expressed in axenic hairy root plant tissues. Mol. Gen. Genet. 186:16-22.

Willmitzer, L., Dhaese, P., Schreier, P., Schmalenbach, W., Van Montagu, M., and Schell, J. 1983. Size, location, and polarity of T-DNA encoded transcripts in nopaline crown gall tumors; common transcripts in octopine and nopaline tumors. Cell 32: 1045-1056.

Winans, S., Allenza, P., Stachel, E., McBride, K., and Nester, E. 1987. Characterization of the virE operon of the Agrobacterium tumefcaiens Ti plasmid pTIA6. Nucleic Acids. Res. 15:825-838.

52

Winans, S., Kerstetter, R., and Nester, E. 1988. Transcriptional regulation of the wrA and wrG genes of Agrobacterium tumefaciens. J. Bacteriol. 170:4047 4054.

Winans, S., Kerstetter, R., Ward, J., and Nester, E. 1989. A protein required for transcriptional regulation of Agrobacterium virulence genes spans the cytoplasmic membrane. J. Bacteriol. 171:1616-1622.

Winans, S., Mantis, N., Chen, C, Chang, C, and Han, D. 1994. Host recognition by the VirA, VirG two component regulatory proteins of Agrobacterium tumefaciens. Res. In Microbiol. 145:461-473.

Yadav, N., Postle, K., Saiki, R., Thomashow, M., and Chilton M. 1980. T-DNA of a crown gall teratoma is covalently joined to host plant DNA. Nature 287: 458-461.

Yadav, N., Vanderleyden, J., Bennett, D., Barnes, W., and Chilton, M. 1982. Short direct repeats flanks the T-DNA on a nopaline Ti plasmid. Proc. Natl. Acad. Sci. USA 79: 6322-6326.

Yamada, T., Palm, C, Brooks, B. and Kosuge, T. 1985. Nucleotide sequences of Pseudomonas savastanoi indole acetic acid genes show homology with Agrobacterium tumefaciens T-DHA. Proc.Natl. Acad. Sci. USA 82:6522-6526.

Yanofsky, M., Porter, S., Young, C, Albright, L., Gordon, M., and Nester, E. 1986. The wrD operon of Agrobacterium tumefaciens encodes a site specific endonuclease. Cell 47:471-477.

Yanofsky, M., Montoya, A., Knauf, V., Lowe, B., Gordon M.P., and Nester, E.W. 1985a. Limited-host-range plasmid of Agrobacterium tumefaciens: Molecular genetic analyses of transferred DNA. J. Bacteriol. 163:341-348.

Yanofsky, M., Lowe, B., Montoya, A., Rubin, R., Krul, W., Gordon, M., and Nester, E. W. 1985b. Molecular and genetic analysis of factors controlling host range in Agrobacterium tumefaciens. Mol. Gen. Genet. 201:237-246.

Young. S., and Citovsky, V. 1991. Phylogeny of the phototrophic Rhizobium strain BTAil by polymerase chain reaction-based sequencing of a 16S rRNA gene segment. J.Bacteriol. 173:2271-2277.

Zaenen, I., Van Larebeke, N., Teuchy, H., Van Montagu, M., and Schell, J. 1974. Supercoiled circular DNA in crown gall inducing Agrobacterium strains. J. Mol. Biol. 86: 109-127.

53

Zambryski, P. 1992. Chronicles from the Agrobacterium-plant cell DNA transfer story. Annu. Rev. Plant Physiol. Plant Mol. Biol. 43, 465-490.

Zupan, J., and Zambryski, P. 1995. Transfer of T-DNA from Agrobacterium to the plant cell. Plant Physiol. 107, 1041-1047.

Zupan, J., Citovsky, V., and Zambryski, P. 1996. Agrobacterium VirE2 protein mediates nuclear uptake of ssDNA in plant cells. Proc. Natl. Acad. Sci. USA 93:2392-2397.

54

CHAPTER II

BIOCHEMICAL AND MOLECULAR CHARACTERIZATION OP

AGROBACTERIUM VITIS STRAINS COLLECTED

NEAR LUBBOCK, TEXAS

2.1 Introduction

Agrobacterium vitis (Ophel and Kerr, 1990), formerly called Agrobacterium

tumefaciens biotype III (Kerr and Panagopoulous, 1977), is strongly associated

with grapevine (Burr et al., 1987; Burr and Katz, 1983; Sawada et al., 1990).

Agrobacterium vitis is the primary agent that causes crown gall in grape (Burr,

1988). Its ability to survive systemically in healthy grapevines (Burr and Katz,

1984; Tarbah and Goodman, 1986) makes it a very successful pathogen. It has

been reported that in the U.S. a large portion of grapevine nursery stock is

systemically infected with A. vitis (Goodman et al., 1987). Burr et al. (1995)

reported that A. vitis could survive in decaying grape roots and canes in soil.

This explains the significant damage caused by A. vitis to the grape industry

around the world.

In addition to crown gall disease, A. vitis induces electrolyte leakage and

strong necrotic lisons on the roots of grapevine (Strover et al., 1997; Burr et al.,

1988). This is because A. vitis produces extracellular enzymes

polygalacturonase (PG) and endoglucanase that degrade root epidermal tissue

(Rodriguez-Palenzula et al., 1991; Ophel and Kerr, 1990). Certain A. vitis strains

55

induce only a necrotic response in grape stems (Yanofsky et al., 1985a, 1985b;

Pu and Godman, 1992). This response is not related to the PG enzyme but to

the sensitivity of grapevine to high levels of auxin.

Agrobacterium vitis is distinguished from biotype I and biotype II based on

several chromosomally encoded factors (Kerr and Panagopoulos, 1977). This

includes the production of 3-ketolactose, ability to grow in 2% NaCI, growth at

35°C, acid production from sucrose, erythritol and melezitose, alkali production

from malonic acid, tartaric acid, propionic acid and mucic acid, growth on ferric

ammonium citrate and citrate utilization. One of the unique property of A. vitis is

tartrate utilization, which is preferred even over glucose (Szegedi, 1985).

A. vitis has been divided into four main subgroups: nopaline (N),

octopine/cucumopine (0/C) with small or large TA region (OS and OL plasmids)

and vitopine (V) (Paulus et al., 1989a). The o/c group accounts for half of the

isolated strains (Otten and Ruffray, 1994). Mapping analysis of several Ti

plasmids from the o/c group showed that virulence and T-DNA regions were

highly conserved (Knauf et al., 1984; Otten et al., 1992; Van Nuenen et al., 1993;

Pournier et al., 1994). Otten and Ruffray (1994) compared the Ti plasmid from A.

vitis nopaline strain AB4 to other Ti plasmids and found that the pTiAB4 iaaM,

iaaH and ipt regions were strongly homologous to pTi15955/pToAch5 (93.7%)

and pTiTM4 (94.7%). In an extensive review, Otten et al. (1992) reported that

iaaM and iaaH of octopine, O/C, N, and succinamopine Ti plasmids were highly

homologous. In the same review, they also reported that structure and function

56

of Ti plasmids from different Agrobacterium strains were highly conserved.

Although in certain cases the overall structure of different TI plasmids was only

30% (Engler et al., 1981), a detailed analysis showed that highly homologous

regions (80-85% conservation) were embedded in non-homologous sequences.

(Otten et al., 1992). This observation led to the hypothesis that Ti plasmids are

mosaic structures, constructed by horizontal gene transfer (Otten et al., 1992). In

general, the oncogenes of the T-DNA from different Ti plasmids are well

conserved in structure as well as in function ( Engler et al., 1981; Garfinkel et al.,

1981; Ooms etal., 1981; Leemans etal., 1982; Willmitzer etal., 1982,1983; Joos

et al., 1983; Binns and Thomashow, 1988).

The main objectives of this study were to isolate the predominant strains

of A. vitis associated with vineyards near Lubbock, TX, to characterize the

isolates using biochemical and molecular tests and to determine their host range

and tumorgenesis ability.

57

2.2 Materials and Methods

2.2.1 Isolation of A. vitis. bacteria

Grapevine galls were collected from several vineyards located in six

different counties. Agrobacterium isolates, host cultivar and locations are listed

in Appendix III. The gall tissue surface was sterilized for 20 minutes in 20%

bleach solution and rinsed three times in sterile water. After removing the dark

brown dead tissue, the gall was cut into three to five pieces of approximately two

cm^ and placed in 5 ml of distilled sterile water for 45 minutes to allow bacteria to

diffuse into the water. To isolate and determine the predominant strains, 1 ml of

the liquid was plated on three different solid media and incubated for 3 days at

28 °C. Medium 1A selects for Agrobacterium tumefaciens biotype I, medium 2E

selects for Agrobacterium tumefaciens biotype II (Brisbane and Kerr, 1983) and

Roy-Sasser medium selects for Agrobacterium vitis (Roy and Sasser, 1983).

The other 2 ml were plated on D-1 media (Kado and Heskett, 1970). D-1 media

was used to differentiate Agrobacterium from other Gram negative bacteria.

Colonies grown on D-1 were then replica plated on 1A, 2E and Roy-Sasser

media. Protocols of selective media are listed on Appendix I. Strains resembling

A. vitis were then streaked on YEB medium and examined for purity.

2.2.2 Biochemical characterization

Eighteen purified isolates were given a designation (Table 2.1), and two

previously characterized Agrobacterium isolates (ATCC 49767, A. vitis ; ATCC

58

15955, A. tumefaciens) were used as internal controls. This study included ten

A. vitis isolates with a broad genetic make-up obtained form Dr. Tomas J. Burr at

Cornell University. Purified isolates were subjected to the following determinative

biochemical assays according to Moore et al., (1988): 3-Ketolactose production;

growth in 2% NaCI; acid production from sucrose, erythritol and melezitose; alkali

production from malonic acid, L-tartaric acid, proponic acid and mucic acid;

citrate and ferric ammonium citrate utilization. Strains were grown on YEB liquid

media (Tarbah and Goodman, 1986) for 48 hours at 28 °C. Cultures were diluted

100-fold to get approximately 10^ CPU and 100 |al were used for each assay.

Agrobacterium strains were also screened for octopine and nopaline utilization.

Octopine and nopaline are the most common opines and are commercially

available. A 100 il bacterial culture was streaked on a basal medium containing

5 mM filter-sterilized opine. The controls were grown on the same basal medium

with 5 mM glucose and 5 mM ammonium sulfate. Protocols of biochemical tests

are listed on Appendix B.

2.2.3 Pathooenicitv assay

Seeds of tomato (Lycopersicon esculentum, 'Better Boy Hybrid'),

sunflower (Helianthus annus, 'Sunshine') and tobacco (Nicotina tabacum,

'rustica') plants were germinated in one 2 L pots and grown in the greenhouse.

Six weeks later, stems were wounded with a sterile needle and freshly cultured

Agrobacterium strains were applied to the plant wound. Grapevine (Vitis vinifera,

59

'Sauvignian Blanch') dormant canes were rooted and grown six weeks in the

greenhouse. Green, tender stems were wounded and inoculated as with other

hosts. Tumor formation and morphology was assessed three weeks after the

inoculation. This experiment were repeated three time to reduce any

environmental effects on tumor formation.

2.2.4 Molecular characterization

2.2.4.1 Isolation of Total DNA

Total DNA was isolated from ail Agrobacterium isolates using a modified

procedure of Slusarenko (1990). A volume of 3 ml of YEB medium was

inoculated and grown for 48 hours at 28 °C. Bacteria from a volume of 1.5 ml

were pelleted by centrifugation for 3 min at 4000 xg. The bacteria were then

suspended in 300 ^1 of TE buffer (10 mM, 1.0 mM EDTA), 100 |al of 5% sarkosyl

in TE buffer, and 150 [i\ of Pronase solution (4.0 mg/ml Pronase in TE buffer,

predigested for 30 min at 37 °C). The tubes were incubated at 37 °C for 1 hr.

After complete lysis, the samples were passed through a #20 gauge needle and

centrifuged at 13,000 xg for 30 min. The supernatant was placed into clean

tubes and 0.5 volume of 7.5 M ammonium acetate was added. Tubes were then

placed on ice for 30 min and centrifuged for 30 min at 13,000 xg. The

supernatant was mixed with an equal volume of isopropanol and placed on ice

for 30 min. The DNA pellet was collected by centrifugation at 13,000 xg for 15

60

min, rinsed with 70 % ethanol and vacuum-dried. The pellet was resuspended in

50 \i\ of water. Total DNA was digested by incubating 10 [ig of DNA in 1 X

restriction reaction overnight at 37 °C. The digested DNA was separated using a

1% agarose gel.

2.2.4.2 Isolation of Ti plasmid

The TI plasmid was isolated and purified according to Kuang-Hua (1993).

Ten ml of overnight culture were centrifuged for 5 min at 11,000 xg at 4 °C.

pellets were resuspended in 1 ml of TE buffer, 100 \i\ of 5M NaCI and 20 |il of

10% Na sarkosyl, and equally transferred into two clean 1.5-ml tubes. The tubes

were then centrifuged at 13,000 xg for 2 min, and the pellets were resuspended

in 100 [i\ of solution I (50 mM glucose, 25 mM Tris-HCL pH 8.0, 10 mM EDTA pH

8.0 and 2 mg/ml lysozyme). The preparations were incubated for 10 min on ice,

200 III of Solution II (0.2N NaoH, 1% SDS) were added, and the tubes were then

incubated at 37 °C for 30-60 min. After complete lysis, 50 |al of 2 M Tris-Hcl (pH

7.0) were added and gently mixed. The solution was incubated at room

temperature for 30 min, after which 100 1 of 5 M NaCI were added. Samples

were then extracted twice with phenol/chloroform/isoamyl alcohol (25:24:1). The

supernatant was transferred into a clean, 1.5-ml tube and an equal volume of

isopropanol was added to precipitate the nucleic acid. Pellets were collected by

centrifugation for 15 min at 13,000 xg and rinsed with 70% ethanol. The dry

61

pellets were resuspended in 50 |il of solution I, 85 1 of sterile water and 5 |al of 2

M Tris-HCI (pH 7.0). Tubes were incubated at 50 °C for 5 min to dissolve the

pellet, 10 pi of 2 M NaOH were added, and the preparation was incubated at

room temperature for 5 min. To renature the plasmid DNA, 75 il of ice-cold

solution III [(5M KOAc (60 ml), acetic acid (11.5 ml) and water (28.5 ml))] were

added to samples and incubated on ice for 5 min. Next, 20 |il of 1% EtBr were

added and incubated on ice for 30 min. Tubes were centrifuged for 5 min at

13,000 xg. The plasmid DNA remained in the supernatant, and EtBr was

removed by two phenol extractions and one chloroform extraction. DNA was

precipitated with isoprpanol and washed with ethanol. Plasmids were collected

by centrifugation, the pellets were vacuum-dried and the pellets were

resuspended in 20 pi of TE buffer.

2.2.4.3 Homology study

Ten micrograms of purified total DNA per sample was resuspended in 10

ml of distilled deionized water. Ten units of the appropriate restriction enzyme

(EcoR I, BamH I and Hind III) were added to each sample with the appropriate

buffer supplied by the manufacturer. The DNA was digested overnight at 37 °C.

The digested DNA was loaded onto a 1.0% agarose gel containing 0.5 |ag/ml

EtBr. Electrophoresis was performed at 50 volts for about four hours in TBE

buffer (100 mM Tris borate, 2 mM EDTA, pH 8.3).

62

Restricted DNA fragments in the agarose gel were depurinated in 250 mM

HCI, neutralized in 500 mM NaOH and 400 mM NaCI, and transferred to a nylon

membrane using a vacuum blotting system. After transfer, the membranes were

washed with 2X SSC buffer (pH 7.0), air dried, wrapped in Saran wrap and

stored at 4 °C. Prehybridization was carried out for 24 hours in a solution

containing 6X SSPE, 5X Denhardt's solution (0.02% Picoll, 0.02%

polyvinylpyrolidine, 0.02% bovine serum albumin), 0.5% SDS, and 35%

formamide.

2.2.4.4 PCR analysis

To further investigate the relationship among the Agrobacterium isolates,

two sets of primers were used, primers specific to the 6a gene of A. tumefaciens

biotype I and primers specific to the chromosomally located pheA gene of all A.

vitis. The 6a primers (ACATCATCAATCCTGGCGG) and

(ACTCGTTGCTGGCCTGAAT) were used to amplify a region of approximately

260 bp unique to A. tumefaciens biotype 1 (Eastwell et al., 1995). The pheA

primers (CGATGGCGGCGAGGATTT) and (ATCGGGCGTGAAACAAGT) were

used to amplify a region of 199 bp from the pheA gene unique to A. vitis. Each

50 pi of PCR reaction contained 100 pmole of each opposing primer; 1 ig of

template genomic or plasmid DNA; 5 1 of 10X Taq buffer containing 500 mM

KCI, 100 mM Tris-HCI (pH 9.0 at 25 °C), and 1% Triton X-100; 4 mM of MgCb;

63

1.5 mM of each of 4 dNTP's; and 2.5 U of Taq polymerase (Promega). A volume

of 150 pi of mineral oil was layered on the top of the sample to prevent

evaporation during the PCR cycles. The PCR amplification were performed with

an initial incubation at 96 °C followed by 35 cycles as follows: denaturation (95

°C, 1 min), annealing ( 50 °C, 30 sec), and extention ( 72 °C, 5 min). At the

completion of the final cycle, the reactions were held at 72 °C for 5 min followed

by cooling to 19 °C.

2.3 Results and Discussion

2.3.1 Isolation and biochemical characterization of A. vitis.

Table 2.1 shows strains of Agrobacterium used in this study. Included

were 18 isolates collected locally designated by LT, ten strains with diverse

genetic make up (obtained from Dr. Thomas J. Burr, Cornell University) and two

previously characterized strains from the American Type Culture Collection,

ATCC 49767 and ATCC 15955, as internal controls. Out of the twenty-three

different galls collected, eighteen A. vitis strains were isolated. No

Agrobacterium strains were detected in galls from cultivar "Chardonnay"

collected from Bill Brown and Morris's vineyards (Appendix C). The simplest

explanation of this observation is that Agrobacterium strains may not be able to

ovenA/inter or survive systemically in the cultivar "Chardonnay" under specific

conditions. Gillings and Ophel-Keller, (1995) indexed grapevine cuttings from

different geographical areas and found that the levels of Agrobacterium vitis

64

varied between locations and cultivars. These results suggest that the

distribution of Agrobacterium population is affected by the interaction between

environment and host genotype. The levels of infestation also varied between

hosts. The genotype Sauvignian Blanc was the most frequently infected by A.

vitis. The level of infestation is estimated by the number of bacterial colonies

collected from the gall tissue. Sauvignian Blanc had three to five times more

colonies of A. vitis than other lines. This indicate that this line is more sensitive

and that propagated material from Sauvignian Blanc should be carefully indexed

to avoid the propagation of the bacterium to new vineyards. The level of

infestation of A. vitis is very important factors in tumorgenesis. Many techniques

used to reduce A. vitis damage to grape are effective only in reducing the level of

the bacteria rather than eradicating the pathogen (Burr et al., 1996).

The selective media and replica plating showed that all isolates were able

to grow only on Roy-Sasser media, which is selective for A. vitis. No other

Agrobacterium biotype was detected, indicating that the predominant strain

associated with grapevine was A. vitis. This observation was documented in

previous reports (Bien et al., 1990; Sawada et al., 1990). The strong and specific

association between A. vitis and grapevine is attributed to A. vitis' ability to use

tartrate as a carbon source (Szegedi, 1985) and the ability to induce necrosis in

grapevine roots due to the presence of a polygalacturonase gene pheA (McGuire

et al. 1991). It was found that PheA protein is accumulated mainly in the

periplasm of the bacterium and it is able to produce dimers, trimers and

65

monomers from polygalacturonic acid (Herlache et al., 1997). Such compounds

are probably used to stimulate the virulence system of A. vitis, since galacturonic

acid has been reported to enhance wrgene expression (Ankenbauer and Nester,

1990).

Purified strains were subjected to several determinative biochemical tests

listed in Table 2.2. Although all isolates were able to grow on Roy-Sasser media,

metabolized tartrate and tolerated 2% NaCI, there was a significant variability

based on other tests (Table 2.2). Two groups can be identified based on these

tests. The first group contains LT1-LT6, LT11, LT13, LT15, and LT17. This

group tended to share some biochemical characteristics with Agrobacterium

tumefaciens biotype I, such as 3-ketolactose production and acid production from

sucrose, erythritol and melizitose. The second group contains LT7-LT10, LT12,

LT14, LT16 and LT18. Group II had similar biochemical responses to A. vitis in

most assays. It was interesting to note that all isolates were able to grow and

produce pigment in ferric ammonium citrate, considered unique for

Agrobacterium tumefaciens biotype I (Moore et al., 1988). Similar variation was

also seen among the A. vitis strains previously characterized (CG series, see

Table 2.2). This variability suggests that the population structure of Lubbock

isolates may consist of at least two clonal lines. The original clonal strains may

not be locally evolved but rather introduced into the area with the original

propagating materials. The systemic survival of A. vitis in the plant host is well

established (Burr and Katz, 1984) and its persistence in surviving in decaying

66

grape and cane tissue for a long period of time provide a successful mean for

spreading (Burr et al., 1995).

The diagnostic tests are performed on chromosomally encoded genes that

are supposedly much more stable than plasmid-encoded factors, because they

are not subjected to horizontal gene exchange. However, in this study we have

seen that a significant variation exists among various strains in terms of

chromosomally encoded genes. Other studies have demonstrated that the

A. vitis chromosome and Rhizobium strains have a high degree of polymorphism

(Otten et al., 1992; Martinez et al., 1990). In a very informative study, Schuiz et

al. (1993) studied 42 A. vitis strains, using genomic fingerprinting and IS

elements, and identified six genomic groups with homologous restriction

patterns. They also noted that for every genomic group, a distinct IS elements

pattern was found. Since IS elements played a major and an important role in Ti

plasmid and Rhizobium chromosome diversity (Paulus et al., 1989b, Martinez et

al., 1990; Otten et al., 1992) one can speculate that similar events may be

associated with the Agrobacterium chromosome. Therefore, the assumption that

the bacterial chromosome is relatively more stable than plasmid may not be true

in all cases.

Screening for opine utilization revealed two groups. The first group

contained 15 out of the 18 isolates, and all were able to use octopine. However,

within this group, strains LT7, LT12 and LT9 were able to grow on octopine and

67

nopaline solid media but not on nopaline liquid media. This suggests that they

are probably true octopine types. All previously isolated octopine strains of A.

vitis were also cucumopine type (Pournier et al., 1994; Otten et al., 1992; Paulus

et al., 1989a). Therefore, group I can be classified as octopine/cucumopine (o/c).

It was not surprising that most of isolates in this study were o/c, since

approximately half of A. vitis isolated world-wide are o/c (Otten and Ruffray, 1994;

Van Nuenen et al., 1993). The second group contained LT3, LT10 and LT16 that

were unable to use either octopine or nopaline, indicating that these strains may

belong to vitopine group. It is important to note that o/c strains have been

divided into wide-host-range (WHR) that induce tumors on tobacco and tomato,

and limited-host-range (LHR) that are only virulent on grape (Paulus et al. 1989b,

Knauf et al.,1982). Actually the evolution and the predominance of this group

has been linked to the development of viticulture during last two centuries (Otten

et al., 1992). The pathogenicity test showed that all o/c strains isolated around

Lubbock were LHR (Section 2.3.3). This is additional evidence of the clonal

origin of Lubbock isolates.

2.3.3 Pathogenicity test

Agrobacterium isolates were tested for virulence on tomato, sunflower,

tobacco and grape plants. Strains were considered virulent only if they were able

to induce a tumor with an equal or greater diameter than the infected stem. This

was important to define, since sometimes a hypersensitive response or stem

68

swelling tends to look similar to the gall tissue. As was expected, the bacterial

strain with the broadest host range was the A. tumefaciens ATCC15955.

Because ali of the other strains were originally isolated from grape, those virulent

on other hosts were identified as WHR strains.

Local isolates were LHR being virulent only on grape, with the exception

of LT12 which was also virulent on tobacco (Table 2.3). The other grapevine

isolates (CG series) had different host ranges, with most of them virulent on

tomato, tobacco and grape. The LHR character of the local strains can be

attributed to the fact that all had o/c Ti plasmids and also that their sites of

isolation were geographically limited. Contrary to this, the CG strains had

diverse Ti plasmids and were isolated from a broader geographical area (Table

2.1 and Table 2.3). Although LHR and WHR o/c strains differ in their host range,

at the molecular level they share extensive DNA homology (Knauf et al., 1983).

It was reported that most A. vitis LHR strains have a deletion or a major

rearrangement on the cytokinin biosynthesis gene (ipt) which renders it inactive

(Hooykass and Schilperoort, 1992).

The morphology of the tumor tissue differs from strain to strain (Fig.2.1 to

Fig.2.8). For example, A. tumefaciens ATCC15955 was super-virulent on tomato

in terms of rate of appearance and larger size but less virulent on grape, inducing

small galls. Sunflower was highly resistant to all the Agrobacterium strains,

except for A. tumefaciens ATCC15955 and several A. vitis that caused a

69

hypersensitive response. Such a response is probably due to the ability of A.

vitis to produce polygalacturonase and endoglucanase that degrade epidermal

tissue (Rodriguez-Palenzula et al., 1991; Ophel and Kerr, 1990). Two super-

virulent strains on grape were identified, namely CG475 and LT9. Both strains

were o/c, highly virulent, and induced tumor formation faster than any other

bacterium (within two weeks of infection) (Pig.2.4), but most interestingly, the site

of isolation of both strains was relatively close. The LT9 was isolated from

Lubbock, TX and CG475 from New Mexico.

The fact that the same bacterium caused different responses on

different hosts suggests the involvement of plant factors in the process of

pathogenicity. The assumption that tumor formation is solely dictated by

the bacterium may not be true. It is rather a product of the Interaction

between plant and bacterial factors that determine the degree of virulence

and the morphology of the tumor. One way the plant interacts with the

bacteria is at the level of T-DNA integration and its expression. All

oncogenes located within the T-DNA have eukaryotic regulatory elements;

therefore, their expression requires plant transcription factors. The plant

may exploit this characteristic to restrain or inhibit tumor formation and

hence reduce the host range. This may be why Agrobacterium is unable

to infect most monocot plants. Grimsley et al. (1987) inoculated maize

seedlings with T-DNA carrying the maize streak virus genome and found

70

that most seedlings developed viral symptoms. Another experiment

showed that the limitation to transform maize is due to insufficient T-DNA

integration and/or expression of T-DNA genes (Narasimhulu et al., 1996).

The host plant can also affect the genetic make-up of the Inciting bacteria.

Belanger et al. (1995) reported that five different A. tumefaciens strains

originally isolated from apple tumors yielded 99% nonpathogenic mutants

after their reintroduction Into axenic apple plants. Such rearrangement on

the bacterial genome can be expected more frequently in

octopine/cucumopine A. vitis strains since, their Ti plasmid is highly

unstable due to the presence of an unusual duplication of a 2.3-kb DNA

fragment (Pournier et al., 1994). All of this evidence shows that the host

plant plays an important role in determining the host range of

Agrobacterium.

2.2.4. Molecular characterization of A. vitis

To make sure that all isolates harbor the pathogenic Ti plasmid, total DNA

was extracted and plasmids were visualized. All isolates contained large

plasmid (Pig. 2.5). The plasmid Intensity varied among strains but the size was

very similar except for LT9 and LT12 that had relatively larger-sized plasmids.

This may explain some of the uniqueness of the two strains. Unlike all other

local strains, LT9 was highly virulent on grape and LT12 was the only strain to

71

cause tumors on tobacco. The sizes of the Ti plasmids were equal or greater

than 120 kb, since the molecular weight of Til 5955 is known to be approximately

120 kb(Daniela etal., 1978).

The first objective of this study was to assess the relationship between

various isolates using genetic markers from the Ti plasmid and from the bacterial

chromosome. Throughout their evolution, A. vitis evidently experienced

significant rearrangements in their Ti plasmid. One event was the deletion of the

6a gene present in A. tumefaciens biotype I (Pournier et al., 1994). As was

expected, the primers specific for the 6a gene unique to A. tumefaciens amplified

a single and intense band with DNA from Til 5955 (Pig. 2.8). The size of the

band was consistent with the predicted fragment of 260 bp. However, when the

same primers were used with Ti plasmid DNA from all A. vitis strains, no

amplification was achieved. This clearly shows that the locally isolated strains

were true A. vitis, although some were similar to A. tumefaciens biotype I based

on a few biochemical tests. When primers specific for the pheA gene were used

with total DNA as template, multiple bands were amplified. The predicted band

of 199 bp was very difficult to assess, since the amplification of the band was not

reproducible. The pheA gene is a chromosomally located gene specific to A.

vitis. It encodes polygalacturonase, which is a pectic enzyme that induces root

decay. In this study, we were not able to use this gene as a marker using

polymerase chain reaction (PCR). This is probably due either to the lack of

72

appropriate conditions for the PCR or the significant genetic variation of the

bacterial chromosome.

The second objective was to assess the level of homology of the

oncogenic T-DNA region between A. vitis isolates using T-DNA probes pGV0153

and pGV201 (De Vos et al., 1981). These two probes are clones from the broad

host range Agrobacterium tumefaciens Ach5, a biotype I strain. Both pGV153

and pGV201 were used extensively to study DNA homology between virulent

strains of Agrobacterium. According to Paulus et al. (1989a), pGV153 will

hybridize with DNA from strains having a significant DNA sequence homology to

both T-DNA A region (TA) and T-DNA B region (TB) tryptophan monooxygenase

(iaaM) and indoleacetamide hydrolase (iaaH) genes, while pGV201 will hybridize

if the homology is significant at isopentenyladenosine phosphotransferase (ipt),

6b and cos genes.

Southern hybridization using the pGV0153 probe shows that all isolates

were homologous in TB and TA iaa genes (Fig. 2.7). This was expected since all

isolates were assumed to be virulent due to their presence in crown gall tissue

and detection of a large Ti plasmid. Hybridization using pGV201 revealed that all

isolates share a significant homology at the ipt, 6b and cos region with exception

of LT4, LT6 and LT17, indicating a major rearrangement at this region. This did

not result in loss of virulence as demonstrated before. Actually, the ipt gene is

not required by A. vitis strains for virulence (Bonnard et al., 1989), but it is

73

necessary to broaden the host range. This was demonstrated by introducing an

intact ipt gene from a WHR into a LHR strain, which expanded the host range

(Yanofsky, 1985b). The other genes 6b and cos are not known to play a role in

tumor formation, and that may explain why strains LT4, LT6 and LT17 remain

pathogenic. Purther analysis with pGV201 using three different restriction

enzymes (Eco Rl, Bam H I and Hind III) showed very low polymorphism in the

phytohormone genes among isolates. This indicates that A. vitis strains are

highly conserved at this region. In extensive studies, Otten and co-workers

demonstrated that the iaaM and iaaH genes of octopine, octopine/cucumopine,

nopaline and succinamopine Ti plasmids are strongly homologous (Otten et al.,

1992; Van Nuenen et al., 1993; Pournier et al.,1994). They also surveyed the

T-DNA region of five subclasses of o/c Ti plasmids and found that the existing

differences are predominantly due to insertion elements (IS), and that DNA

sequences outside the IS elements are more than 99.7% identical (Otten et al.

1992). Even phytohormone genes from A. tumefaciens biotype I are highly

homologous with their A. vitis counterparts. Comparing published sequences

from A. vitis and A. tumefaciens, iaaH genes had 89% DNA homology and iaaM

genes had 90% homology. Even the CAAT and TATA elements were conserved

at positions-98 and-57, respectively (Bonnard etal., 1991; Baker etal., 1983).

74

2.4 References

Ankenbauer, R.G., and Nester, E.W. 1990. Sugar mediated induction of Agrobacterium tumefaciens virulence genes: Structural specificity and activities of monosaccharides. J. Bacteriol. 172:6442-6446.

Baker, R.F., Idler, K.B., Thompson, D.V., Kemp, J.D. 1983. Nucleotide sequence of the T region from the Agrobacterium tumefaciens octopine Ti plasmid pTi15955. Plant Mol. Biol. 2:335-350.

Belanger, C , Cantfield M.L., Moore, L.W., and Dion, P. 1995. Genetic analysis of nonpathogenic Agrobacterium tumefaciens mutants arising in crown gall tumors. J. Bacteriol. 177:3752-3757.

Bien, E., Lorenz, D., Eichhom, K., and Plapp, R. 1990. Isolation and characterization of Agrobacterium tumefaciens from the German vine region Rheinpalz. J. Plant Dis. Prot. 97:313-322.

Binns, A.N., and Thomashow, M.F. 1988. Cell biology of Agrobacterium infection and transformation of plants. Annu. Rev. Microbiol. 42:575-606

Bonnard, G. Vincent, P. and Otten, L. 1991. Sequence of Agrobacterium tumefaciens biotype III auxin genes. Plant Mol. Biol. 16:733-738.

Bonnard, G., Tinland, B., Paulus, P., Szegedi, E., and Otten, L.I989. Nucleotide sequence, evolutionary origin and biological role of a rearranged cytokinin gene isolated from a wide host range biotype III Agrobacterium strain. Mol.Gen.Genet 216:428-438.

Brisbane, P.G., and Kerr, A. 1983. Selective media for three biovars of Agrobacterium. J. Appl. Bacteriol. 54:425-431.

Brisset, M. N., Rodriguez-Palenzula, P., Burr, T.J. and Collmer, A. 1991. Attachment, chemotaxis, and multiplication of Agrobacterium tumefaciens biovar 1 and biovar 3 on grapevine and pea. Appl. Environ. Microbiol. 57:3178-3182.

Burr, T. J., Reid, C. L., Splittstoesser, D.P., and Yoshimura, M. 1996. Effect of heat treatments on grape bud mortality and survival of Agrobacterium vitis in vitro and in dormant grape cuttings. Am. J. Enol. Vitic. 47:119-123

Burr, T. 1988. Crown gall. In: Compendium of Grape Diseases, R.C. Pearson and A. C. Goheen (Eds.), pp. 41-42. APS Press, St Paul, MN.

75

Burr, T. J. and Katz, B. H. 1983. Isolation of Agrobacterium tumefaciens biovar from grapevine galls and sap and from vineyard soil. Phytopathology. 73:163-165.

Burr, T. J., Bishop, A. L, Katz, B. H., Blanchard, L. M., and Bazzi, C. 1988b. A root-specific decay of grapevine caused by Agrobacterium tumefaciens and A. radiobacter b\o\jar 3. Phytopthology 77: 1424-1427.

Burr, T. J., Katz, B. H., and Bishop, A. L. 1987. Population of Agrobacterium in vineyardand nonvineyard soils and grape roots in vineyards and nurseries. Plant Dis. 71:617-620.

Burr, T.J., Reid, C.L, Yoshima, M., Momol, E.A., and Bazzi, C. 1995. Survival and tumorigenicity of Agrobacterium vitis in living and decaying grape roots and cane in soil. Plant Dis. 78:677-682.

Burr, T.J., and Katz, B. H. 1984. Grapevine cuttings as potential sites of survival and means of dissemination of Agrobacterium tumefaciens. Plant Dis. 68976-978.

Collmer, A., and Keen, N. T., 1986. The role of pectic enzymes in plant pathogenesis. Ann. Rev. Phytopathology 24:383-409.

Daniela, S., Montoya, A.L., and Chilton, M.D. 1978. Fingerprints of Agrobacterium Ti plasmids. Plasmid 1:238-258.

De Vos, G., DE Beuckeleer, M., Van Montagu, M., and Schell, J. 1981. Restriction endonuclease mapping of the Octopine Tumor-inducing Plasmid pTiAch5 of Agrobacterium tumefaciens.

Deng, W.; Pu, X., Goodman, R.N., Gordon, M.P., and Nester, E.W. 1995. T-DNA genes responsible for inducing a necrotic response on grapevines. MPMI. 4:538-548.

Engler, G., Depicker, A., Maenhout, R., Villaroel, R., Van Montagu, M., and Schell, J. 1981. Physical mapping of DNA base sequence homologies between an octopine and nopaline Ti plasmid of Agrobacterium tumefaciens. J. Mol. Biol. 152:183-208.

Fournier, P., de Ruffray, P., and Otten, L. 1994. Natural instability of Agrobacterium vitis Ti plasmid due to unusual duplication of a 2.3 kb DNA fragment Mol. Plant-Microb. Interact 7:164-172.

76

Garfinkel, D., J., Simpson, R. B., Ream, L. W., White, P. P., Gordon, M. P., and Nester, E. W. 1981. Genetic analysis of crown gall: a fine structure map of the T-DNA by site-directed mutagenesis. Cell 27:143-153

Gillings, M. and Ophel-Keller K.1995. Comparison of strains of Agrobacterium vitis from grapevine source areas in Australia. Australian Plant Pathology 24:29-37.

Goodman, R.N., Butrov, D. and Tarbah, P. 1987. The occurrence of Agrobacterium tumefaciens in grapevine-propagating material and a simplified indexing system. Am. J. Enol. Vitic. 38:189-193.

Grimsley, N., Hohn, T., Davies, J.W., Hohn, B.I987. Agrobacterium mediated delivery of infectious maize streak virus into maize plants. Nature 325:117 79.

Herlache, T. C, Hotchkiss, JR. A. T., Burr, T. J., and Collmer. A., 1997. Charcterization of the Agrobacterium vitis pheA gene and comparison of the encoded polygalacturonase with homologous enzymes from Erwinia carotovora and Ralstonia solancearum. Applied and Envir. Microbiol. 63:338-346.

Hooykass, P.J., and Schilperoort, R.A. 1992. Agrobacterium and plant genetic engineering. Plant Molecular Biology 19:15-38.

Hooykass, P., den Dulk-Ras, H., and Schilperoort, R. 1988. the Agrobacterium tumefaciens T-DNA gene 6b is an one gene. Plant Mol. Biol. 11:791-794.

Joos, H., Inze, D., Caplan, A., Sormann, M., and Van Montagu, M. 1983. Genetic analysis of T-DNA transcripts in nopaline crown galls. Cell 32:1057-1067.

Kado, E. I., and Heskett, M. G. 1970. Selective media for isolation of Agrobacterium, Corynebacterium, Erwinia, Pseudomonas, and Xanthomonas. Phytopathology 60:969-976.

Kerr, A., and Panagopoulous, CG. 1977. Biotypes of Agrobacterium radiobacter var tumefaciens and their biological control. Phytopathol. Z. 90:172-179.

Knauf, V. C. Yanofsky, M., Montoya, A., and Nester, E. W. 1984. Physical and functional map of an Agrobacterium tumefaciens plasmid that confers a narrow host range. J. Bacteriol. 160: 564-568.

77

Knauf, V. C , Panagopoulous, CG, and Nester, E. W. 1982. Genetic factors controlling host range of Agrobacterium tumefaciens. Phytopathology. 12; 1545-1549.

Knauf, V. C , Panagopoulous, CG, and Nester, E. W. 1983. Comparison of Ti plasmids from three different biotypes of Agrobacterium tumefaciens isolated from grapevines. J. Bacteriol. 153:1535-1542.

Kuang-Hua Amy Hsu.1993. Molecular analysis of Agrobacterium Strains Isolated from Muscadine (Vitis Rotundifolia). Master Thesis, Mississippi State University.

Leemans, J., Deblarere, R., Willmizer, L., DeGreve, H., and Hernalsteens, J. P. 1982. Genetic identification of functions of TL-DNA transcripts in octopine crown galls. EMBO J. 1:147-152.

Martinez, E., Romero, D., and Palcios, R. 1990. the Rhizobium genome. Pages 59-93 in: Critical Reviews in Plant Sciences.

McGuire, R.G., Rodriguez-Palenzula, P., Collmer, A., and Burr, T.J. 1991. Polygalacturonase production by Agrobacterium tumefaciens biovar 3. Appl. Environ. Microbiol. 57:660-664.

Moore, L. W, Kado, C I., and Bouzar, H. 1988. Gram-negative bacteria. A. Agrobacterium. pp 16-36. In: Laboratory Guide for Identification of Plant Pathogenic Bacteria. 2"^. ed. N.W. Schaad, ed. American Phytopathological Society, St. Paul, MN.

Narasimhulu, S.B., Deng, X.B., Sarria, R., and Gelvin, S.B. 1996. Early transcription of Agrobacterium T-DNA genes in tobacco and maize. Plant Cell 8, 873-886.

Ooms, G., Hooykaas, P. J.J., Noleman, G., and Schilperoort, R. A. 1981. Crown gall tumors of abnormal morphology induced by Agrobacterium tumefaciens carrying mutated octopine Ti plasmids: analysis of T-DNA functions. Gene 14:33-50

Ophel, K, and Kerr, A. 1990. Agrobacterium vitis sp. nov. for strains of Agrobacterium biovar 3 from grapevines. Int. Syst. Bacteriol. 40:236-241.

Otten, L., and Ruffray, P. 1994. Agrobacterium vitis nopaline Ti plasmid pTiAB4: relationship to other Ti plasmids and T-DNA structure.

78

otten, L., Canaday, J., Gerard, J-C, Crouzet, P., Paulus, P. 1992. Evolution of Agrobacteria and their Ti plasmids. A review. Mol. Plant-Microb. Interact. 5:279-287.

Paulus, P., Huss, B., Bonnard, G., Ride, M., Szegedi, E., Tempe J., Petit A., and Otten, L. 1989a. Molecular systematic of biotype III Ti plasmids of Agrobacterium tumefaciens. Mol Plant-Microb. Interact. 2:64-74.

Paulus, P., Ride, M., and Otten, L. 1989b. Distribution of two Agrobacterium tumefaciens insertion elements In natural isolates: Evidence for stable association between Ti plasmids and their bacterial hosts. Mol. Gen. Genet 219:145-152.

Pu, X. A., and Goodman, R. N. 1992. Induction of necrogenesis by Agrobacterium tumefaciens on grape explants. Physiol. Mol. Plant Pathol. 41:241-254.

Rodriguez-Palenzula, P., Burr, T.J., and Collmer, P. 1991. Polygalcturonase is a virulence factor in Agrobacterium tumefaciens biovar 3. J. Bacteriol. 173: 6547-6552.

Roy, M., and Sasser, M. 1983. A medium selective for Agrobacterium tumefaciens biotype 3. Phytopathology 73:810.

Sawada, H., leki, H., and Takikawa, Y. 1990. Identification of grapevine crown gall bacteria isolated in Japan. Ann. Phytopathol. Soc. Jpn. 56:199-206.

Schuiz, T.P., Bauer, C, Lorenz, D., Plapp, R., and Eichhorn, K.W. 1993. Studies on the evolution of Agrobacterium vitis as based on genomic fingerprinting and IS element analysis. System. Appl. Microbiol. 16, 322-329.

Slusarenko, A. J. 1990. A rapid miniprep for the isolation of total DNA from Agrobacterium tumefaciens. Plant Mol. Biol. Reporter 8:249-252.

Strover, E. W., Swatz, H., J., and Burr, T., J. 1997. Agrobacterium wY/s-lnduced electrolyte leakage in crown gall susceptible and resistant grape gentoypes. Am.J. Enol. Vitic, 2: 145-149.

Szegedi, E. 1985. Host range and specific L(+)-tartrate utilization of biotype 3 Agrobacterium tumefaciens. Acta Phytopathol Acad Sci Hung 20:17-22

Tarbah, P. A., and Goodman, R. N. 1986. Rapid detection of Agrobacterium tumefaciens in grapevine propagating material and the basis for an efficient indexing system. Plant Dis. 70:566-568.

79

Thomashow, L., Reeves, S., and Thomashow, M. 1984. Grown gall oncogenesis: Evidence that a T-DNA gene from the Agrobacterium Ti plasmid pTiA6 encodes an enzyme that catalyzes synthesis of indoleacetic acid. Proc. Natl. Acad. Sci. USA 81:5071-5075.

Van Nuenen, M., de Ruffray, P., Otten, L. 1993. Rapid divergence of Agrobacterium vitis octopine-cucumopine Ti plasmids from a recent common ancestor. Mol. Gen. Gent. 240:49-57.

Willmitzer, L., Simons, G., and Schell, J. 1982. The TL-DNA of octopine crown gall tumors codes for seven well defined polyadenylated transcripts. EMBO. J. 1:139-146.

Willmitzer, L., Dhaese, P., Schreider, P. H., Schmalenbach, W., Van Montagu, M. 1983. Size, location, and polarity of T-DNA encoded transcripts in nopaline crown gall tumors: evidence for common transcripts present in both octopine and nopaline tumors. Cell 32:1045-1056.

Yanofsky, M., Lowe, B., Montoya, A., Rubin, R., Krul, W., Gordon, M., and Nester, E. W. 1985b. Molecular and genetic analysis of factors controlling host range in Agrobacterium tumefaciens. Mol. Gen. Genet. 201:237-246.

Yanofsky, M., Montoya, A., Knauf, V., Lowe, B., Gordon M.P., and Nester, E.W. 1985a. Limited-host-range plasmid of Agrobacterium tumefaciens: Molecular genetic analyses of transferred DNA. J. Bacteriol. 163:341-348.

80

Table 2.1. List of Agrobacterium isolates

Isolates Designation LT1 LT2 LT3 LT4 LT5 LT6 LT7 LT8 LT9 LT10 LT11 LT12 LT13 LT14 LT15 LT16 LT17 LT18 ATCC 49767 ATCC 15955 CG49 CG56 CG101 CG415 CG98 CG108 CG78 CG475 CG81 CG450

Biotype A. vitis A. vitis A. vitis A. vitis A. vitis A. vitis A. vitis A. vitis A. vitis A. vitis A. vitis A. vitis A. vitis A. vitis A. vitis A. vitis A. vitis A. vitis A. vitis A. tumefaciens A. vitis A. vitis A. vitis A. vitis A. vitis A. vitis A. vitis A. vitis A. vitis A. vitis

Host Unknown Unknown Unknown Unknown Merlot Merlot Sauv. Blanc Sauv. Blanc Sauv. Blanc CBSV Shardonnay Shardonnay Shardonnay Sauv. Blanc Sauv. Blanc Shardonnay Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown Unknown

Source Texas Texas Texas Texas Texas Texas Texas Texas Texas Texas Texas Texas Texas Texas Texas Texas Texas Texas ATCC ATCC New York Michigan Virginia New York Virginia New Mexico New York New Mexico Michigan New York

81

v>

B 15 o E a> sz o o io o

• . »

(0 c "ro k .

tn E

ni

o <

10 (U M c o QL (0 (D Q:

0) .O (0

u 3

O 'c o

S o . u o

= (0 (0 -c . ^ (0

"c

(D

g

E o P c: * : .c

< a> u> o k . o 3

y ' k .

a3 Li.

0) C CO o .b •c b

O CO

"o n Z

0) (A

2 c

+ • " I I I + + + 1 + I + I I 1 + + • I I I I I I

I I I I I ' > + l + l + l + + l , + + , , , , I I I I I

+ + + + + + + + + + + + + + , + + + + I + + + + + , + + +

+ + + + + + + + + + + +,+ ,+ , + +,^^^^^_^_ ^ ^ ^

+ + + + + + + • + • + . + . + • 1 + + + .

+ + + + + + + ! I I + . + I + , + . , + , , I l l +

+ + + + + + + . , . + + + . + + + , , + , , ^ . ^ _^

+ + + + + + + + + + + + . + ^ + + + + ^ + _J + + + , + + +

+ + + + + + + + + + + + + + + + + + + + + + + + + + + + +

+ + + + + + + + + + + + + + + + + + + . + + + + + + + + +

+ + + + + + • I I l + l + i + . + , , + + + + , , + + +

- ' - ' - - ' - i - - i - i - i - i - i - i - i _ i _ i _ i _ j _ j - j I _ i ' * ^ 0 0 0 0 0 0 0 0 0 0

82

Table 2.3. Virulence of Agrobacterium strains on selected host and opine utilization.

Virulence on Strain Tomato Sunflower Tobacco Grape

Opine Utilized

LT1 LT2 LT3 LT4 LT5 LT6 LT7 LT8 LT9 LT10 LT11 LT12 LT13 LT14 LT15 LT16 LT17 LT18 49767 15955 CG49 CG56 CG101 CG415 CG98 CG78 CG108 CG475 CG81 CG450

-

-

-

-

-

+

+--

-

-

+ -

+ -

+ + +

HR HR HR

HR

HR HR +

++ +

+ + + + +

+: virulent; -: avirulent; ++: supervirulent; HR: hypersensitive +/- weak virulence; Vit: vitopine; O/C: octopine cucumopine; Oct: octopine; N/D: not determined.

+ + + + + + + + ++ + + + +/-+ +/-+ + + + +/-+ + + + + + + ++ + +

jnsitive lopine;

Oct Oct N/D Oct Oct Oct Oct Oct Oct N/D Oct Oct Oct Oct Oct N/D Oct Oct Oct Oct Nop Nop Vit O/C Vit Vit O/C O/C Vit Vit

f response Nop: Nopaline

83

A B C D E F G H I J K P M N O

Fig 2 1. Tumor induced by Agrobacterium strains on tobacco. A: LT1; B: LT2; C: LT3; D: LT4; E:LT5; F:LT6; G:LT7; H:LT8; l:LT9; J:LT10; K:LT11; P:LT12; M:LT13; N:LT14; 0:LT15; a:LT16; b:LT17; c:LT18; d:ATTC49767; e:ATTC15955; f:CG49; g:CG56; h:CG78; l:CG81; j:CG98; k:CG101; l:CG108; m:CG415; n:CG450; o:CG475.

84

A ^ B C p E F G H I J K P M N O -It.

1 > ^

y x •/."'?•,

1 ? if i r • I i I I I

Fig. 2.2. Tumor induced by Agrobacterium strains on tomato. A: LT1 • B-LT2; C: LT3; D: LT4; E:LT5; F:LT6; G:LT7; H:LT8; l:LT9; J:LT'IO; K:LT11; P:LT12; M:LT13; N:LT14; 0:LT15; a:LT16; b:LT17; c:LT18-d:ATTC49767; e:ATTC15955; f:CG49; g:CG56; h:CG78; l:CG81 ' j:CG98; k:CG101; l:CG108; m:CG415; n:CG450; o:CG475

85

A B C D E F G H I J K P M N O

Fig. 2.3. Tumor induced by Agrobacterium strains on sunflower A" LT1 B LT2; C: LT3; D: LT4; E:LT5; F:LT6; G:LT7; H:LT8; l:LT9; JiLTIo' K:LT11; P:LT12; M:LT13; N:LT14; 0:LT15; a:LT16; b:LT17 cLT18-d.ATTC49767;e:ATTC15955;f:CG49;g:CG56;h:CG78- ICG81 ' j:CG98; k:CG101; l:CG108; m:CG415; n:CG450; o:CG475

86

Fig. 2.4. Tumor types induced by Agrobacterium vitis strains on grape

87

1 2 3 4 5 6 7 8 9 10 11 121314 15

TI

1617 18 19 20 21 22 23 24 25 26 27 28 29 30

Fig. 2.5. Agarose gel electrophoresis showing Ti plasmids of Agrobacterium strains. Lanes: 1: LT1; 2: LT2; 3: LT3;4: LT4; 5:LT5; 6:LT6; 7:LT7; 8:LT8; 9:LT9; 10:LT10; 11:LT11; 12:LT12; 13:LT13; 14:LT14; 15:LT15; 16:LT16; 17:LT17; 18:LT18; 19:ATTC49767; 20:ATTC15955; 21:CG49; 22:CG56; 23:CG78; 24:CG81; 25:CG98; 26:CG101; 27:CG108; 28:CG415; 29:CG450; 30:CG475.

88

C ^ v ^ v 'i CS C ^ <S'^ C^ v * v "* v "

^ 5 ^ ^ ^

.f^m^.- ^iSlgtl0 ^^«uii

V ? ^ Ci * v " v ^ v ^ v ^ v ''' v * 0-- ^

T*!*. ' '--* *'

Fig. 2.6. Southern hybridization analysis of Eco Rl digest of TI plasmid using pGV201 probe

89

<^ \^ v ' v ^ vS C ^ C i C * C<

v ^ v^^^^ ' v^^W^^^ v^^W^^* .> ..v

Fig. 2.7. Southern hybridization analysis of Eco Rl digest of Ti plasmid using pGV153 probe

90

M 20

Fig. 2.8. PCR amplification of 260 bp fragment from A. tumefaciens. Lanes: M: molecular Marker (Hind III X)', 20: Ti 15955 amplified with primer pair 6a.

91

CHAPTER III

ANTISENSE RNA MEDIATED RESISTANCE EXPRESSION

TO GROWN GALL IN TOBACCO

3.1 Introduction

Agrobacterium is a soil-inhabiting. Gram-negative pathogen. It causes

crown gall disease in many woody and herbaceous plants. The host range of

Agrobacterium includes 600 plant species from 331 genera (DeCleene and

DeLey, 1976). The tumor formation is the result of the transfer and expression of

T-DNA genes in the plant host genome.

Agrobacterium evolved a two-component signal transduction pathway by

which the process of infection is regulated. This system is composed of VirA and

VirG proteins. The VirA acts as the environmental sensor and VirG is the

response regulator that binds to the promoter regions of wr operons. The

activation of virulence operons leads to the transfer and integration of the T-DNA

into the host genome. It is the expression of the T-DNA, mainly phytohormone

genes, that lead to the tumor formation. Auxin and cytokinin are the two main

phytohormones produced by Agrobacterium T-DNA genes. The ipt gene

encodes an isopentenyl transferase that catalyses the formation of the cytokinin

isopentenyl-AMP from isopentenyl pyrophosphate and AMP. The auxin

biosynthesis is a two-step pathway. The iaaM gene encodes a tryptophan 2-

monooxygenase which catalyzes an oxidative decarboxylation of tryptophan into

92

3-indoleacetamide (lAM), while the iaaH gene encodes indoleacetamide

hydrolase that converts lAM into 3-indoleacetic acid (IAA). It is important to note

that auxin biosynthesis in Agrobacterium tumefaciens is very similar to many

other hormone-producing bacteria such as A. rhizogenes and Pseudomonas

syringae. Although the organization and mode of expression of phytohormone

genes are different between microorganisms, significant similarities between the

amino acid sequences were reported (Camilleri and Jouanin 1991; Yamada et al.

1985). This indicates that hormonal genes from phytopathogenic bacteria are

genetically conserved, which explains their vital role in virulence.

Crown gall is very important disease. It affects a wide range of

economically important crops, including pome and stone fruit trees, nuts,

brambles, and grapes (Agrios, 1988). It also affects nursery trees, young

plantings and ornamentals. The financial impacts of losses due to crown gall

were estimated to reach $23 million on fruits and nuts alone (Kennedy and

Alcron, 1980). With the increased acreage of fruit and nuts crops during last two

decades, the economic losses are probably much higher than this previous

estimation.

Among the most susceptible crops to Agrobacterium is grape, especially

in a climates with severe cold (Burr, 1988). Crown gall disease in grape is

associated mainly with A. vitis that can exist systemically in healthy grapevines

(Stover et al.. 1997; Burr and Katz, 1983; Lehoczky, 1971). Burr and Katz (1984)

reported that a significant portion of grape nursery stock in the USA is

93

systemically infected with A. vitis. Many techniques are used to eradicate or

control A. vitis, including shoot tip culture (Burr et al., 1988), heat treatment of

dormant cuttings (Ophel et al., 1990) and biological control using nonpathogenic

strains (Burr and Reid, 1993). In spites of all these efforts, A. vitis remains a

major destructive pathogen for grape. One possible approach for protecting

plants against Agrobacterium infection involves the use of antisense RNA

sequences to inhibit gene expression. The basic principle of antisense

technology is that the introduction of an antisense copy of a gene under

constitutive expression or similar transcriptional control as the target gene results

in reducing the expression of that gene.

The use of antisense technology has been successful in protecting plants

against virus infection by RNA viruses (Cuzzo et al., 1988; Hemenway et al.,

1988). Expressing an antisense gene that inhibits ethylene biosynthesis in

transgenic tomato plants prolonged shelf life of the tomato fruit by delaying

ripening (Hamilton et al., 1990; Bird et al., 1991). There are also several reports

on the success of this approach in manipulating biochemical pathways in plants

(Elomaa et al., 1993; Mate et al., 1993; Riesmeier et al., 1994).

The objectives this study were to clone and construct T-DNA auxin

biosynthesis genes in an antisense orientation, transform these constructs into

tobacco and test for tumor formation when transgenic plants are challenged with

wild \ype-Agrobacterium.

94

3.2 Materials and Methods

3.2.2 Construction of chimeric iaaM and iaaH antisense

3.2.2.1 Isolation of/aa/W and iaaH genes

The iaaM and iaaH genes were isolated from the Agrobacterium

tumefaciens pT115955 using polymerase chain reaction (PCR). The Ti plasmid

was isolated and purified as previously described in Section 2.2.4. Using 1 i l of

the plasmid DNA as a template, a PCR reaction was performed in a volume of 50

pi using Taq DNA polymerase (Fisher Scientific, Piano, TX). The oligonucleotide

primers were designed according to the published sequences of the iaaM and

iaaH genes (Baker et al. 1982). The primers flanked the entire coding region for

both genes. For iaaM, the 5' primer was (5'TTCTAACAATGTCAGCTTCA3') and

the 3' primer was (3TGATCTTTAATCAGATACCT5'). For the iaaH, the 5' primer

(5'CTCAGAGAGATGGTGGCCATT3') was used and the 3' primer

(3'AACGGCCAAATGGGTTAATTT5') was used. The reaction conditions were

95°C for 1 min, 50°C for 30 seconds and 72°C for 1 min. This reaction was

repeated for 32 cycles.

3.2.2.2 TA Cloning

One microliter of the amplified PCR product was ligated into pGEM-T

(Promega Corporation, Madison, Wl) using T4 DNA ligase. The pGEM-T vector

has a single deoxy-T-overhang at each 3'end that is complementary to the

95

deoxy-A overhangs created in the PCR product by Taq polymerase, allowing an

efficient ligation. The pGEM-T also has an ampicillin resistance gene for

selection, as well as T7 and SP6 universal primers for sequencing. Two

microliters of the ligation reaction were used to transform competent E. coli strain

DH5a. Cells were then plated on LB plates with 5-bromo-4-chloro-3-indolyl-p-D-

galactoside (X-gal). White colonies were selected for plasmid Isolation, and the

plasmids were digested with Not I to check for the presence of the insert. The

pGEM-T has a recognition site for Not I flanking the insertion site. Plasmids with

inserts that correspond to the expected length of iaaM and iaaH were sequenced

using automated sequencer. The pGEM-T plasmids containing the full-length

coding sequences were designated as pGEMT-/aa/W and pGEMT-/aa/-/

respectively. Plasmid isolation from E. coli was performed by the boiling method

according to Maniatis et al., (1982).

3.2.2.3 Construction of iaaM and iaaH antisense constructs

Antisense iaaM (Pigure 3.1) was made by ligating the Eco Rl iaaM

fragment from pGEM-T-/aa/W into the Eco Rl site of the expression vector pRTL3

to make pRTL3-As-/aa/W. The pRTL3-As-/aa/W plasmid was digested with Sph I

and blunt-ended by the Klenow fragment of E. coli DNA polymerase I. The DNA

fragment was then ligated into the blunt-end Hind III site of the binary vector

pCGN 1578, creating pCGN-AS-/aa/W. The pGEM-T-/aaH plasmid (Figure 3.2)

was cut with Not I and blunt-ended. The purified fragment was then ligated into

96

the blunt-end Xho I site of pRTL-3 to create pRJl-As-iaaH. The expression

cassette was isolated by digesting pRTL-As-/aaH with Hind III and ligating it into

the Hind III site of pCGN 1578 to create pCGN-As-/aaH.

The pRTL3 plasmid is similar to pRTL2 except that it lacks the TEV leader

sequence. The pRTL3 plasmid contains a Cauliflower mosaic virus (CaMV) 35S

promoter with a duplicated enhancer region, a CaMV 35S 3' terminator, and a

polyadenylation signal which cause over-expression of the insert.

3.2.3 Development of Transgenic Tobacco

3.2.3.1 Transformation of Agrobacterium cells

The chimeric antisense gene constructs pCGN-As-/aa/W and pCGN-As-

iaaH were mobilized into A. tumefaciens strain EHA 101 by direct transformation.

Cells were grown overnight in 50ml MG/L medium (Appendix D) containing 50

pg/ml of kanamycin at 30°C in a shaking incubator (250 rpm). One ml of over­

night grown EHA cells was inoculated into 50 ml of MG/L media with no

antibiotics and grown for six hours at 30°C. Cells were then collected by

centrifugation for 10 min at 12,000 rpm and resuspended in 2 ml of fresh MG/L

media. One pg of the purified plasmid with chimeric construct was mixed with

200 pi of pelleted cells. The mixture was then frozen immediately in liquid

nitrogen, thawed at 37°C for 5 min, and transferred to 1 ml of MG/L to grow for 2

hours at 30°C in a shaking incubator. The culture was plated onto MG/L plates

97

containing 100 pg/ml of gentamycin and grown at 30°C. Transformant colonies

were grown in MG/L liquid media (supplied with 200 pi of LB) with 100 pg/ml of

gentamycin and 50 pg/ml of kanamycin. Plasmids were recovered using a

modified alkaline lysis method. Two pg/ml lysozyme were added to the

resuspension solution. Plasmids were analyzed by restriction analysis and

Southern blotting.

3.2.3.2 Agrobacfer/tym-mediated tobacco transformation

Tobacco (Nicotiana tabacum cv Xanti) leaf disk inoculation was performed

according to Horsch et al. (1985). Fully expanded, healthy leaves from 3-month-

old tobacco plants were collected, disinfected in 14% chlorox for 5 min. and

washed 5 times with sterile water. A number 7 cork borer was used to make leaf

disk punches 1.5 cm in diameter. The leaf disks were immersed for 5 min in the

Agrobacterium solution that contained the chimeric antisense construct, blotted

on sterile 3M paper and placed upside down on MSA nutrient plates (Appendix

VI) for 2 days to allow infection to occur. They were then transferred to MSB

plates (Appendix VI) containing hormones and antibiotics that promoted growth

of callus and shoot formation. Shoots that were formed from calluses were cut

and transferred to MSC plates (Appendix D) for root formation. Once visible

roots were developed, plantlets were transferred into Magenta boxes with sterile

98

potting soil and slowly acclimated prior to potting in two-gallons containers in the

greenhouse.

3.2.4 Characterization of Transgenic Tobacco Plant

3.2.4.1Tobacco DNA and RNA Extraction

Plant DNA was isolated from expected transgenic tobacco according to

Dellaporta et al. (1983), with one exception, the starting plant tissue was 3 grams

of leaf tissue instead of 0.75 g. Plant DNA was used to amplify the chimeric

antisense gene using PCR. The PCR reaction and conditions were as described

before (Section 3.2.2).

Total RNA was extracted from transgenic and wild-type tobacco plant

using PUREscript (Promega Corporation, Madison, Wl). Leaf discs were

collected from fully expanded leaves of approximately two-months-old tobacco

plants and placed in foil pouches, frozen in liquid nitrogen and stored at-80 °C.

Discs were placed in micro-centrifuge tubes and ground. Once the discs were

powdery, 300 pi of cell lysis solution were added and the discs were ground for

5-10 more strokes. Then 100 pi of protein-DNA precipitation solution were

added, and the tubes were inverted 10 times and placed on ice for 10 min. After

the tubes were spin for 10 min at 4 °C, the supernatant was collected in a new

tube and 400 pi of isopropanol was added and mixed. Total RNA was

precipitated at -20 °C for ten hours. After a 5-min spin at 4 °C, pellets were

99

washed with 400 pi of 70% EtOH. Samples were dried in a Speedvac for 15 min

after the EtOH was discarded. Fifty pi of RNA rehydration solution was added to

the dry pellet. Samples were vortexed, incubated on ice for 30 min and stored at

-80 °C. The total RNA samples were quantified at 260 nm by using a Shimadzu

UV160U spectrophotometer. The total RNA isolated by this method was used for

Northern blots.

Northern blotting and hybridization analysis was done by using 15 )ig of

total RNA electrophotically separated on 1% agarose gels containing 20%

formaldehyde, in a IX MOPS buffer (0.2 M MOPS, 8 mM NaOAc, ImM EDTA,

pH 7.0). The gels containing the RNA were soaked in 75 mM sodium hydroxide

for 30 min, washed in water for 15 min, washed in 20X SSPE (3 M NaCI, 0.2 M

NaH2P04, 20 mM EDTA, pH 8.0) for 40 min and transferred to nitrocellulose

membranes using 20X SSPE as a transfer buffer according to Maniatis at al.

(1982). The nitrocellulose membranes were dried at 82 °C for 3-4 hours in a

vacuum oven and stored in plastic containers. The membranes were

prehybridized for 2 hours at 42 °C in a solution containing 50% (v/v) formamide,

2X Denhardt's solution (IX Denhardt's is 0.02% PVP, 0.02% Picoll, 0.02% BSA),

0.1% SDS and 5x SSPE. Hybridization was carried out in the same buffer

solution plus the denatured ^^P-labeled probe (As-/aa/Wand As-/aaH fragments)

at 40 °C. The membrane was washed with 2X, IX and 0.5X SET (3 M NaCI, 0.4

M Tris pH 7.8 and 20 mM EDTA) for 30 min at 60 °C. X-ray film was exposed to

the dried membrane at -80 °C for 24 hours.

100

3.2.4.2 Reverse transcriptase polymerase chain reaction

In order to quantify the expression of the antisense gene in tobacco,

reverse transcriptase polymerase chain reaction (RT-PCR) was performed. The

total RNA used for RT-PCR was isolated from powder of frozen tobacco leaf

disks using the acid guanidinium thiocyanate method (Chomczynski and Sacchi,

1987).

First-strand cDNA was synthesized from total RNA isolated from

transgenic and wild-type tobacco using Moloney murine leukemia virus reverse

transcriptase and oligo dT (Promega, Madison, Wl) as primer. Using 2 pi of the

first-strand cDNA as template, a PCR reaction was performed in a volume of

50 pi using Taq DNA polymerase. The primers and the PCR reaction were as

previously described (Section 2.2.4) with one exception: the PCR reaction was

extended for 35 cycles. Visualization of the cDNA amplification was performed

by running the PCR product on 1.3 % agarose gel at 40 volts for 3 hours.

3.2.4.3 Evaluation of tobacco plant expressing antisense iaaM

and iaaH genes

At anthesis, fully expanded leaves from transgenic and wild-type tobacco

were harvested from the greenhouse, and washed three times with deionized

water and lightly blotted dry. Leaves were then soaked in 10 % chlorox for 15

101

minutes and transferred to sterile deionized water for 2 min. This step was

repeated three times. Leaves were cut into sections of approximately 1.5 cm^ in

Petri dishes containing 1 ml of wild-type Agrobacterium tumefaciens culture.

Plant pieces were then blotted on autoclaved paper towels and transferred to

one-half strength MS medium plates. After 2 days, plant pieces were transferred

to the same medium containing mefoxin at 500 mg/L. Three weeks later, plant

tissue was phenotypically evaluated for resistance to Agrobacterium

tumefaciens. The resistance was evaluated in terms of tumor size and number

of tumors per tissue surface area. In addition to transgenic tobacco plants

expressing the antisense iaaM and iaaH genes, three other controls were

evaluated, a transgenic tobacco plant expressing glutathione S-transferase gene

(transformed using the same binary vector as As-iaaM and As-iaaH) and two

wild-type tobacco plants, one generated by tissue culture and the other

germinated from seed. Tumor diameter was measured with an electronic caliper.

This experiment was designed as a completely randomized trial with 6 genotypes

and six replications. For comparison between means, least-significant-difference

(LSD) test (P= 0.05) was used. To evaluate the response of the whole plant,

stems of mature transgenic and wild-type tobacco were wounded with a sterile

needle and freshly cultured Agrobacterium strains were applied to the wound.

102

3.3 Results and Discussion

Auxin biosynthesis genes from Agrobacterium tumefaciens ATCC15955

were used to test the effectiveness of antisense technology to block tumor

development. Agrobacterium tumefaciens ATCC^5955 was used because it is

highly virulent, has a wide host range, and its T-DNA has already been

sequenced. A. tumefaciens iaaM and iaaH genes were amplified using PCR.

The bands amplified corresponded to the expected size of the coding sequences

of both genes (Figure 3.3): iaaM is 2.2 kb and iaaH is 1.4 kb. The -- 700 bp band

corresponded to another phytohormone gene called ipt. The iaaM and iaaH PCR

products were cloned into the pGEM-T plasmid. This plasmid was chosen

because of many advantages. It has a single deoxy-T overhang at each 3' end

complementary to the deoxy-A overhangs created in the PCR product by Taq

DNA polymerase. Sequencing using T7 and SP6 as primers showed that the

cloned fragments were identical to the previously published sequences of iaaM

and iaaH (Baker et al. 1983) data not presented. This indicates that PCR is a

reliable technique to directly clone bacterial phytohormone genes.

Both coding sequences were inserted into pRTL3. This plasmid was

developed in Dr. Allen Randy laboratory at Texas Tech University. It was made

to specifically express antisense constructs. The pRTL3 is similar to pRTL2.

Both have the cauliflower mosaic virus (CaMV) 35S promoter, a CaMV 35S 3'

terminator, and a polyadenylation signal that cause overexpression of the

inserted DNA. The pRTL3, however, lacks the TEV leader sequence allowing an

103

efficient antisense effect. The orientation of the inserts were checked first by

restriction mapping followed by sequencing. The antisense constructs were

inserted into the binary vector pCGN 1578. This plasmid contains the left and

right T-DNA border sequences that are necessary for plant transformation.

Using PCR and Southern hybridization, six independent antisense iaaM

and four independents antisense iaaHsNere identified. Southern hybridization

was performed using ^^P-labelled iaaM and /aa/^ fragments as probe. However,

several transgenic plants showed very unusual growth resembling permanent

nitrogen deficiency compare to the control. Those plants were discarded from

this study. Transgenic tobacco plants that expressed the antisense constructs

were identified by Northern blot analyses using ^^P-labelled iaaM and iaaH

fragments as probes. Figure 3.4A and B show that transgenic tobacco plants

accumulated high levels of antisense mRNA compare to the control. To further

evaluate the expression level of both constructs, RT-PCR was used. Figure 3.5

shows the strong expression of the antisense genes from both transgenic plants.

However, the level of antisense iaaH was much higher than antisense iaaM.

Although, the expected bands were amplified from both transgenic plants, a

small-sized band of approximately 350 bp was amplified from antisense iaaH

plants. This is probably due to the primers recognizing an untargeted cDNA

fragment.

Transgenic tobacco plants were evaluated phenotypically by challenging

leaf tissue with wild type A. tumefaciens. No plants showed a complete

104

resistance to the bacteria (Figures 3.6 and 3.7), indicating that the auxin is not

the only virulence factor in tumor development. Resistance was estimated in

terms of frequency of tumor galls formed per 2 cm^ of tissue and the morphology

of the tumor. Table 3.1 shows that the expression of both constructs affected the

frequency and the morphology of the induced tumor. The controls had more

galls per surface area and relatively larger tumors than transgenic plants,

indicating a significant interaction at the level of gene expression. No significant

differences were detected between controls in terms of tumor frequency,

however control II (tobacco plants generated from tissue culture) had smaller

tumor galls than the other controls. This is probably due to a microenvironment

effect rather than an inherited trait. The expression of antisense iaaM reduced

gall size by 46% and gall frequency by 45% and antisense iaaH by 16% and 36%

respectively. However, 60% of samples from antisense iaaH plants formed roots

in response to Agrobacterium infection (Table 3.1), while 16% of antisense iaaM

had roots. These roots can be considered as tumorous tissue, since other

Agrobacterium species induce tumors in the form of roots. Actually,

Agrobacterium tumefaciens induced roots on stems of Kalanchoe

diagremontiana stem (data not shown).

Agrobacterium tumefaciens causes tumors in plants by inducing the

production of high and unbalanced levels of auxin and cytokinin. Two genes of

the T-DNA from A. tumefaciens encode enzymes for auxin biosynthesis: the

iaaM gene which encodes tryptophan monooxygenase and the iaaH gene

105

encodes indoleactamlde hydrolase. In an attempt to block the tumor formation,

the antisense of iaaM and IaaH were expressed In transgenic tobacco plants.

Although the frequency and morphology of tumors were reduced, both transgenic

plants formed tumors after infection. This indicates that the unbalanced ratio

between auxin and cytokinin still exist at least in the antisense iaaM plants. This

means that auxin biosynthesis was not completely inhibited. Other genes on the

T-DNA may complement the suppression of the iaaM or iaaH genes. Gene5 and

6b have been implicated in auxin and cytokinin regulation (Winans, 1992).

Tinland et al. (1990) reported that gene 6b has an auxin-like effect on plants,

while geneS modulates auxin responses in plants by autoregulating the synthesis

of an auxin antagonist, indole-3-lactate (Korber et al., 1991). The behavior of

gened is not yet known when auxin biosynthesis is inhibited. All of these findings

suggest that there are other factors involved in auxin regulation besides iaaM

and iaaH. It will be interesting to clone the entire T-DNA in the antisense

orientation, expressing it into plants and evaluate them for resistance. This will

eliminate the problem of complementation between various genes. The fact that

antisense iaaH expressing plants formed roots when infected with A. tumefaciens

indicates that the antisense construct had the opposite effect, since roots are

Induced when the ratio of auxin to cytokinin is high. The antisense iaaH plants

probably blocked the conversion of lAM to IAA, which led to an accumulation of

lAM in plant tissue. Although lAM has been shown to be an inactive compound

in plants (Klee et al. 1987), plant cells may converts it into IAA. The ability of

106

plant cells to hydrolyze lAM has been reported (Klee et al., 1987). These studies

in combination with our observations show that manipulating the iaaH gene to

acquire resistance to Agrobacterium may not be efficient. However, the first step

in auxin biosynthesis seems promising, assuming that all T-DNA genes are well

characterized.

107

3.4 References

Agrios, G. 1988. Plant Pathology. 3ed edition. Academic Press. New Yorlc. pp.558-564.

Baker, R.F., Idler, K.B., Thompson, D.V., Kemp, J.D. 1983. Nucleotide sequence of the T region from the Agrobacterium tumefaciens octopine Ti plasmid pTi15955. Plant Mol. Biol. 2:335-350.

Bird, C.R., Ray. J.A., Fletcher, J.D. 1991. Using antisense RNA to study gene function inhibition on cartenoid biosynthesis in transgenic tomatoes.Bio/Tech. 9:635-639.

Burr, T. J., and Reid, C. L., 1993. Biological control of grape crown gall with nontumorigenic Agrobacter/ty/77 vitis strain F2/5. Am. J. Enol. and Vitic 45:213-219.

Burr, T. J., Katz, B. H, Bishop, A. L., Meyers, C.A. and Mittak. 1988b. Effects of shoot age and tip culture propagation of grapes on systemic infestations by Agrobacterium tumefaciens Biovar 3. Am.J.Enol.Vitic. 39:67-70.

Burr, T. 1988a. Crown gall. In: Compendium of Grape Diseases, R.C. Pearson and A. C. Goheen (Eds.), pp. 41-42. APS Press, St. Paul, MN.

Burr, T.J., and Katz, B. H. 1984. Grapevine cuttings as potential sites of survival and means of dissemination of Agrobacterium tumefaciens. Plant Dis. 68976-978.

Burr, T. J. and Katz, B. H. 1983. Isolation of Agrobacterium tumefaciens biovar from grapevine galls and sap and from vineyard soil. Phytopathology. 73:163-165.

Camilleri C, Jouanin, L. 1991. The TR-DNA region carrying the auxin synthesis genes of A.rhizogenes agropine type plasmid pRiA4: nucleotide sequence analysis and introduction into tobacco plants. Mol Plant Microb Interact 4:155-162.

Chomczynski, P., and Sacchi, N. 1987. Single step method of RNA extraction by Acid Guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156-159

Cuzzo, M., O'Connel, K.M., Kaniewski, W., Pang, R.X., Chua, N.H., Tumer, N.E. 1988. Viral protection in transgenic tobacco plants expressing the

108

cucumber mosaic virus coat protein or its antisense RNA. Bio/Tech. 6:549 557.

DeCleene, M., and DeLey J. 1976. The host range of crown gall. Bot. Rev. 42:389-466.

Dellaporta, S.L., Wood, J.,and Hicks, J.B. 1988. A plant DNA minipreparation: Version II. Plant Mol. Biol. Reporter 1:19-21.

Elomaa, P., Honkanen, J., Puska, R. 1993. Agrobacter/t/m-mediated transfer of antisense chalcone synthase cDNA to Gerbera hybrida inhibits flower pigmentation. Bio?Tech. 11:508-511.

Hamilton, A.J., Kycett, G.W., and Grierson, D. 1990. Antisense gene that inhibits synthesis of the hormone ethylene in transgenic plants. Nature 346:284 287.

Hemenway , C. Fang, R.X., Kaniewski, K.W., Chua, N.H., Tumer, N.E. 1988. Analysis of the mechanism of protection in transgenic plants expressing the potato virus X coat protein or its antisense RNA. EMBO J. 7:1273 1280.

Horsch, R.B., Fry, J.E., Hofman, N.J., Eicholtz, D., Rogers, S.C, Praley, R.T. 1985. A simple and general method for transferring genes into plants. Science 227-119-123.

Kennedy, B. and Alcron, S. 1980. Estimates of U.S. crop looses to prokaryotic plant pathogens. PI. Disease 64:674-676.

Klee, H.,J., Horsh, R.B., Hinchee, M.A., Hein, M.B., and Hoffmann, N.,L. 1987. The effect of overproduction of two Agrobacterium tumefaciens T-DNA auxin biosynthesis gene products in transgenic petunia plants. Genes Dev. 1:86-96.

Korber, H., strizhov, N., Staiger, D. and Koncz, C. 1991. T-DNA gene 5 of Agrobacterium modulates auxin response by autoragulated syntheis of a growth hormone antagonist in plants. EMBO J. 10:3983-3991.

Lehoczky, J. 1971. Further evidence concerning the systemic spreading of Agrobacterium tumefaciens in the vascular system of grapevines, vitis 10:215-221.

109

Maniatis, T., Fritsch, E.F., and Sambrook, J. 1982. Molecular cloning: A laboratory manual. Cold Spring Harbor, NY. Cold Spring Harbor Laboratory.

Mate, C.J., Hudson, G.S., Von Caemmerer, S., Evans, J.R., Andrews, T.J. 1993. Reduction of ribulose bisphosphate carboxylase activase levels in tobacco (Nicotiana tabacum) by antisense RNA reduces ribulose bisphosphate carboxylase carbamylation and impairs photosynthesis. PI. Physiol. 102:1119-1128.

Ophel, K., Nicholas, P.R., Magarey, P.A., and Bass, A.W. 1990. Hot water treatment of dormant grape cuttings reduces crown gall incidence in a field nursery. Am.J. Enol. Vitic, 41: 325-329.

Riesmeier, J.W., Willmitzer, L., Frommer, W.B. 1994. Evidence for an essential role of the sucrose transporter in phloem loading and assimilate partioning. EMBO J. 13:1-7.

Strover, E. W., Swatz, H., J., and Burr, T., J. 1997. Agrobacterium wY/s-lnduced electrolyte leakage in crown gall susceptible and resistant grape gentoypes. Am.J. Enol. Vitic, 2: 145-149.

Tinland, B., Rohfritsch, O., Michler, P., and Otten, L. ^990.Agrobacterium tumefaciens T-DNA gene 6b stimulate rol-induced root formation, permits growth at high auxin concentration and increase root size. Mol. Gen. Gent. 223:1-10

Winans, S.C. 1992. Two-way chemical signaling in Agrobacterium-plant interactions. Microbiol. Rev. 56:12-31.

Yamada T., Plam C.J., Brooks B., Kosuge T. 1985. Nucleotide sequences of the Pseudomonas savastoni indolacetic acid gene show homology with Agrobacterium tumefaciens T-DHA. Proc Natl. Acad. Sci. USA 82:6522 6526.

110

Table 3.1. Tumor size, number, and frequency of tumor formation in transgenic and wild type tobacco plants after infection by Agrobacterium tumefaciens.

Tumor Sample Size (cm) number

% rooting

Control 1

Control Ii

Control III

Antisense iaaM

Antisense iaaH

0.44±0.16a

0.34±0.12bc

0.41±0.15ab

0.2±0.10d

0.31±0.12c

10±4.4a

11±5.0a

12±2.7a

6±3.0b

7±4.0b

0

11

0

16

60

Values with the same letters are not significantly different at 0.05 probability level

111

Table 3.2. Reduction in tumor size and number due to the expression of the antisense iaaM and iaaH genes in tobacco plants

% reduction in tumor Sample Size (cm) number

Antisense 46 45 iaaM

Antisense 16 36 iaaH

112

PCR

J_ iaaM

Ligate

T IaaM

I pGEM-T-iaaM I

I pGEM-T I

EcoRI

Digest with EcoRi

EcoRI

EcoRI Promoter _ L ^ Term

Promoter I pRTL3 j V y Digest with EcoRI

pRTL3-AS-iaaM

Digest with SphI Blunt

P~H wgg/ iTT

Hindill

Ligate

me!

Promotei^r " ^ ^ Term

Digest with Mindiil Blunt

Fig. 3.1. Strategy for the development of the antisense iaaM construct

113

PCR

i IaaH

Ligate

T IaaH

NotI ^ ^ ^ ^ ^ ^ N o t l

f\ I pGEM-T-iaaH I

I pGEM-T I

Digest with NotI Blunt

Xho! P r o m o t e r i ^ ^ P e r m

I pRTL3

i HBB!

Digest with Xhol Blunt

Promoter

Hindill

pRTL3-AS-iaaH

Digest with Hindill

I P L^JdrnZDnZ

Hindill

Ligate

Heei

Promoter^^ " ' ^ T e r m

Digest with Hindill Blunt

Fig. 3.2. strategy for the development of the antisense iaaH construct

114

RTH M

Fig. 3.3. PCR amplification of phytohormone genes from the Ti plasmid of Agrobacterium tumefaciens. Lanes: R: X DNA Eco Rl/ Hind II marker, size on kb; T: amplification of the ipt gene; H: amplification of iaaH gene and M: amplification of iaaM gene.

115

MC

Fig. 3.4. Total RNA and Northern blot analysis of iaaM and IaaH antisense in tobacco. AM: The total RNA from tobacco expressing antisense iaaM; AC: The Total RNA from wild-type tobacco; AH: The Total RNA from tobacco expressing antisense IaaH. BM: antisense /aa/W transcripts hybridize with ^^P-labelle /aa/W gene and BH: antisense /aa/^ transcripts hybridize with ^^P-labelled iaaH gene

116

Fig. 3.5. RT-PCR analysis of iaaM and iaaH antisense transcripts. Lane: R: 1 kb DNA ladder; M: amplification of/aa/W cDNA; H: amplification of iaaH cDNA.

117

Fig. 3.6. Tumor morphology induced by Agrobacterium tumefaciens on tobacco leaf tissue, a; wild-type Xanthi grown from seed; b; wild type Xanthi generated from tissue culture and c; transgenic tobacco expressing glutathione S-transferase gene.

118

Fig. 3.7. Tumor morphology induced by Agrobacterium tumefaciens on trangenic tobacco leaf tissue, a; transgenic tobacco expressing iaaM antisense and b; transgenic tobacco expressing iaaH antisense.

119

CHAPTER IV

CONCLUSIONS

The main objectives of this study were first to characterize the local

isolates of Agrobacterium vitis and test the possibility of using antisense

technology to induce resistance to Agrobatreium infection in transgenic plants. A

vitis is a pathogen, well associated with crown gall disease in grape. The

destruction of several vineyards around Lubbock,TX, was due to high infestation

of Agrobacterium vitis.

Significant variation was obsen/ed at the level of the biochemical tests.

However, local isolates had a narrow host range and most of them had an

octopine-cucumopine Ti plasmid. The T-DNA region containing phytohormone

genes was well conserved among the isolates. This indicates that the local

population of A. vitis is probably of a clonal origin. Since, A. vitis can survive

systemically in healthy grapevine, the introduction of A. vitis into Lubbock area

was probably via plant material from other parts of the country. This indicates

that introduced material from other grape growing areas should be indexed

before planting. This study also showed that the level of infestation varied

between grape cultivars and that the systemic behavior of A. vitis can be

influenced by both the host and the environment.

Tobacco was used as a model to test whether transgenic plants with T-

DNA auxin biosynthetic genes in an antisense orientation would block tumor

120

morphology. The expression of iaaM antisense RNA resulted in an

approximately 46% reduction in the number of tumors. The iaaM anfisense also

affected tumor morphology by reducing tumor size. Plants expressing iaaH

antisense had fewer tumors than the control, but more than 60% of samples

formed roots when infected with Agrobacterium. The incomplete suppression of

tumor formafion may be due to the presense of other loci on the T-DNA that are

also involved in auxin biosynthesis. Although a complete inhibifion of

tumorigenesis was not achieved, the fact that both tumor frequency and

morphology changed, indicate that further manipulation of phytohormone genes

using antisense technology may result in complete resistance to Agrobacterium

tumefaciens species in transgenic plants. It will be interesting to test if the

expression of the entire T-DNA in anfisense orientation will result in a complete

resistance, since gene complementaion will not occur.

121

APPENDIX A

SELCTIVE MEDIA FOR AGROBACTRIUM BIOTYPING

I.D-1 media Per liter

Mannitol 15.0g NaNOs 5.0g LiCI 6.0g Ca(N03)2.4H20 0.002g K2HPO4 2.0g MgS04.7 H2O 0.2g Bromthymol blue O.lg Agar 15.0g The pH is adjusted to 7.2 after autoclaving and should apper dark blue

II.Medium 1A

L(-) arabitol 3.04g NH4NO3 0.16g K2HPO4 1.04g KH2PO4 0.54g Sodium taurochlate 0.29g MgS04.7 H2O 0.25g Agar 15g Crystal violet, 0.1% (w/v) aqueous 2ml Autocleave, cool to about 50 C, then add filter-sterilized cycloheximide: 1.0 ml of 2% solution and Na2Se03: 6.6 ml of 1% solution.

III. Medium 2E

Erythritol 3.05g NH4NO3 0.16g KH2PO4 0.54g K2HPO4 1.04g Yeast extract, 1 % (w/v) aqueous 1 ml Sodium taurochlate 0.29g MgS04.7 H2O 0.25g Agar 15g Malchite green, 0.1% (w/v) aqueous 5ml

122

Autocleave, cool to about 50 C, then add filter-sterilized cycloheximide: 1.0 ml of 2% solution and Na2Se03 : 6.6 ml of 1% solufion.

IV. Rov-Sasser medium

Adonitol NH4NO3 KH2PO4 K2HPO4 Yeast extract, 1 % (w/v) aqueous MgS04.7 H2O Nad H3B03 Agar Chlorothalonil (Bravo 500), 4% (w/v)

4.0g 0.16g 0.7g 0.9g 0.14g 0.2g 0.2g I.Og 15.0g 0.5 ml

Adjust to pH 7.2 before adding agar, autoclave, cool to 50 C and add aseptically after dissolving seoparately in 3 ml of distilled water and after sterilizing: Triphenyltertrazolium chloride 80mg D-cycloserine 20mg Trimethoprim (add 1 drop HCI) 20mg

123

APPEMDIX B

BIOCHEMICAL TESTS

3-Ketolactose test

Inoculate bacterial strains over 1.0 cm-diameter spot on media containing 1% a-lactose, 0.1 yeast extract, and 2% agar. Incubate the plate at 27 C for 2 days. Then flood the agar surface with a shallow layer of Benedict's reagent and place at room temperature. In approximately 1 hour, a yellow ring of Cu20 will form around the cell if 3-Ketolactose is present. Benedict's reagent: 173 g of sodium citrate and lOOg of anhydrous sodium carbonate is disolved in 600 ml of disfilled water with heating. Dissolve 17.3 g of curpric sulfate in 150 ml disfilled water. Slowly add the curpic sulfate solution into a large beaker containing the sodium citrate carbonate solution, while stirring constantly. Dilute to 1 liter.

Growth in ferric ammonium citrate broth

A liter solufion contains (Ferric ammonium citrate lOg, MgS04.7H20 0.5g, K2HP04 0.5g and Cacl2 0.2g). Adjust to pH 7.0 then autoclave. Inoculate the culture tubes and incubate in a stafionary posifion. Biovar 1 strain will produce a reddish brown pellicle at the surface of the medium.

Acid production from Eryhtritol. Melezitose and Sucrose

A liter of basal medium contains (MgS04.7H20 0.2g, K2HP04 1 .Og ,KCI 0.2g, yeast extract I.Og Bromthymol blue, 1% (w/v) in 50% ethanol 3.0 ml) Adjust the pH to 7.1 with 1M NaOH then add 1.5g Agar and autoclave. Add one part of filter-sterilized 10% (w/v) Eryhtritol, Melezitose or Sucrose solufion to 9 parts steril and cooled basal media, then dispense asepfically about 4 ml of medium to sterile tubes. The production of a yellow color in the medium indicates production of acid from oxidafion of Eryhtritol, Melezitose and Sucrose.

Growth in 2% Nad

Inoculate NYB plates containing 2% (w/v) Nad and check for growth

124

Citrate utilization

A liter of basal medium conatins ( NaCI S.Og, MgS04.7H20 0.2g, K2HP04 1.0g, NH4H2P04 1.0g, sodium citrate 2.0g, bromthymol blue, 1% (w/v) in 50% ethanol 15 ml) adjust to pH 6.8 and add 20g of Agar. Dispense the medium in test-tubes, autoclave at 121 C for 15 minutes and slant the tubes to cool. After 24-48 hours, the inoculated medium turns to a deep Prussian blue if citrate has been utilized.

Alkali production from malonic acid

A liter of medium conatins (NaCI 2.0g, K2HP04 1.0g, KH2P04 0.4g, (NH4)2S04 2.0g, yeast extract O.lg, malonic acid, sodium salt 3.0g, bromthymol blue, 1%. Adjust to pH 7.0, dispense 3-4 ml of medium in test tube before autoclaving. Inoculate the medium and incubate at 27 C. the media will turn blue when alkali is produced.

Alkali production from mucic acid, propionic acid and L-tartaric acid

A liter of medium conatins (NaNH4P04 0.5 g, K2HP04 I.Og, KH2P04 0.4g, KCI 0.2g, bromthymol blue, 1%. Adjust to pH 7.0, dispense 3-4 ml of medium in test tube before autoclaving. Then aseptically add 0.5 ml of filter sterilized 1% solution of either L-tartaric acid, mucic acid, or propionic acid previously neutralized with NaoH. After inoculation, incubate at 27 C for about two weeks. The medium will turn blue when alkali is produced.

Opine utilization

A liter of basal medium contains (K2HP04 7.2.0g, KH2P04 2.8g, MgS04.7H20 0.2g, Cad2.2H20 11mg, FeS04 5mg, MnCI2.4H20 2mg) Adjust to pH 7.2 and add 5g of gelrite and autocleave. Then aseptically add 5Mm of the filter sterilized opine tested.

125

APPENDIX C

LIST OF CROWN GALL SAMPLES, HOST AND LOCATION

T a b l e d . Collected galls

Crown gall Culfivars Vinyard

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23

Unknown Unknown Unknown Unknown Merlot Merlot Shardonnay Shardonnay Sauvignian Blanc Shardonnay Shardonnay Shardonnay Sauvignian Blanc Sauvignian Blanc CBSV Shardonnay Shardonnay Shardonnay Sauvignian Blanc Sauvignian Blanc Shardonnay Unknown Unknown

Pheasant Ridge Pheasant Ridge Pheasant Ridge Pheasant Ridge Bill Brown Bill Brown Bill Brown Bill Brown Morris Morris Morris Morris Morris Morris Bobby young Bobby young Bobby young Bobby young Brownfield Brownfield Brownfield Lubbock Lubbock

126

APPENDIX D

TRANSFORMATION AND TISSUE CULTURE MEDIA

MG/L medium

To 800 ml of deionized water, add: 0.5g Mannitol; I.Og L-glutamic acid or 1.15gsodium glutamate; 5.0 tryptophane; 2.5g yeast extract; 0.25g KH2P04; O.lg NaCI; O.lg MgS04.7H20. Mix well and adjust the pH to 7.0 with 1 M NaoH. Adjust the volume to 1L. Add 2.0g Phytagel. Autoclave.

MSA Plates for inoculafion

To 800 ml of deionized water, add 1 bag of Murashige and Skoog BasalSalt, 30g sucrose, 1ml 1000X vitamins B-5, 10 ul ng/ml NAA, 200 ul 5mg/ml BA. Mix well, adjust pH to 7.0. Adjust volume to 1 L. Add 2.0 g phytagel. Autoclave. Pour into 10x200 fissue culture plates.

MSB Plates for shoot and callus formafion

Same a MSA except for the addifion of antibiotics as follows: 50 ug/ml Kanamycin 300 ug/ml Cefotaxime 300 ug/ml Carbenicillin

MSC Plates for root formation

Same as MSB except that no NAA or BA hormones were added. The concentrations of the antibiotics is the same.

127