a novel mutation in the coding region of the prosaposin gene leads

© 2001 Oxford University Press Human Molecular Genetics, 2001, Vol. 10, No. 9 927–940

A novel mutation in the coding region of the prosaposingene leads to a complete deficiency of prosaposinand saposins, and is associated with a complexsphingolipidosis dominated by lactosylceramideaccumulationH. Hulková1,2, M. Cervenková1, J. Ledvinová1, M. Tochácková1, M. Hrebícek1, H. Poupetová1,A. Befekadu1, L. Berná1, B.C. Paton3, K. Harzer4, A. Böör5, F. Šmíd6 and M. Elleder1,+

1Institute of Inherited Metabolic Disorders, Charles University, First Faculty of Medicine, Ke Karlovu 2,128 08 Prague 2, Czech Republic,2Institute of Pathology, Charles University, First Faculty of Medicine,Studnickova 2, 128 00, Prague 2, Czech Republic, 3Department of Chemical Pathology, Women’s and Children’sHospital, North Adelaide, SA 5006, Australia, 4Institute for Brain Research, University of Tübingen, D-72070Tübingen, Germany, 5Institute of Pathology, P.J. Šafarík University, Faculty of Medicine, Košice, Slovakia and61st Medical Department—Clinical Department of Haematology and Nephrology, Charles University, First Facultyof Medicine, U nemocnice 2, 128 08 Prague 2, Czech Republic

Received 3 January 2001; Revised and Accepted 21 February 2001 DDBJ/EMBL/GenBank accession no. AF307850

A fatal infantile storage disorder with hepatospleno-megaly and severe neurological disease isdescribed. Sphingolipids, including monohexo-sylceramides (mainly glucosylceramide), dihexosyl-ceramides (mainly lactosylceramide), globotriaosylceramide, sulphatides, ceramides and globotetraosylceramide, were stored in the tissues. In general,cholesterol and sphingomyelin levels were unaltered.The storage process was generalized and affected anumber of cell types, with histiocytes, which infiltrateda number of visceral organs and the brain, especiallyinvolved. The ultrastructure of the storage lyso-somes was membranous with oligolamellar, mainlyvesicular, profiles. Infrequently, there were Gaucher-like lysosomes in histiocytes. The neuropathologywas severe and featured neuronal storage and losswith a massive depopulation of cortical neurons andpronounced fibrillary astrocytosis. There was apaucity of myelin and stainable axons in the whitematter with signs of active demyelination. Immuno-histochemical investigations indicated that saposinsA, B, C and D were all deficient. The patient washomozygous for a 1 bp deletion (c.803delG) withinthe SAP-B domain of the prosaposin gene whichleads to a frameshift and premature stop codon. Inthe heterozygous parents, mutant cDNA was detectedby amplification refractory mutation analysis in thenuclear, but not the cytoplasmic, fraction of fibroblastRNA, indicating that the mutant mRNA was rapidly

degraded. The storage process in the probandresembled that of a published case from an unrelatedfamily. Saposins were also deficient in this case,leading to its reclassification as prosaposin deficiency,and her mother was found to be a carrier for the samec.803delG mutation. Both of the investigated familiescame from the same district of eastern Slovakia.

INTRODUCTION

Prosaposin (PSAP) is a polyfunctional highly conservedglycoprotein. The human PSAP gene is located on chromo-some 10 (10q22.1) (1) and probably spans >39 kb (2,3).Published sequences cover the promotor region plus exons 1 (3)and 2–14 (2). The PSAP mRNA encodes a 70 kDa polypeptidecontaining a signal peptide in addition to four homologoussphingolipid activator protein (SAP or saposin A, B, C and D)domains (2–5). In humans, an alternative splicing of exon 8(within the SAP B domain) gives rise to three protein isoforms(524, 526 or 527 amino acids), with intracellular transport ofthe PSAP being isoform-dependent (6), but with little impactof the isoform on substrate turnover (7), despite effects on thebinding affinity for sphingolipids of SAP B (8). Thoughubiquitous, the level of PSAP expression in mammals is variable(4,9–14) and in rodents its expression was shown to be underdevelopmental control (9–11).

The targeting and processing of PSAP varies in a tissue/cell-specific manner. Firstly, newly synthesized PSAP can enter theacidic endocytotic compartment via a mannose-6-phosphate-independent (15), but PSAP sequence-dependent (16) processin association with sphingolipids (17) and procathepsin D

+To whom correspondence should be addressed at: Institute of Inherited Metabolic Disorders, First Faculty of Medicine and University Hospital, Ke Karlovu 2,Bldg D, Division B, 128 08 Prague 2; Tel: +420 2 2491 8283; Fax: +420 2 2491 9392; Email: [email protected]

928 Human Molecular Genetics, 2001, Vol. 10, No. 9

(18,19). Once in the lysosome, the dissociated mature protease,cathepsin D, participates in the maturation of PSAP (20).Alternatively, PSAP is secreted into a variety of extracellularfluids (10,21,22) and subsequently targeted to the lysosomalcompartment via receptor-mediated endocytosis (23).

The precursor PSAP has many functions. Firstly, its bindingaffinity for gangliosides suggests that it has a role inglycosphingolipid transport (24). In extracellular fluids it mayalso act as a PSAP reservoir for surrounding tissues. Like thesaposins it can facilitate enzymatic hydrolysis of certain sphin-golipids (24) and it can also promote glycosphingolipidsynthesis (25,26). A significant portion of PSAP is associatedwith gangliosides in the plasma membranes of neurons (27,28)and it has been shown to have neurotrophic, neuroprotectiveand reparative effects (29–34) as well as being myelinotrophic(35). At least in rodents, PSAP is thought to have specific

effects on the development, maintenance and differentiation ofmale reproductive organs and may also play a role in lysosomalresidual body degradation in Sertoli cells (36).

The saposins are important cofactors for the lysosomaldegradation of sphingolipids and function by either activatingthe enzyme or solubilizing the substrate (37–41). The presenceof mutations in both the SAP C (42,43) and SAP B (44–49)domains of PSAP has confirmed the critical role played bythese saposins in sphingolipid hydrolysis.

To date, a complete deficiency of human PSAP has beendescribed only in a single family (50,51), with the affectedindividuals being homozygous for a point mutation in the initi-ation codon of the PSAP gene (52). A mouse knock-out modelfor PSAP deficiency (PSAPD) (53,54) showed very similarbiochemical features to the human disorder. We now presentclinical, neuropathological, ultrastructural, histochemical,biochemical and molecular findings on a new case of completePSAPD caused by a novel mutation within the SAP B domainof the PSAP gene. In addition, we also present evidence forreclassification of the case previously described as a lactosyl-ceramide (LacCer)-storing variant of Niemann–Pick type C (NPC)(55) as PSAPD.

RESULTS

Structural and histochemical findings

In patient PD1 (Materials and Methods) the storage processwas predominantly expressed in the numerous macrophagesinfiltrating the spleen red pulp, liver sinusoids, adrenal cortex(especially the reticular zone) and pulmonary alveoles. Theircytology varied from a foamy to almost solid appearance withvariantly expressed cytoplasmic Gaucher-like striations. Thespleen was also rich in multinucleated storage histiocytes.Storage was histologically detectable in hepatocytes, renaltubular cells, glomerular podocytes, adrenal cortex (moretowards the medulla), spleen sinus endothelium, brain neuronsand in skin eccrine glands. Electron microscopy revealed variablestorage in the vascular endothelium (most pronounced in thebrain and just detectable in the heart capillaries), in fibrocytes,adipocytes, dermal Schwann cells and pancreas acinaryexocrine cells, but more in the interlobular pancreatic ductulesand in endocrine islet cells. The skin nerves contained well-myelinated fibres. The epidermis of the trunk was histologicallypractically normal with several loose keratin layers. The onlyunaffected cell type was cardiocytes.

The ultrastructure of the deposits was pleiomorphic andmembranous (Fig. 1). Gaucher-like tubules were seen inmacrophages intermingled with non-specific storage lyso-somes (Fig. 1A). Frequently there were oligolamellar anularformations ∼200 nm in diameter, which were often clustered(Fig. 1B). In some locations larger angulated deposits (especiallyin the glial cells) (Fig. 1C) or discrete spicules (in splenicmacrophages) were seen, suggesting the presence of a crystalizedlipid. The lysosomes varied greatly in size from <1 to 3 µm.The cerebral cortex (Fig. 2A) contained numerous reactivefibrillary astrocytes (strongly GFAP positive) (Fig. 2B) andlipid phagocytes (strongly stained with CD 68) (Fig. 2C) butthere was a striking paucity of neurons (Fig 2A, insert). Theneurons and lipid phagocytes displayed strong storage,whereas storage in the astrocytes was only detectable by

Table 1. Cholesterol, sphingomyelin, ceramides and glycosphingolipid/sphingomyelin (GSL/SM) ratios in tissues of PSAP-deficient and NPCpatients

aResults are expressed in µmol cholesterol per gram of tissue wet weight.bResults are expressed as µmol sphingomyelin phosphorus per gram of tissuewet weight.cResults are expressed in µg of ceramide per gram of tissue wet weight.dRatio of total neutral glycosphingolipids and sulphatides (GSLs) tosphingomyelin (SM).ePatients as designated in Materials and Methods; NCL is a pathological control.fAge-matched control to PD1 and PD2.gNot estimated due to the lack of material for analysis.

Tissue Cholesterola Sphingomyelinb Ceramidesc GSL/SMd

Kidney

PD1e 11.5 3.0 944 2.3

Controlf 9.5 1.4 164 0.6

Spleen

PD1e 9.8 2.1 903 5.0

PD2e 9.6 2.5 1083 4.9

NPC1e 43.6 14.9 160 0.3

Controlf 8.5 2.0 140 0.1

Liver

PD1e 9.4 1.8 1942 5.4

PD2e NEg 2.5 NEg 2.4

PD3e 7.4 2.3 852 2.2

NPC1e 17.3 5.9 344 0.3

Controlf 8.9 1.8 148 0.1

Adrenal

PD1e 19.7 7.3 1030 2.0

NPC2e 38.3 2.5 150 0.2

NCLe 59.3 1.8 166 0.2

Brain gray matter

PD1e 39.2 2.6 244 2.7

NPC1e 43.1 6.2 108 0.4

Controlf 22.4 1.7 148 0.3

Human Molecular Genetics, 2001, Vol. 10, No. 9 929

electron microscopy. The white matter was astrogliosed andinfiltrated with storing lipid phagocytes and, when comparedwith age-matched controls, axons (detected with Bodian) andmyelin (absence of myelin birefringence and negative forSpielmayer staining) were both depleted, with the myelin,which was only rarely seen around persisting axons, showing agreatly reduced number of layers. The sample of basal gangliadisplayed similar changes (massive fibrillary gliosis, paucityof myelin, excess of lipid phagocytes) but with a lesspronounced loss of neurons (ballooned with storage).

Lipid histochemistry showed an excess of neutral glycolipids.The staining for phospholipids was just detectable. Birefrin-

gence of the stored lipids ranged from minimal (macrophages,hepatocytes and neurons) to readily discernible (adrenal cortexand renal tubules). There was prominent accumulation ofsulphatides in the renal tubules, mimicking the situation insulphatidosis. Brain glial phagocytes were slightly stained withOil red O but rich in cholesteryl ester solid crystals.

SAP immunohistochemistry gave completely negative resultsfor all examined tissues, i.e. lung, kidney, spleen, liver and brain(Fig. 3, liver and brain), whereas controls from normal individ-uals and patients with unrelated lysosomal diseases were allimmunoreactive. There was some non-specific staining ofhypertrophic astroglia, a well known drawback of the combined

Figure 1. Ultrastructure of storage material in patient PD1. (A) Spleen macrophage with fusiform lysosomes containing loose Gaucher twisted tubules (arrow-heads). (B) Membranous concentric bodies and the dense membranous network in lysosomes of adrenal cortical epithelial cell. (C) Large crystalloid deposits in abrain cortical storage, most probably glial phagocyte, cell. (D) Massive endothelial storage with vesicular membranous deposits in a brain cortical microvessel.Magnification: (A, B and D) × 24 000; (C) × 5000.


antibody against SAPs A plus D (J. Tyynella, personal commu-nication). Immunolabeling of Cathepsin D showed elevatedstaining of storage cells, consistent with its lysosomal localiza-tion (data not shown) and indicating that the deficiency ofPSAP did not prevent lysosomal targeting of procathepsin D.

Biochemical results

Cholesterol levels were almost normal in all extraneural tissuesof PD1, thereby excluding the suspicion of NPC disease (Table 1)

with the increase seen in brain derived from cholesterol esters,mentioned in the Discussion. Apart from the adrenal tissue,where it was increased three-fold, sphingomyelin was notgreatly changed (Table 1), again differing from NPC patients.Instead, there was a massive general increase in shorterglycosphingolipids in all tissues analyzed, especially glucocerebro-side (GlcCer) (Fig. 4A and B, kidney, brain and adrenals) andLacCer (Fig. 4B, adrenals; Fig. 5A, whole tissue series). In thekidney, large accumulation of galactocerebroside (GalCer)

Figure 2. Brain cortex pathology of patient PD1. (A) Survey of the dense cortical cellular population consisting solely of astrocytes and glial phagocytes; H&E × 65.Inset: isolated surviving neuron exhibiting storage; H&E × 120. (B) Dense population of fibrillary astrocytes revealed by immunostaining for GFAP × 120. (C) Glialphagocytes distended by storage detected by immunostaining for CD68 × 120.


(Fig. 4A) and sulphatides (Fig. 4C) was found. Immunodetec-tion confirmed that LacCer was the main component of theceramide dihexoside fraction (Fig. 5A), with its concentrationbeing highest in the adrenal gland and spleen. The ceramidetrihexoside fraction, which contained globotriaosyl ceramide(Gb3Cer) (Fig. 5B), was also increased, with the highestamounts found in the kidney and adrenals (Figs 4B and 5B).The total concentration of simple glycolipids was significantlyhigher than sphingomyelin in PSAPD tissues, againcontrasting with NPC samples (Table 1), and ceramides wereincreased several-fold in kidney, spleen and liver (Table 1).The ganglioside pattern in the gray and white matter of PD1

was notably changed with an increase in monosialoganglio-sides GM1, GM2 and GM3, accompanied by a virtual absence ofpolysialogangliosides (data not shown).

Molecular findings

As only a very limited amount of the patient’s genomic DNAwas available from blood spots, initial mutation screening wasundertaken on his parents. The promotor region and all exonsand intron/exon boundaries of the PSAP gene were sequencedfrom PCR products amplified from genomic DNA. Bothparents carried a single base deletion (c.803delG) in exon 9(Fig. 6A) which was confirmed by amplification refractory

Figure 3. Saposin immunohistochemistry (patient PD1). Note the strong immunostaining for saposins in control tissues (A, C and E) contrasting with lack ofstaining in the patient’s tissues (B, D and F). Immunostaining of brain cortex for SAPs A plus D (A and B), and of liver for SAP B (C and D) and SAP C (E andF). Sections were counterstained with hematoxylin × 120 (A and C–F) and × 130 (B). The slight residual staining of astrocytes in B is non-specific (see main text).


mutation system (ARMS) analysis (Fig. 6B). The PCR productcontaining the heterozygous mutation was cloned and clonescontaining each of the alleles were sequenced. No other differ-ences from the published sequences were found in thesequenced parts of the gene, with the exception of the promoterregion and exon 1 (see below). Subsequently, the patient wasshown to be homozygous for the c.803delG mutation bysequencing of PCR products and by ARMS (Fig. 6B). Thec.803delG mutation leads to a frameshift followed by a prematurestop codon 27 bases later.

Direct sequencing of overlapping RT–PCR products did notreveal any abnormalities in the region harboring the mutationfor either of PD1’s parents, nor was the mutant allele detectedby ARMS analysis of their cDNA (prepared from total RNA),even after 80 rounds of amplification (Fig. 6C). However, afteronly 35 amplification cycles both mutant and wild-type alleleswere detected in cDNA prepared from the nuclear, but not thecytosolic, fraction of the parental cell lines (Fig. 6C).

The sequence of the promotor region and exon 1 differed inboth parents from the published sequence in a number ofpositions. Sequencing of genomic DNA from 10 unrelatedhealthy control subjects gave identical sequencing results tothat of the investigated parents. The changes in the promoterregion do not affect the presumed regulatory domains.However, at the 3′ end of exon 1 the published sequence

contained three additional nucleotides which were not present inour data (data not shown). Based on our results, we have re-positioned the exon/intron boundary, the proposed new splicesite corresponding well with the consensus splice site. Ourrevised sequence data for the promoter region and exon 1 hasbeen submitted to Genbank (accession no. AF307850).

Revised diagnosis for the case previously thought to be aLacCer-storing variant of NPC (55)

The sphingolipid storage observed in PD2 (Table 1 and Fig. 5)displayed identical features to that found in PD1 (Table 1, Figs 4and 5), and all of the saposins were immunohistochemicallyundetectable. DNA from the mother of PD2 showed that shewas a carrier for the same PSAP mutation as found in PD1(c.803delG). The families of PD1 and PD2, who denied anyrelationship, both live in eastern Slovakia near Kosice invillages ∼20 km apart.

DISCUSSION

Our pathological findings for patient PD1 led to molecularanalysis of his PSAP gene with the subsequent identification ofa homozygous c.803delG mutation within the SAP B domain,the resulting frameshift introducing a premature stop codon.

Figure 4. Analysis of sphingolipids in tissues from patient PD1. Chromatography was performed as described in Materials and Methods [sodium tetraborateimpregnation was used in (A)]. Aliquots of 2.5 mg (adrenal) or 5.0 mg (kidney and brain) of tissue (wet weight) were applied to the plates. Findings are as follows:(A) Kidney and brain white matter: accumulation of gluco- and galactocerebrosides; (B) Adrenal gland: accumulation of simple ceramide hexosides (mono-, di- andtrihexosides); (C) Kidney: Accumulation of sulphatides. S, standards; S1, GlcCer and GalCer; S2, sulphatides; S3, GalCer standard (double band); S4, GlcCer,GalCer, LacCer, Gb3Cer and Gb4Cer; C, control; NPC2, Niemann–Pick type C2; P, patient PD1.


The identified deletion would be expected to disrupt expres-sion of full-length SAP B as well as preventing expression ofthe more 3′ PSAP domains encoding SAPs C and D. Immuno-histochemical investigations indicated that, in addition to adeficiency of saposins B, C and D, SAP A was also deficient intissues from PD1. The absence of all four saposins is supportedby our molecular investigations in cells from the parents ofPD1. Whereas both the mutant and wild-type alleles could bedetected in cDNA prepared from the nuclear fraction, only thewild-type allele was detected in cDNA prepared from thecytosolic fraction, indicating specific loss of the mutantmRNA, presumably through the process of nonsense-mediatedmRNA decay (56). The lack of cytosolic mRNA from themutant allele predicts that, in addition to a deficiency of theindividual saposins, the PSAP precursor protein, with itsneurotrophic and other functions, will also be deficient inpatient PD1.

At the biochemical level, the characteristic feature of ourpatients was a generalized lipid storage of unusual complexity;the spectrum of stored lipids being consistent with the absenceof PSAP-derived saposins. Elevated levels of ceramide havebeen reported for both human and mouse PSAPD (51,53) andturnover studies demonstrated that its hydrolysis could berestored by addition of SAP D (57,58). In PD1 and PD2, a 4–10-fold increase in free ceramides was found in all examinedextraneural tissues. However, it is probable that the reducedturnover of glycosphingolipids (see below) moderated its accu-mulation. Ceramide accumulation was most marked in theliver of PD1, where there was also a high proportion of the

slower migrating fraction (∼20%) with an Rf corresponding tothe hydroxy fatty acid (HFA)-ceramide standard. This fractionwas not observed in the other PSAPD tissues examined here,nor in the liver of the PSAPD fetus investigated by Bradová et al.(51), and its composition is currently being characterized.Accumulation of GlcCer was prominent in all examined

Figure 5. Immunodetection of LacCer and Gb3Cer in tissue extracts fromPSAPD cases and controls. Tissues were extracted, chromatographed andimmunolabeled for LacCer (A) or Gb3Cer (B) as described in Materials andMethods. Aliquots of 0.1 mg (A) or 1 mg (B) of tissue (wet weight) wereapplied except for the liver of PD3 patient (fetal) and spleen of PD2 patient,where 0.05 mg was used for anti-LacCer immunostaining. K, kidney; S,spleen; L, liver; BG, brain gray matter; A, adrenal; Gb3, Gb3Cer standard; Lac,LacCer standard; FD, Fabry disease; PD1 and PD2, PSAPD patients; PD3,PSAPD fetus as designated in Materials and Methods.

Figure 6. Molecular investigations of PSAP genomic (g) and cDNA for mem-bers of the family of PD1. (A) Sequencing of cDNA and genomic (g) DNAfrom one of PD1’s parents, showing that the parent was heterozygous for thec.803delG mutation (bottom) but that the mutant allele was not detected in thecDNA (top). (B) ARMS analysis for c.803delG on genomic DNA. Upper PCRproducts (661 bp) are amplification controls. Lower PCR products (433 bp) arenormal (odd numbered lanes) and mutant (even numbered lanes) alleles forPSAP. Samples: lane M, molecular weight markers; 1 and 2, mother; 3 and 4,father; 5 and 6, proband PD1; 7 and 8, chorionic villi from third pregnancy; 9and 10, control; 11, blank control for amplification. (C) ARMS analysis forc.803delG in nuclear and cytoplasmic cDNA fractions. Upper PCR product(1090 bp) is an amplification control. Lower PCR products (830 bp) are normal(odd numbered lanes) and mutant (even numbered lanes) alleles for PSAP.Samples: lane M, molecular weight markers; 1 and 2, mother’s nuclear cDNA;3 and 4, mother’s cytoplasmic cDNA; 5 and 6, father’s nuclear cDNA; 7 and 8,father’s cytoplasmic cDNA; 9 and 10, control nuclear cDNA; 11 and 12, controlcytoplasmic cDNA; 13, blank control for amplification.


tissues from PD1 and correlated with the presence of storagehistiocytes, the only cell type affected in Gaucher disease. Itsstorage can be explained by the absence of SAP C, a knownactivator of β-glucocerebrosidase, with cases of isolated SAP Cdeficiency (59,60) showing a phenotypic range similar toGaucher disease patients, where the primary defect is in theenzyme β-glucocerebrosidase. GalCer was abnormallyincreased in the kidney, similar to human and animal models ofKrabbe disease (61,62). In contrast to Krabbe patients, we alsofound some increase in GalCer in PSAPD brain white matter,despite the hypomyelination which is thought to prevent itsaccumulation in patients with a defective enzyme. Accumula-tion of GalCer can probably be attributed to the loss of SAPs Aplus C, since the deficient turnover of this sphingolipid inPSAPD fibroblasts could be partially corrected by the additionof either of these saposins (63). The most conspicuous abnor-mality in the glycolipid pattern was the accumulation ofLacCer, which was elevated 25–40-fold in all affected tissues.LacCer can be hydrolysed by both β-galactosylceramidase andβ-galactosidase and, as discussed previously (64), its massiveaccumulation in PSAPD suggests that both of these activitiesare impaired, a view supported by the accumulation of LacCerin mice genetically deficient in both of these enzymes (65).The observation is also consistent with the role of SAP B infacilitating LacCer hydrolysis by β-galactosidase (64) whileactivation of β-galactosylceramidase is dependent on SAP Aand/or C. The hydrolysis of Gb3Cer is known to be dependenton SAP B (66,67), its marked storage in the kidney and thenotable storage in the vascular endothelium fitting well withthe storage pattern in Fabry disease (FD) (68). There was alsono detectable storage in cardiocytes, commonly affected in FD,even when storage in other tissues is absent (69,70). Anotherdiscrepancy was the prominent accumulation of Gb3Cer inthe adrenal cortex, which is not affected in classical FD(M. Elleder, unpublished data). A possible explanation for thedifferences may be the cumulative impact of blocks in multipledegradative steps within the lysosomal compartment inPSAPD. Decreased turnover of Gb3Cer has been confirmed incultured PSAPD skin fibroblasts (64). Sulphatides wereincreased 10-fold in the kidney of PD1. This, together with the

histochemical findings, mimics the storage pattern in meta-chromatic leukodystrophy (71) and is consistent with theknown role of SAP B in hydrolysis of sulphatide, as evidencedin isolated SAP B-deficiency (72,73). There was no sign ofhistochemical sulphatide storage in brain glial phagocytes,probably due to the paucity of cerebral myelin. The brainganglioside pattern was changed substantially in PD1 withincreases in GM1, GM2 and GM3 gangliosides. This contrastedwith the nearly normal ganglioside pattern seen in the fetalcase of PSAPD (51). This variance might reflect the differencein developmental age of the two cases, although an effect offormaldehyde fixation cannot be excluded in our case. Incontrast to the brain, GM3 and GM2 gangliosides were increasedin liver from the fetal PSAPD case (51) and monosialoganglio-sides were also elevated in brain from the PSAP knock-outmouse (53). Although turnover studies in PSAPD and SAPB-deficient fibroblasts did not support the previously heldview that SAP B facilitates GM1 ganglioside degradation, theydid indicate that SAP B facilitates the degradation of GM3ganglioside (74), a view that was supported by in vitro studies(75). The accumulation of other gangliosides in PSAPD tissuesmay be secondary to the block in GM3 ganglioside turnover.The generally normal levels of sphingomyelin were consistentwith earlier reports for human and mouse PSAPD (50,53,64).

One of the most remarkable aspects of the disease process inPD1 was the pronounced neuronal depletion, particularly in thecortical region, which was populated by abundant glial phago-cytes and fibrillary astrocytes, suggesting a destructive/repara-tive sequence of events, the former strongly resembling thesituation in neuronal ceroid lipofuscinosis (NCL) type 1caused by protein palmitoyl thioesterase (PPT)-deficiency(76). Common to both disorders is the fact that both PPT andPSAP are under developmental control in neural tissues, whichsuggests a role in the development and maintenance of neurons(9,11,77). The destructive neuronal process may be facilitatedby the absence of PSAP’s known neurotrophic functions, andthe prominent astrocytic reaction is consistent with PSAP’ssuppression of the glial reaction after wounding (34). Thepronounced paucity of cerebral myelin may be due to a combin-ation of hypomyelination and demyelination. The absence of

Table 2. Diagnostic indicators for PSAP deficiency

aUrine is recommended as one of the samples for early investigation—lipids in urine should reflect kidney storage with the likelihood that Cer is elevated inaddition to the elevation in sulphatide, LacCer and Gb3Cer already noted for SAP-B deficiency (93).bKidney, liver and adrenal cortex are the most useful tissues for diagnosis postmortem.cProvided that any defective PSAP-derived proteins which are expressed are not immuno-cross-reactive.

Feature/test Sample Comments

Cytology, storage bodies Fibroblasts, biopsy and postmortemtissues and bone marrow aspirate

Foamy storage cells; storage macrophages may include Gaucher-like bodies;lysosomal pleomorphic/oligolamellar vesicular structures

Sphingolipid analysis Urinea, biopsy and postmortemb tissuesand fibroblasts

Storage of multiple sphingolipids, but not of sphingomyelin or cholesterol; LacCeruniversally stored; tissue dependent storage of Cer, GlcCer, GalCer,Gb3Cer andsulphatide; increased glycosphingolipid/sphingomyelin ratio in visceral organs;variable altered pattern of brain gangliosides

Sphingolipid hydrolase assays Fibroblasts and leukocytes Reduced activities of galactocerebrosidase, glucocerebrosidase and ceramidase

Sphingolipid turnover Fibroblasts Reduced turnover of Cer, GalCer, LacCer, Gb3Cer and sulphatide

SAP immunoreactivity Fibroblasts, leukocytes, biopsyand postmortem tissues

Lack of PSAP and SAPs A, B, C and Dc


the myelinotrophic effects of PSAP (35) would be consistentwith hypomyelination; however, delayed myelination has alsobeen observed in unrelated lysosomal disorders (78), so itcould be a non-specific effect. The cholesteryl ester accumula-tion in glial phagocytes clearly supports the case for demyelin-ation.

This report consolidates and, particularly in relation to itsneuropathology, extends our knowledge of human PSAPD. Inaddition, it has at last provided a definitive diagnosis forpatient PD2. This patient was previously diagnosed as a variantof NPC (55), because she had a similar neutral glycolipidstorage pattern to an earlier case of lactosylceramidosis (79),which was subsequently shown to have NPC (80,81).However, in the case of PD2, the excessive accumulation ofLacCer is now attributed to PSAPD.

Our findings have highlighted the need to consider the possi-bility of PSAPD in the differential diagnosis of neonatalpatients with severe neurological manifestations and spleno- orhepatosplenomegaly resembling infantile Gaucher disease(Table 2). Ultrastructural and biochemical investigationswhich should aid in the diagnosis of PSAPD are indicated inTable 2. The levels of sphingomyelin, cholesterol, ceramideand the ratio of glycosphingolipids to sphingomyelin may beparticularly helpful in distinguishing cases of PSAPD fromNPC (Table 1) (82) or other disorders where LacCer is alsoincreased. If a suspicion of PSAPD is raised, the above investiga-tions can be followed by more specific indicators of PSAPD,such as immunochemical detection of PSAP or saposins (onlyinformative if not detected; Table 2) and/or molecular analysisof the PSAP gene, the latter giving ultimate confirmation of aPSAP defect. It must also be noted that patients with mutationswhich result in only a partial deficiency of PSAP, or whichimpact on only certain domains encoded by the PSAP gene,would not be expected to show the full spectrum of featuresseen when PSAP is totally deficient.

Cumulative evidence from three unrelated families indicatesthat a total deficiency of PSAP is associated with a rapid andfatal course with severe neurovisceral manifestations alreadyevident at birth. The pathology may stem from a deficiency notonly of saposins, with their additive effects on the hydrolysisof a number of sphingolipids, but also of the precursor proteinwith its independent functions. Finally, our data indicate thatthere is an increased incidence of this extremely rare disorderin a small district in Eastern Slovakia, suggesting the existenceof a genetic isolate.

MATERIALS AND METHODS

Patients

The first patient (PD1), a male (46XY), was the product of thesecond pregnancy of unrelated parents, their previouspregnancy having resulted in a spontaneous abortion duringthe first trimester. He was born by section, at term, after anuneventful pregnancy. He weighed 3420 g, was 51 cm inlength and had an Apgar score of 9/10/10. At birth, moderatehepatomegaly and splenomegaly (4 cm below the costalmargin) were apparent and generalized seizures developedwithin minutes. Routine biochemical, hematological andmicrobiological analyses gave normal results, but brain sono-graphy revealed a diffuse periventricular and cortical atrophy

as well as signs of atrophy in the brain stem and cerebellum.Microcephalus, atrophy of the optical nerve, a subcapsularcataract, a right-sided hydrocoela and a non-descendent lefttestis were additional findings. The skin was macroscopicallyunremarkable. During the neonatal period the patient, who wasnever fully conscious, never cried and often developed seizuresin response to tactile stimuli. He died at the age of 3.5 months.Formalin-fixed (10% formaldehyde for one year) tissues(spleen, liver, lung, adrenal cortex, kidney, skin, pancreas, andbasal ganglia and cortex) and a blood spot were available foranalysis. His parents were not related in the previous threegenerations, but both came from the same region of easternSlovakia near Košice. Cell cultures were established from skinbiopsies taken from the parents and from the chorionic villusand amniotic fluid samples collected from the parents’ nextpregnancy. The family’s medical history, including that for theprevious three generations, was unremarkable with the exceptionof the mother’s sister, who suffered from epilepsy. All investiga-tions were carried out with the family’s informed consent.

As part of our study we also reviewed a second patient(PD2). The clinical history of this female patient, who died inthe neonatal period, has been published (55). She was thoughtto have a variant form of NPC with enhanced glycolipid(including LacCer) storage. However, only formalin-fixedspleen and maternal fibroblasts were available for biochemistry.For comparative purposes, liver from the original PSAPD fetus(PD3) (50) as well as samples from confirmed cases of NPCfrom two different complementation groups (NPC1 andNPC2), NCL and FD were also examined, together with aseries of tissues from normal heathy controls (accidentaldeaths).

Tissue culture

Skin fibroblasts were cultured according to routine proceduresin Dulbecco’s modified Eagle’s medium (Gibco BRL, LifeTechnologies GmbH) with 10% fetal calf serum (Gibco BRL,Life Technologies GmbH) in 25 cm2 culture flasks.

Structural and histochemical analyses

Frozen sections were prepared from fixed tissues for lipidhistochemical investigations. The sections were stained withSudan black B, Fettrot FB, ferric hematoxylin (for phospho-lipids), cresyl violet (for sulphatides and acidic lipids) and PASwith and without prior extraction with chloroform:methanol(C:M; 2:1; v/v) (glycolipids seen in non-C:M extractedsamples), and unstained sections were analysed for birefrin-gence (83). Paraffin sections were used for neuropathologicalstudies and examined using Oil red O, hematoxylin and eosin(H&E), Bodian and modified Spielmayer stains.

Immunodetection of saposins was done on paraffin sectionsusing antibodies recognizing SAP A plus D (rabbit anti-INCL-antiserum provided by Dr Jaana Tyynelä, Helsinki, Finland)(84), SAP C (rabbit antibody provided by Dr Helen Christo-manou, Athens, Greece) and SAP B (goat antibody providedby Prof. K. Sandhoff, Bonn, Germany). The paraffin sectionswere stained after deparaffination, hydratation and proteolyticpretreatment (20–30 min, 37°C) with 0.1% w/v trypsin for SapB detection, 4% w/v pepsin for detection of SAP A plus D (84)or without proteolytic pretreatment for optimal detection ofSAP C. Detection of bound primary antisera was achieved


using a Universal DAKO LSAB peroxidase kit with 3,3′-diaminobenzidine as substrate. Macrophages (including theglial ones) and astrocytes were detected using the monoclonalanti-human CD68 (clone PG-M1) and monoclonal anti-humanglial fibrillary acidic protein (GFAP) (clone 6F2), both from

DAKO, respectively. Cathepsin D was detected using rabbitanti-human antibody (DAKO).

For electron microscopy, samples were postfixed withosmium tetroxide, dehydrated with ethanol and then embeddedin Araldite–Epon mixture.

Table 3. Primers for amplification of PSAP genomic DNA and cDNA and for ARMS analysis for c.803delG mutation

Exon Primer name Primer sequence (5′→3′) Annealingtemperature (°C)

Size of PCRproduct (bp)

Primers for amplification of PSAP genomic DNA

1 PSAP-g1S-T7 AATACGACTCACTATAGGGGCTTTTCTTTTATGACCTT 59 410

PSAP-g6A-RP CAGGAAACAGCTATGACGACGCTGCGAGGGTCAAATCCT

2 PSAP-g7S-T7 AATACGACTCACTATAGCTGGGGAAATAAGTCAGGTCG 61 434

PSAP-g7A-RP CAGGAAACAGCTATGACCTGAGCCTCCATCTCCTCTG

3 PSAP-g8S-T7 AATACGACTCACTATAGAGTCACACCTCTTCCCTC 61 467

PSAP-g8A-RP CAGGAAACAGCTATGACTATACGGCTCATATACCCTAA

4 PSAP-g9S-T7 AATACGACTCACTATAGGCTGTTTTCCAGGCTTGGTT 61 518

PSAP-g9A-RP CAGGAAACAGCTATGACTTACATTCCTTCAGCAGTCCG

5 PSAP-g10S-T7 AATACGACTCACTATAGAGGGACTAATTCAGAGGCACT 61 419

PSAP-g10A-RP CAGGAAACAGCTATGACGCCCCAGTTTAAGAACCAC

6 PSAP-g11S-T7 AATACGACTCACTATAGATTTGAGAGCCTGTAAAGCAT 61 379

PSAP-g11A-RP CAGGAAACAGCTATGACCCTACTCCAGCCTCCACA

7 PSAP-g12S-RP CAGGAAACAGCTATGACGGCCCAGAGCAGACATT 60 363

PSAP-g12A-T7 AATACGACTCACTATAGGCCCAATTCAGCACTCTAAG

7B PSAP-g13S-T7 AATACGACTCACTATAGAGAGCATTTCCCCTGAACCT 60 336

PSAP-g13A-RP CAGGAAACAGCTATGACAGCCCTCCCCAGCCTAT

8 PSAP-g14S-T7 AATACGACTCACTATAGGGAGAGGGAGGTAGC 60 457

PSAP-g14A-RP CAGGAAACAGCTATGACCATTAGTATAGGGGATAGGA

9 PSAP-g15S-T7 AATACGACTCACTATAGCTTTAGGGGAGCAAGACCAA 60 332

PSAP-g15A-RP CAGGAAACAGCTATGACTCCACGAGATGGGGACA

10 + 11 PSAP-g16S-T7 AATACGACTCACTATAGAACGGCACCCACCATTGAC 60 758

PSAP-g16A-RP CAGGAAACAGCTATGACTTCAGGTTGCTTCCCCCAGT

12 + 13 PSAP-g17S-RP CAGGAAACAGCTATGACTCAGGGAACAGTGTATCCAG 60.5 787

PSAP-g17A-T7 AATACGACTCACTATAGGGGACCATGAGTAAGCCTAA

14 PSAP-g18S-T7 AATACGACTCACTATAGCTAGGACAAGAGAACAGGT 60.5 1292

PSAP-g18A-RP CAGGAAACAGCTATGACTTTAGTGCAAAACAAAAATC

Primers for amplification of PSAP cDNA

1 PSAP-cDNA1S-RP CAGGAAACAGCTATGACCGCTATGTACGCCCTCTTCCTC 65.2 960

PSAP-cDNA1A-T7 AATACGACTCACTATAGGCTGGGACCTCGTGCTTCTT

2 PSAP-cDNA2S-T7 AATACGACTCACTATAGGCCCTGGAACTGGTGGAG 65.2 863

PSAP-cDNA2A-RP CAGGAAACAGCTATGACGGACACAGAAATGGGGGAGGT

Primer name and specificity Primer sequence (5′→3′) Annealingtemperature (°C)

Size of PCRproduct (bp)

Primers for ARMS analysis of c.803delG on genomic (g) and cDNA

803delG-A-minus wild-type specific; antisense ACAGAACCCAACCAGCGCAC

803delG-A-plus mutant specific; antisense ACAGAACCCAACCAGCGCAA

803delG-gDNA-S gDNA specific; sense GGCATGGTAGTTCCCCCTCT 66 433

PSAP-cDNA1S-RP cDNA specific; sense CAGGAAACAGCTATGACCGCTATGTACGCCCTCTTCCTC 66 830


Biochemical analyses

For lipid analyses, formalin-fixed tissue samples from patientsand age-matched controls were exhaustively washedwith water, then weighed, homogenized and extracted succes-sively with mixtures of chloroform:methanol:water (C:M:W;20:10:1; 10:20:1; 10:10:1; v/v/v) according to Natomi et al.(85). Purified pooled lipid extracts were analyzed on HPTLCSilica 60 plates (Merck). Sphingomyelin was determined byphosphorus analysis using the method of Bradova et al. (86).Ceramides were resolved by double development of the plate;first with chloroform:methanol (95:5; v/v) and then, afterdrying, with hexane:diethylether:glacial acetic acid (60:40:1;v/v/v), followed by detection with cupric sulfate/phosphoricacid (87). Glycosphingolipids were separated using C:M:W(65:25:4, v/v/v) on either untreated plates or, for the separationof GlcCer and GalCer, on plates impregnated with 1% (w/v)sodium tetraborate in methanol (87) followed by detectionwith orcinol. Parallel plates were sprayed with Azure A forspecific detection of sulphatides (88).

Immunodetection of Gb3Cer and LacCer was performed aspreviously described (89,90) on Polygram Sil G sheets(Macherey-Nagel) using mouse monoclonal antibodies toGb3Cer (provided by Dr Tadashi Tai, Tokyo MetropolitanInstitute of Medical Science, Japan) and LacCer (provided byDr Kristian Koubek, Institute of Hematology and Blood Trans-fusion, Prague, Czech Republic), respectively. Binding ofprimary antibodies was detected using Pierce anti-mouse IgGperoxidase conjugate (Pierce) or a Universal DAKO LSABperoxidase kit for Gb3Cer, and Pierce anti-mouse IgM peroxi-dase conjugate (Pierce) for LacCer.

Chromatograms were evaluated densitometrically using aCamag TLC Scanner II (Cats3; Camag Scientific) in reflectionmode and quantitation was based on comparison with knownamounts of glycolipid standards applied to the same chromato-gram. The following sphingolipid standards were prepared inour Prague laboratory and their identity confirmed by massspectrometry: GalCer from human brain, LacCer from humanspleen and erythrocytes, GlcCer from Gaucher spleen, Gb3Cerfrom Fabry myocardium, globotetraosyl ceramide (Gb4Cer)from human erythrocytes and sulphatides from human brain.Sphingomyelin from bovine brain, and non-hydroxy fatty acid(NFA)- and HFA-ceramides, were purchased from SigmaChemical Company.

Molecular investigations

Genomic DNA was isolated by standard techniques from whiteblood cells and cultured skin fibroblasts or, for blood spots,according to Caggana et al. (91). Total RNA was extractedfollowing the method of Chomczynski and Sacchi (92) andcDNA was prepared using Superscript II reverse transcriptase(Gibco BRL, Life Technologies GmbH) with oligo d(T)18priming. Primers used for the amplification of genomic orcDNA are listed in Table 3. T7 or RP standard primers wereadded to the 5′ ends of the primers as indicated. PSAP cDNAwas amplified using two pairs of primers (PSAP-cDNA-S1-RPwith PSAP-cDNA-A1-T7 and PSAP-cDNA-S2-T7 withPSAP-cDNA-A2-RP). For genomic DNA, the promoter regionplus exon 1 was amplified using primers (PSAP-g1S-T7 andPSAP-g6A-RP) derived from the sequence of Sun et al. (3).

The primers used for amplification of the other exons are listedin Table 3 and were based on the sequence of Rorman et al. (2).PCR products were gel purified and sequenced using Thermo-Sequenase (Amersham) or AmpliTaq FS polymerases (Perkin-Elmer) with fluorescently labeled T7 and RP primers. Thesequencing reactions were analysed using an AlfExpressfluorescent sequencer (Amersham Pharmacia Biotech).

To analyse RNA from the nuclear and cytosolic compart-ments, cultured skin fibroblasts (approximately 15 × 106 cells)were harvested and washed twice with phosphate bufferedsaline. The cells were pelleted and resuspended in 500 µl ofice-cold Triton X-100 lysis buffer [10 mM Tris–Cl pH 8, 150 mMNaCl, 1.5 mM MgCl2, 0.5 % Triton X-100 (v/v)]. The suspensionwas overlaid onto 300 µl of ice-cold Triton X-100 lysis buffercontaining 0.3 M sucrose and centrifuged at 1000 g for 10 minat 4°C. The cytoplasmic upper phase was transferred to a freshtube and mixed with a denaturing solution (Solution D) (92).The remainder of the sucrose phase was discarded and thepelleted nuclei were also solubilized in Solution D. Isolation ofRNA from the nuclear and cytoplasmic lysates and preparationof cDNA were as described above.

ARMS analysis of the c.803delG mutation in genomic DNAand cDNA used primers 803delG-A-plus and primer 803delG-A-minus (Table 3) to specifically amplify the mutant and wild-type alleles. These primers were paired with primer 803delG-gDNA-S and PSAP-cDNA1S-RP (Table 3) for amplificationfrom genomic and cDNA, respectively. The amplificationmixture contained another set of primers amplifying a differentpart of the genome as an amplification control. The amplifica-tion reactions were performed in 50 mM Tris–HCl pH 9.1,with 2U of Klentaq 1 (GeneAge Technologies).

Electronic database information

Accession numbers and URLs for data in this article are asfollows: Genbank, http://www.ncbi.nlm.nih.gov/Web/Genbank(accession nos M86181, AF057307 and AF307850).

ACKNOWLEDGEMENTS

Dr Jaana Tyynelä, Dr Helen Christomanou, Prof. KonradSandhoff, Dr Tadashi Tai and Dr Kristian Koubek are thankedfor their generous gifts of antibodies. This work was supportedby grants from the Ministry of Education and Youth of theCzech Republic (VS 96127) and from the Grant Agency of theCharles University, Prague (GAUK 37/2000/C).

REFERENCES

1. Bar-Am, I., Avivi, L. and Horowitz, M. (1996) Assignment of the humanprosaposin gene (PSAP) to 10q22.1 by fluorescence in situ hybridisation.Cytogenet. Cell Genet., 72, 316–318.

2. Rorman, E.G., Scheinker, V. and Grabowski, G.A. (1992) Structure andevolution of the human prosaposin chromosomal gene. Genomics, 13,312–318.

3. Sun, Y., Jin, P., Witte, D.P. and Grabowski, G.A. (1998) Isolation andcharacterization of the human prosaposin promoter. Gene, 218, 34–47.

4. O’Brien, J.S., Kretz, K.A., Dewji, N., Wenger, D.A., Esch, F. andFluharty, A.L. (1988) Coding of two sphingolipid activator proteins(SAP-1 and SAP-2) by same genetic locus. Science, 241, 1098–1101.

5. Nakano, T., Sandhoff, K., Stümper, J., Christomanou, H. and Suzuki, K.(1989) Structure of full-length cDNA coding for sulfatide activator, a co-β-glucosidase and two other homologous proteins: two alternate forms ofthe sulfatide activator. J. Biochem., 105, 152–154.


6. Madar-Shapiro, L., Pasmanik-Chor, M., Vaccaro, A.M., Dinur, T., Dagan,A., Gatt, S. and Horowitz, M. (1999) Importance of splicing for prosa-posin sorting. Biochem. J., 337, 433–443.

7. Henseler, M., Klein, A., Glombitza, G.J., Suzuki, K. and Sandhoff, K.(1996) Expression of three alternative forms of the sphingolipid activatorprotein precursor in baby hamster kidney cells and functional assays in acell culture system. J. Biol. Chem., 271, 8416–8423.

8. Lamontagne, S. and Potier, M. (1994) Modulation of human saposin Bsphingolipid-binding specificity by alternative splicing. A study withsaposin B-derived peptides. J. Biol. Chem., 269, 20528–20532.

9. Sano, A., Hineno, T., Mizuno, T., Kondoh, K., Ueno, S.-I., Kakimoto, Y.and Inui, K. (1989) Sphingolipid hydrolase activator proteins and theirprecursors. Biochem. Biophys. Res. Commun., 165, 1191–1197.

10. Kondoh, K., Sano, A., Kakimoto, Y., Matsuda, S. and Sakanaka, M.(1993) Distribution of prosaposin-like immunoreactivity in rat brain.J. Comp. Neurol., 334, 590–602.

11. Sun, Y., Witte, D.P. and Grabowski, G.A. (1994) Developmental andtissue-specific expression of prosaposin mRNA in murine tissues. Am.J. Pathol., 145, 1390–1398.

12. Kreda, S.M., Fujita, N. and Suzuki, K. (1994) Expression of sphingolipidactivator protein gene in brain and systemic organs of developing mice.Dev. Neurosci., 16, 90–99.

13. Leonova, T., Qi, X., Bencosme, A., Ponce, E., Sun, Y. and Grabowski,G.A. (1996) Proteolytic processing patterns of prosaposin in insect andmammalian cells. J. Biol. Chem., 271, 17312–17320.

14. Morales, C.R., El-Alfy, M., Zhao, Q. and Igdoura, S.A. (1996) Expressionand tissue distribution of rat sulfated glycoprotein-1 (prosaposin). J. Histochem.Cytochem., 44, 327–337.

15. Vielhaber, G., Hurwitz, R. and Sandhoff, K. (1996) Biosynthesis, processing,and targeting of sphingolipid activator protein (SAP) precursor in culturedhuman fibroblasts. J. Biol. Chem., 271, 32438–32446.

16. Zhao, Q. and Morales, C.R. (2000) Identification of a novel sequenceinvolved in lysosomal sorting of the sphingolipid activator protein prosaposin.J. Biol. Chem., 275, 24829–24839.

17. Lefrancois, S., Michaud, L., Potier, M., Igdoura, S. and Morales, C.R.(1999) Role of sphingolipids in the transport of prosaposin to the lysosomes.J. Lipid Res., 40, 1593–1603.

18. Zhu, Y. and Conner, G.E. (1994) Intermolecular association of lysosomalprotein precursors during biosynthesis. J. Biol. Chem., 269, 3846–3851.

19. Godbold, G.D., Ahn, K., Yeyeodu, S., Lee, L.-F., Ting, J.P.-Y. and Erickson,A.H. (1998) Biosynthesis and intracellular targeting of the lysosomalaspartic proteinase cathepsin D. Adv. Exp. Med. Biol., 436, 153–162.

20. Hiraiwa, M., Martin, B.M., Kishimoto, Y., Conner, G.E., Tsuji, S. andO’Brien, J.S. (1997) Lysosomal proteolysis of prosaposin, the precursorof saposins (sphingolipid activator proteins)—its mechanism and inhibi-tion by ganglioside. Arch. Biochem. Biophys., 341, 17–24.

21. Hineno, T., Sano, A., Kondoh, K., Ueno, S.-I., Kakimoto, Y. and Yoshida,K.-I. (1991) Secretion of sphingolipid hydrolase activator precursor,prosaposin. Biochem. Biophys. Res. Commun., 176, 668–674.

22. Patton, S., Carson, G.S., Hiraiwa, M., O’Brien, J.S. and Sano, A. (1997)Prosaposin, a neurotrophic factor: presence and properties in milk.J. Dairy Sci., 80, 264–272.

23. Hiesberger, T., Hüttler, S., Rohlmann, A., Schneider, W., Sandhoff, K.and Herz, J. (1998) Cellular uptake of saposin (SAP) precursor andlysosomal delivery by low density lipoprotein receptor-related protein(LRP). EMBO J., 17, 4617–4625.

24. Hiraiwa, M., Soeda, S., Kishimoto, Y. and O’Brien, J.S. (1992) Bindingand transport of gangliosides by prosaposin. Proc. Natl Acad. Sci. USA,89, 11254–11258.

25. Misasi, R., Sorice, M., Carson, G.S., Griggi, T., Lenti, L., Pontieri, G.M.and O’Brien, J.S. (1996) Prosaposin and prosaptide, a peptide from prosa-posin, induce an increase in ganglioside content on NS20Y neuroblastomacells. Glycoconj. J., 13, 195–202.

26. Campana, W.M., Hiraiwa, M. and O’Brien, J.S. (1998) Prosaptide activatesthe MAPK pathway by a G-protein-dependent mechanism essential forenhanced sulfatide synthesis by Schwann cells. FASEB J., 12, 307–314.

27. Fu, Q., Carson, G.S., Hiraiwa, M., Grafe, M., Kishimoto, Y. and O’Brien,J.S. (1994) Occurrence of prosaposin as a neuronal surface membranecomponent. J. Mol. Neurosci., 5, 59–67.

28. Misasi, R., Sorice, M., Garofalo, T., Griggi, T., Campana, W.M., Giammatteo,M., Pavan, A., Hiraiwa, M., Pontieri, G.M. and O’Brien, J.S. (1998) Colo-calization and complex formation between prosaposin and monosialogan-glioside GM3 in neural cells. J. Neurochem., 71, 2313–2321.

29. O’Brien, J.S., Carson, G.S., Seo, H.-C., Hiraiwa, M. and Kishimoto, Y.(1994) Identification of prosaposin as a neurotrophic factor. Proc. NatlAcad. Sci. USA, 91, 9593–9596.

30. Kotani, Y., Matsuda, S., Sakanaka, M., Kondoh, K., Ueno, S.-I. and Sano,A. (1996) Prosaposin facilitates sciatic nerve regeneration in vivo. J. Neuro-chem., 66, 2019–2025.

31. Hiraiwa, M., Taylor, E.M., Campana, W.M., Darin, S.J. and O’Brien, J.S.(1997) Cell death prevention, mitogen-activated protein kinase stimula-tion, and increased sulfatide concentrations in Schwann cells andoligodendrocytes by prosaposin and prosaptides. Proc. Natl Acad. Sci.USA, 94, 4778–4781.

32. Calcutt, N.A., Campana, M., Eskeland, N.L., Mohiuddin, L., Dines, K.C.,Mizisin, A.P. and O’Brien, J.S. (1999) Prosaposin gene expression and theefficacy of a prosaposin-derived peptide in preventing structural and func-tional disorders of peripheral nerve in diabetic rats. J. Neuropathol. Exp.Neurol., 58, 628–636.

33. Igase, K., Tanaka, J., Kumon, Y., Zhang, B., Sadamoto, Y., Maeda, N.,Sakaki, S. and Sakanaka, M. (1999) An 18-mer peptide fragment of pro-saposin ameliorates place navigation disability, cortical infarction, andretrograde thalamic degeneration in rats with focal cerebral ischemia.J. Cereb. Blood Flow Metab., 19, 298–306.

34. Hozumi, I., Hiraiwa, M., Inuzuka, T., Yoneoka, Y., Akiyama, K., Tanaka,R., Kikugawa, K., Nakano, R., Tsuji, S. and O’Brien, J.S. (1999) Administra-tion of prosaposin ameliorates spatial learning disturbance and reduces cavityformation following stab wounds in rat brain. Neurosci. Lett., 267, 73–76.

35. Hiraiwa, M., Campana, W.M., Mizisin, A.P., Mohiuddin, L. and O’Brien,J.S. (1999) Prosaposin: a myelinotrophic protein that promotes expressionof myelin constituents and is secreted after nerve injury. Glia, 26, 353–360.

36. Morales, C.R., Zhao, Q., Lefrancois, S. and Ham, D. (2000) Role ofprosaposin in the male reproductive system: effect of prosaposin inactiva-tion on the testis, epidiymis, prostate, and seminal vesicle. Arch. Androl.,44, 173–186.

37. Kishimoto, Y., Hiraiwa, M. and O’Brien, J.S. (1992) Saposins: structure,function, distribution, and molecular genetics. J. Lipid Res., 33, 1255–1267.

38. Sandhoff, K. and Klein, A. (1994) Intracellular trafficking of glycosphin-golipids: role of sphingolipid activator proteins in the topology of endocytosisand lysosomal digestion. FEBS Lett., 346, 103–107.

39. Sandhoff, K., Harzer, K. and Fürst, W. (1995) Sphingolipid activator proteins.In Scriver, C.R., Beaudet, A.L., Sly, W.S. and Valle, D. (eds), TheMetabolic and Molecular Bases of Human Disease, 7th edn. McGraw-Hill,New York, NY, pp. 2427–2441.

40. Suzuki, K., van Echten-Deckert, G., Klein, A. and Sandhoff, K. (1995)Glycosphingolipids and sphingolipid activator proteins: Cell biology, bio-chemistry and molecular genetics. In Papa, S. and Tager, J.M. (eds), Bio-chemistry of Cell Membranes. Birkhäuser Verlag, Basel, Switzerland, pp.137–149.

41. Kolter, T. and Sandhoff, K. (1998) Recent advances in the biochemistry ofsphingolipidoses. Brain Pathol., 8, 79–100.

42. Schnabel, D., Schröder, M. and Sandhoff, K. (1991) Mutation in thesphingolipid activator protein 2 in a patient with a variant of Gaucherdisease. FEBS Lett., 284, 57–59.

43. Rafi, M.A., de Gala, G., Zhang, X.-L. and Wenger, D.A. (1993) Muta-tional analysis in a patient with a variant form of Gaucher disease causedby SAP-2 deficiency. Somat. Cell Mol. Genet., 19, 1–7.

44. Kretz, K.A., Carson, G.S., Morimoto, S., Kishimoto, Y., Fluharty, A.L.and O’Brien, J.S. (1990) Characterization of a mutation in a family withsaposin B deficiency: a glycosylation site defect. Proc. Natl Acad. Sci.USA, 87, 2541–2544.

45. Rafi, M.A., Zhang, X.-L., DeGala, G. and Wenger, D.A. (1990) Detectionof a point mutation in sphingolipid activator protein-1 mRNA in patientswith a variant form of metachromatic leukodystrophy. Biochem. Biophys.Res. Commun., 166, 1017–1023.

46. Holtschmidt, H., Sandhoff, K., Kwon, H.Y., Harzer, K., Nakano, T. andSuzuki, K. (1991) Sulfatide activator protein. Alternative splicing thatgenerates three mRNAs and a newly found mutation responsible for aclinical disease. J. Biol. Chem., 266, 7556–7560.

47. Zhang, X.L., Rafi, M.A., DeGala, G. and Wenger, D.A. (1991) The mech-anism for a 33-nucleotide insertion in mRNA causing sphingolipid activatorprotein (SAP-1)-deficient metachromatic leukodystrophy. Hum. Genet.,87, 211–215.

48. Henseler, M., Klein, A., Reber, M., Vanier, M.T., Landrieu, P. and Sandhoff,K. (1996) Analysis of a splice-site mutation in the sap-precurson gene ofa patient with metachromatic leukodystrophy. Am. J. Hum. Genet., 58, 65–74.


49. Reis, S., Filocamo, M., Corsolini, F., Caroli, F., Keulemans, J.L., van-Diggelen, O.P. and Gatti, R. (1999) An Asn→Lys substitution in saposinB involving a conserved amino acidic residue and leading to the loss of thesingle N-glycosylation site in a patient with metachromatic leukodystrophyand normal arylsulphatase A activity. Eur. J. Hum. Genet., 7, 125–130.

50. Harzer, K., Paton, B.C., Poulos, A., Kustermann-Kuhn, B., Roggendorf,W., Grisar, T. and Popp, M. (1989) Sphingolipid activator proteindeficiency in a 16-week-old atypical Gaucher disease patient and his fetalsibling: biochemical signs of combined sphingolipidoses. Eur. J. Pediatr.,149, 1–9.

51. Bradová, V., Šmíd, F., Ulrich-Bott, B., Roggendorf, W., Paton, B.C. andHarzer, K. (1993) Prosaposin deficiency: further characterization of thesphingolipid activator protein-deficient sibs. Multiple glycolipid eleva-tions (including lactosylceramidosis), partial enzyme deficiencies andultrastructure of the skin in this generalized sphingolipid storage disease.Hum. Genet., 92, 143–152.

52. Schnabel, D., Schröder, M., Fürst, W., Klein, A., Hurwitz, R., Zenk, T.,Weber, J., Harzer, K., Paton, B.C., Poulos, A. et al. (1992) Simultaneousdeficiency of sphingolipid activator proteins 1 and 2 is caused by a muta-tion in the initiation codon of their common gene. J. Biol. Chem., 267,3312–3315.

53. Fujita, N., Suzuki, K., Vanier, M.T., Popko, B., Maeda, N., Klein, N.,Henseler, M., Sandhoff, K., Nakayasu, H. and Suzuki, K. (1996) Targeteddisruption of the mouse sphingolipid activator protein gene: a complexphenotype, including severe leukodystrophy and widespread storage ofmultiple sphingolipids. Hum. Mol. Genet., 5, 711–725.

54. Oya, Y., Nakayasu, H., Fujita, N., Suzuki, K. and Suzuki, K. (1998) Path-ological study of mice with total deficiency of sphingolipid activatorproteins (SAP knockout mice). Acta Neuropathol. (Berl.), 96, 29–40.

55. Elleder, M., Jirásek, A., Šmid, F., Ledvinová, J., Besley, G.T.N. andStopeková, M. (1984) Niemann-Pick disease type C with enhancedglycolipid storage. Report on further case of so-called lactosylceramidosis.Virchows Arch., 402, 307–317.

56. Frischmeyer, P.A. and Dietz, H.C. (1999) Nonsense-mediated mRNAdecay in health and disease. Hum. Mol. Genet., 8, 1893–1900.

57. Klein, A., Henseler, M., Klein, C., Suzuki, K., Harzer, K. and Sandhoff,K. (1994) Sphingolipid activator protein D (sap-D) stimulates the lysosomaldegradation of ceramide in vivo. Biochem. Biophys. Res. Commun., 200,1440–1448.

58. Chatelut, M., Harzer, K., Christomanou, H., Feunteun, J., Pieraggi, M.-T.,Paton, B.C., Kishimoto, Y., O’Brien, J.S., Basile, J.-P., Thiers, J.-C. et al.(1997) Model SV40-transformed fibroblast lines for metabolic studies ofhuman prosaposin and acid ceramidase deficiencies. Clin. Chim. Acta,262, 61–76.

59. Christomanou, H., Chabás, A., Pámpols, T. and Guardiola, A. (1989) Acti-vator protein deficient Gaucher’s disease. A second patient with the newlyidentified lipid storage disorder. Wien. Klin. Wochenschr., 67, 999–1003.

60. Pamplos, T., Pineda, M., Girós, M.L., Ferrer, I., Cusi, V., Chabás, A., Sanmarti,F.X., Vanier, M.T. and Christomanou, H. (1999) Neuronopathic juvenileglycosylceramidosis due to sap-C deficiency: clinical course, neuro-pathology and brain lipid composition in this Gaucher disease variant.Acta Neuropathol. (Berl.), 97, 91–97.

61. Suzuki, K. (1971) Renal cerebroside in globoid cell leukodystrophy(Krabbe’s disease). Lipids, 6, 433–436.

62. Suzuki, K. (1986) Characteristic inclusions in the kidney of canine glo-boid cell leukodystrophy. Acta Neuropathol. (Berl.), 69, 33–37.

63. Harzer, K., Paton, B.C., Christomanou, H., Chatelut, M., Levade, T.,Hiraiwa, M. and O’Brien, J.S. (1997) Saposins (sap) A and c activate thedegradation of galactosylceramide in living cells. FEBS Lett., 417, 270–274.

64. Paton, B.C., Schmid, B., Kustermann-Kuhn, B., Poulos, A. and Harzer, K.(1992) Additional biochemical findings in a patient and fetal sibling witha genetic defect in the sphingolipid activator protein (SAP) precursor, pro-saposin. Evidence for a deficiency in SAP-1 and for a normal lysosomalneuraminidase. Biochem. J., 285, 481–488.

65. Tohyama, J., Vanier, M.T., Suzuki, K., Ezoe, T., Matsuda, J. and Suzuki,K. (2000) Paradoxical influence of acid β-galactosidase gene dosage onphenotype of the twitcher mouse (genetic galactosylceramidase defi-ciency). Hum. Mol. Genet., 9, 1699–1707.

66. Zschoche, A., Fürst, W., Schwarzmann, G. and Sandhoff, K. (1994)Hydrolysis of lactosylceramide by human galactosylceramidase andGM1-β-galactosidase in a detergent-free system and its stimulation bysphingolipid activator proteins, sap-B, sap-C. Activator proteins stimulatelactosylceramide hydrolysis. Eur. J. Biochem., 222, 83–90.

67. Vogel, A., Fürst, W., Abo-Hashish, M.A., Lee-Vaupel, M., Conzelmann,E. and Sandhoff, K. (1987) Identity of the activator proteins for thehydrolysis of sulfatide, ganglioside GM1, and globotriaosylceramide.Arch. Biochem. Biophys., 259, 627–638.

68. Desnick, R.J., Ioannou, Y.A. and Eng, C.M. (1995) α-galactosidase Adeficiency: Fabry disease. In Scriver, C.R., Beaudet, A.L., Sly, W.S.,Valle, D. (eds), The Metabolic and Molecular Bases of Human Disease,7th edn. McGraw-Hill, New York, NY, pp. 2741–2823.

69. Elleder, M., Bradová, V., Šmíd, F., Budesinsky, M., Harzer, K.,Kustermann-Kuhn, B., Ledvinova, J., Belohlavek, M., Kral, V. andDorazilova, V. (1990) Cardiocyte storage and hypertrophy as a solemanifestation of Fabry’s disease. Report on a case simulating hyper-trophic non-obstructive cardiomyopathy. Virchows Arch., 417, 449–455.

70. von Scheidt, W., Eng, C.M., Fitzmaurice, T.F., Erdmann, E., Hubner, G.,Olsen, E.G., Christomanou, H., Kandolf, R., Bishop, D.F. and Desnick,R.J. (1991) An atypical variant of Fabry’s disease with manifestationsconfined to the myocardium. N. Engl. J. Med., 324, 395–399.

71. Kolodny, E.H. and Fluharty, A.L. (1995) Metachromatic leukodystrophyand multiple sulfatase deficiency: sulfatide lipidosis. In Scriver, C.R.,Beaudet, A.L., Sly, W.S., Valle, D. (eds), The Metabolic and MolecularBases of Human Disease, 7th edn. McGraw-Hill, New York, NY, pp.2693–2740.

72. Stevens, R.L., Fluharty, A.L., Kihara, H., Kaback, M.M., Shapiro, L.J.,Marsh, B., Sandhoff, K. and Fischer, G. (1981) Cerebroside sulfatase acti-vator deficiency induced metachromatic leukodystrophy. Am. J. Hum.Genet., 33, 900–906.

73. Schlote, W., Harzer, K., Christomanou, H., Paton, B.C., Kustermann-Kuhn,B., Schmid, B., Seeger, J., Beudt, U., Schuster, I. and Langenbeck, U.(1991) Sphingolipid activator protein 1 deficiency in metachromaticleucodystrophy with normal arylsulphatase A activity. A clinical,morphological, biochemical, and immunological study. Eur. J. Pediatr.,150, 584–591.

74. Schmid, B., Paton, B.C., Sandhoff, K. and Harzer, K. (1992) Metabolismof GM1 ganglioside in cultured skin fibroblasts: anomalies in gangliosides,sialidoses, and sphingolipid activator protein (SAP, saposin) 1 andprosaposin deficient disorders. Hum. Genet., 89, 513–518.

75. Fingerhut, R., van der Horst, G.T., Verheijen, F.W. and Conzelmann, E.(1992) Degradation of gangliosides by the lysosomal sialidase requires anactivator protein. Eur. J. Biochem., 208, 623–629.

76. Haltia, M., Rapola, J. and Santavuori, P. (1973) Infantile type of so-calledneuronal ceroid-lipofuscinosis. Histological and electron microscopicstudies. Acta Neuropathol. (Berl.), 26, 157–170.

77. Suopanki, J., Tyynela, J., Baumann, M. and Haltia, M. (1999) The expressionof palmitoyl-protein thioesterase is developmentally regulated in neuraltissues but not in nonneural tissues. Mol. Genet. Metab., 66, 290–293.

78. Uusitalo, A., Tenhunen, K., Heinonen, O., Hiltunen, J.O., Saarma, M.,Haltia, M., Jalanko, A. and Peltonen, L. (1999) Toward understanding theneuronal pathogenesis of aspartylglucosaminuria: expression of aspar-tylglucosaminidase in brain during development. Mol. Genet. Metab., 67,294–303.

79. Dawson, G. and Stein, A.O. (1970) Lactosyl ceramidosis: catabolicenzyme defect of glycosphingolipid metabolism. Science, 170, 556–558.

80. Wenger, D.A., Sattler, M., Clark, C., Tanaka, H., Suzuki, K. and Dawson,G. (1975) Lactosyl ceramidosis: normal activity of two lactosyl ceramideβ-galactosidases. Science, 188, 1310–1312.

81. Vanier, M.T., Wenger, D.A., Comly, M.E., Rousson, R., Brady, R.O. andPentchev, P.G. (1988) Niemann-Pick disease group C: clinical variabilityand diagnosis based on defective cholesterol esterification. A collabora-tive study on 70 patients. Clin. Genet., 33, 331–348.

82. Vanier, M.T. (1999) Lipid changes in Niemann-Pick disease type C brain:personal experience and review of the literature. Neurochem. Res., 24,481–489.

83. Elleder, M., Jirásek, A., Ledvinová, J. and Besley, G.T.N. (1985)Niemann-Pick disease type C. Study on the nature of the cerebral storageprocess. Acta Neuropathol. (Berl.), 66, 325–336.

84. Tyynelä, J., Baumann, M., Henseler, M., Sandhoff, K. and Haltia, M.(1995) Sphingolipid activator proteins in the neuronal ceroid-lipofuscinoses:an immunological study. Acta Neuropathol. (Berl.), 89, 391–398.

85. Natomi, H., Sugano, K., Iwamori, M., Takaku, F. and Nagai, Y. (1988)Region specific distribution of glycosphingolipids in the rabbit gastroin-testinal tract: preferential enrichment of sulphoglycolipids in the mucosalregions exposed to acid. Biochim. Biophys. Acta, 961, 213–222.

86. Bradová, V., Šmíd, F., Ledvinova, J. and Michalec, C. (1990) Improvedone-dimensional thin-layer chromatography for the separation of phos-


pholipids in biological material. J. Chromatogr. B Biomed. Sci. Appl.,533, 297–299.

87. Schnaar, R.L. and Needham, L.K. (1994) Thin-layer chromatography ofglycosphingolipids. Methods Enzymol., 230, 371–389.

88. Berna, L., Asfaw, B., Conzelmann, E., Cerny, B. and Ledvinova, J. (1999)Determination of urinary sulfatides and other lipids by combination ofreversed-phase and thin-layer chromatographies. Anal. Biochem., 269,304–311.

89. Kotani, M., Ozawa, H., Kawashima, I., Ando, S. and Tai, T. (1992)Generation of one set of monoclonal antibodies specific for a-pathwayganglio-series gangliosides. Biochim. Biophys. Acta, 1117, 97–103.

90. Ledvinova, J., Poupetova, H., Hanackova, A., Pisacka, M. and Elleder, M.(1997) Blood group B glycosphingolipids in α-galactosidase deficiency

(Fabry disease): influence of secretor status. Biochim. Biophys. Acta,1345, 180–187.

91. Caggana, M., Conroy, J.M. and Pass, K.A. (1998) Rapid, efficient methodfor multiplex amplification from filter paper. Hum. Mutat., 11, 404–409.

92. Chomczynski, P. and Sacchi, N. (1987) Single-step method of RNA isola-tion by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal.Biochem., 162, 156–159.

93. Shapiro, L.J., Aleck, K.A., Kaback, M.M., Itabashi, H., Desnick, R.J.,Brand, N., Stevens, R.L., Fluharty, A.L. and Kihara, H. (1979) Metachro-matic leukodystrophy without arylsulphatase A deficiency. Pediatr. Res.,13, 1179–1181.

a novel mutation in the coding region of the prosaposin gene leads

Documents