Amino acid sequence of His protein

• DNA provides the instructions for how to build proteins

• Each gene dictates how to build a single protein in prokaryotes

• The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that make up a protein

Protein Synthesis & Gene Expression

nucleotide sequence of His protein

Protein Synthesis & Gene Expression

Protein Synthesis & Gene Expression• Protein Synthesis = Gene Expression

The process in which the instructions encoded by a gene are used to build a protein

Gene

DNA in the nucleus

mRNA

made in nucleus, exits out of a pore in the nuclear envelope and finds a ribosome in the cytoplasm

transcription polypeptide

built out of amino acids by a ribosome in the cytoplasm using instructions from an mRNA

translation

protein

Final resulting molecule after polypeptide is modified and folded into final shape in the rough ER

Packaged into a vesicle in the golgi and shipped out to where it is needed

Protein Synthesis & Gene Expression

• Transcription RNA polymerase makes an

mRNA (messenger RNA) copy of a gene

occurs in cytoplasm of prokaryotes, nucleus of eukaryotes

Enables cell to make many copies of a gene so that a lotof protein can be made at onetime

Enables eukaryotic cells tokeep DNA protected in the nucleus, only mRNA copiesof genes leave the nucleus

(eukaryotes)

1) INITIATION

• Transcription Initiation RNA polymerase binds to a

region on DNA known as the promoter, which signals the start of a gene

Promoters are specific to genes RNA polymerase does not need

a primer

Transcription factors assemble at the promoter forming a transcription initiation complex – activator proteins help stabilize the complex

Gene expression can be regulated (turned on/off or up/down) by controlling the amount of each transcription factor

Protein Synthesis & Gene Expression

HONORS

1) INITIATION

• Transcription Elongation RNA polymerase unwinds

the DNA and breaks the H-bonds between the bases of the two strands, separating them from one another

Base pairing occurs between incoming RNA nucleotides and the DNA nucleotides of the gene (template)

• recall RNA uses uracil instead of thymine

AGTCAT

UCAGUA

Protein Synthesis & Gene Expression

HONORS

• Transcription Elongation

The gene occurs on only one of the DNA strands; each strand possesses a separate set of genes

Protein Synthesis & Gene Expression

RNA polymerase slides down the template strand connecting together RNA nucleotides

1) INITIATION

• Transcription Termination A region on DNA known as

the terminator signals the stop of a gene

RNA polymerase separates from the mRNA and the DNA

Protein Synthesis & Gene Expression

HONORS

Exons are “coding” regions provide instructionsfor one or more proteins)

Introns are removed

different combinations of exons form different mRNA resulting in multiple proteins from the same gene

Humans have 30,000 genes but are capable of producing 100,000 proteins

• Alternative Splicing (eukaryotes only)

Protein Synthesis & Gene ExpressionHONORS

Web ResourcesTranscription• http://www.biostudio.com/d_%20Transcription.htm

• http://www.youtube.com/watch?v=WsofH466lqk

• http://www.dnalc.org/resources/3d/TranscriptionBasic_withFX.html

Alternative Splicing• http://www.youtube.com/watch?v=FVuAwBGw_pQ&feature=related

Protein Synthesis & Gene Expression

• Translation mRNA is used by ribosome to build

polypeptides (Ribosomes attach to the mRNA and use its sequence of nucleotides to determine the order of amino acids in the polypeptide)

occurs in cytoplasm of prokaryotes and eukaryotes

some polypeptides feed directly into rough ER in eukaryotes where they are modified and folded into the final protein

Transcription

Translation

mRNA

tRNA synthesis

• TranslationInitiation Start codon signals where the

gene begins (at 5’ end of mRNA)

AUGGACAUUGAACCG…5’ 3’

start codon

Translation

mRNAProtein Synthesis

• TranslationInitiation Start codon signals where the gene

begins (at 5’ end of mRNA) Ribosome binding site on the mRNA

binds to a small ribosomal subunit Then this complex binds to a large

ribosomal subunit forming the complete ribosome

Protein Synthesis & Gene Expression

• TranslationScanning The ribosome moves in 5’ to 3’ direction “reading” the mRNA and

assembling amino acids into the correct polypeptide

Protein Synthesis & Gene Expression

Transcription

Translation

mRNA

tRNA synthesis

• TranslationScanning

Every three mRNA nucleotides (codon) specify an amino acid

Protein Synthesis & Gene Expression

• TranslationScanning Each tRNA carries a specific amino acid tRNA have an anticodon region that specifically binds to its codon

Protein Synthesis & Gene Expression

anticodon

• TranslationTermination Ribosome disengages from the mRNA

when it encounters a stop codon

Protein Synthesis

Web ResourcesTranslation• Eukaryotic: http://www.youtube.com/watch?v=5bLEDd-PSTQ&feature=related

• Prokaryotic: http://www.biostudio.com/d_%20Protein%20Synthesis%20Prokaryotic.htm

• http://www.biostudio.com/d_%20Peptide%20Bond%20Formation.htm

• http://www.johnkyrk.com/DNAtranslation.html

• http://www.dnalc.org/resources/3d/TranslationBasic_withFX0.html

• http://www.dnalc.org/resources/3d/TranslationAdvanced.html

• Post-Translational Modifications Polypeptide is modified in the rough ER – this might include cutting out

sections and/or cut a section from one part of the polypeptide and moving it to another part

Chaperone proteins help to fold the polypeptide into its final tertiary shape. Now it is called a protein.

Protein Synthesis & Gene Expression

• Folded membrane that forms compartments where newly synthesized proteins are processed (cut, joined, folded into their final shape)

• Ribosomes bind to rough ER when they start to synthesize proteins that are intended to be exported from the cell – the proteins enter the ER directly from the ribosome

Rough Endoplasmic Reticulum (ER)

Protein Synthesis & Gene Expression

• Folded membranes form compartments that each contain different enzymes which selectively modify the contents depending on where they are destined to end up

• Processes and packages macromolecules produced by the cell (e.g. proteins and lipids) – sent out as excretory vesicles “labeled” for their destination

Golgi ApparatusProtein Synthesis & Gene Expression

• Multiple RNA polymerases can engage a gene at one time

• Multiple ribosomes can engage a single mRNA at one time

DNA mRNAs

Transcription

Translation

Protein Synthesis & Gene Expression

• Eukaryotes: transcription occurs in the nucleus and translation occurs in the cytoplasm

• Prokaryotes: Transcription and translation occur simultaneously in the cytoplasm

Protein Synthesis & Gene Expression

• There are three main types of RNA:

1. mRNA (messenger RNA) - RNA copy of a gene used as a template for protein synthesis

2. rRNA (ribosomal RNA) - part of structure of ribosomes

3. tRNA (transfer RNA)- amino acid carrier that matches to mRNA codon

Protein Synthesis & Gene Expression

Practice QuestionTranslate the following mRNA sequence

AGCUACCAUACGCACCCGAGUUCUUCAAGC

Practice QuestionTranslate the following mRNA sequence

AGCUACCAUACGCACCCGAGUUCUUCAAGCSerine – Tyrosine – Histidine – Threonine – Histidine – Proline – Serine – Serine – Serine - Serine

Ser – Tyr – His – Thr – His – Pro – Ser – Ser – Ser - Ser

Practice QuestionTranslate the following mRNA sequence

AGCUACCAUACGCACCCGAGUUCUUCAAGCSerine – Tyrosine – Histidine – Threonine – Histidine – Proline – Serine – Serine – Serine - Serine

Serine – Tyrosine – Histidine – Threonine – Histidine – Proline – Serine – Serine – Serine - Serine

Practice QuestionTranslate the following mRNA sequence

AGCUACCAUACGCACCCGAGUUCUUCAAGC

S – Y –H– T – H – P – S – S – S - S

Ser – Tyr – His – Thr – His – Pro – Ser – Ser – Ser - Ser

Protein Synthesis & Gene Expression

• Protein Synthesis = Gene Expression Process in which a gene is used to build a protein resulting in the

presence of a particular phenotype (physical characteristic) Phenotypic variation among organisms is due to genotypic variation

(differences in the sequence of their DNA bases) Differences exist between species and within a species

• Different genes (genomes) different proteins (proteomes)

• Different versions of the same gene = alleles

• Differences in gene expression = epigenetics

Insulin Example of Protein Synthesishttp://www.biotopics.co.uk/as/insulinproteinstructure.html

Hemoglobin Example of Protein Synthesishttp://www.biotopics.co.uk/as/insulinproteinstructure.html

Collagen Example of Protein Synthesishttp://www.biotopics.co.uk/JmolApplet/collagen.html

Web Resources