2014 11 03_bioinformatics_case_studies

Bioinformatics case studiesTranslating epigenetics, Personal genomics

Wim Van CriekingeAmsterdam, 3rd November 2014

wvcrieki

Overview

Epigenetics– Introduction– DNA Methylation & Oncology

Translating Epigenetics– NEXT-GENeration (Epi)genetic biomarkers

for Clinical and Prognostic UsePersonal/Recreational Genomics

Overview

for Clinical and Prognostic Use Personal Genomics

Defining Epigenetics

Reversible changes in gene expression/function

Without changes in DNA sequence

Can be inherited from precursor cells

Allows to integrate intrinsic with environmental signals (including diet)

Genome

Gene Expression

Epigenome

Chromatin

Phenotype

Chromatin, a Key Component of Epigenetic Regulation

nucleosomehistoneDNA

chromatin

Cellular DNA is packaged into a structure called chromatin

The unit of chromatin is the nucleosome, a complex of a histone tetramer with approx. 147 bp of DNA wound around it

Epigenetics I Intoduction | Oncology | Biomarker

DNA Methylation Prevents Gene Expression

DNA methylation involves the transfer of methyl groups to cytosine residues in DNA by DNA methyltransferases (DNMTs)

Hypo <-> Hyper

MeMeMe Me

DNMT DNMT

Geneexpression

Historically, Cancer Was Considered to be Driven Mostly by Genetic Changes

Example: Replication errors

GENETIC

Altered DNA/mRNA/proteins

Altered DNA sequence

Oncogenesis

Mutations in p53

Activating mutations in RAS

Mutations or amplifications of the

HER-2 gene

Chromosomal translocations in

myeloid cells and the generation of

the BCR-ABL fusion protein

Epigenetic Changes are Important in Causing Cancer

Example: Replication errors

GENETIC EPIGENETIC

Example: Chromatin modification errors

Altered DNA/mRNA/proteins

Altered DNA sequence

Altered levels ofmRNA/proteins

Alteredchromatin structure

Oncogenesis

Source: Schuebel et al 2007

STARD8

PTPRDCD109

RETCHD%

RNF182

Methylated Mutated

76-100 51-75 21-50 1-20

Example of Methylation vs Mutation: Colon & Breast Cancer

ActionableEpigenome

OutsideOncology ?

Evolutionary Perspectiveepigenetic (meta)information = stem cells

Cellular programming

Overview

for Clinical and Prognostic Use – Implementation

MGMT BiologyO6 Methyl-Guanine Methyl Transferase

Essential DNA Repair Enzyme

Removes alkyl groups from damaged guanine bases

Healthy individual: - MGMT is an essential DNA repair enzymeLoss of MGMT activity makes individuals susceptible to DNA damage and prone to tumor development

Glioblastoma patient on alkylator chemotherapy: - Patients with MGMT promoter methylation show have longer PFS and OS with the use of alkylating agents as chemotherapy

# samples

# markers

Discovery Verification Validation

3 000 000

<50 only models

and fresh frozen

> 50 All sample types

Incl. FFPE

Enrichment Sequencing (RUO) Targeted Sequencing (IVD)

Next GenerationEpigenetic Profiling

# samples

# markers

MethylCap_Seq

3 000 000

<50 only models

and fresh frozen

Incl. FFPE

MethylCap_Seq

DNA Sheared

Immobilized Methyl Binding Domain

Condensed Chromatin

DNA Sheared

Immobilized Methyl binding domain

Next Gen SequencingGA Illumina: 100 million reads

MethylCap_Seq

Quality evaluation of Methyl Binding Domain based kits for enrichment DNA-methylation sequencing

MGMT = dual core

Data integrationCorrelation tracks

methylation methylation

expression expression

Corr =-1 Corr = 1

Correlation trackin GBM @ MGMT

# samples

# markers

MethylCap_Seq

3 000 000

EpiHealth

<50 only models

and fresh frozen

Incl. FFPE

440 cancer-related genes genes are known to be epigenetically altered in human solid cancers based on recent scientific and clinical literature.

Coverage and allelic strans specific methylation signals

Dual strands accounts for genetic variant identification

# samples

# markers

MethylCap_Seq

Deep_Seq

3 000 000

EpiHealth

<50 only models

and fresh frozen

Incl. FFPE

Methylation Specific Seq

GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT

25% 50% 25%

GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT

Dense methylated needed for transcriptional silencingAre there alleles with all three positions methylated ?

GCATCGTGACTTACGACTGATCGATGGATGCTAGCAT

unmethylated alleles

less methylationmethylated alleles

more methylation

Deep Sequencing

Deep Sequencing MGMT Heterogenic complexity

Data integration with

DEEP Sequencing, Infinium, Reactivation, (directional) Expression …

DeepSeq

Molecular Unificationgenetic + epigenetic testing

107 106 105 104 103 102 101 1108109

Full genome bp

Whole-genomeBisulphite seq

GENETIC

Whole-genomesequencing

Enrichment seq(MBD, RRBS)

Enrichment seq(Exome)

Probes(450-27K)

Enrichment Targeted Panels

UltraDeep

SequencingRUO Clinical

Overview

for Clinical and Prognostic UsePersonal/Recreational Genomics

Lab for Bioinformatics and computational genomics

107 106 105 104 103 102 101 1108109

Full genome bp

GENETIC

Whole-genomesequencing

Enrichment seq(Exome)

PCREnrichment

Targeted Panels

Instrument and Assay providers

CLIA Lab service providers

The genome fits as an e-mail attachment

The Technical Feasibility Argument

The Quality Argument

The Price Argument

The Logistics Argument

Recreational genomics

• Experimental designs are outdated by technological advances• Genetic background (reference genome) as a concept will need to be

updated• Traits dependent on multiple loci are “complicated”: educate and

provide tools to deal with it

• Eye color … why not the ear wax/asparagus or unibrown example

• … metabolize nutrients (newborns ?)• … metabolize drugs in case you need it urgently ?

“several 23andMe users have reported taking the FDA’s advice of reviewing their genetic results with their physicians, only to find the doctors unprepared, unwilling, or downright hostile to helping interpret the data”

my genome is too important (for me) to leave it (only) to doctors

NXTGNT biohackerspace …

PGMv2: Personal Genomics Manifesto

Everyone should have the power and legitimacy to be able to discover, develop and find new things about their own genome data.

Intelligent exploration, experimentation and trial topush the boundaries of knowledge are a basic human right.

Personal genome data access should be affordable to all irrespective of nationality, gender, social background or any other circumstance.

Not having access to a personal genetic test is in itself a new kind of discrimination.

Whether one wants to share genome data or keep it private should be a matter of personal choice.

Whatever attitude a person has towards personal genome privacy, it should be utterly respected.

Corporate interest can never compromise any human right. Laws must fully protect individual human rights of equality for every person, irrespective of predicted risks from genetic data.

Stating that genetic tests merely provide non-clinical information misses the point of what personal genomics is all about.

Most genomic information is uninterpretable and may well be meaningless. But those are not reasons to deny it to people.

Genetic test results are not unrelated to someone’s health, one’s ability to respond to certain drugs and one’s ethnic ancestry.

Education in risks and opportunities for personal genetic testing should be the primary aim of policy makers.

Restricting access to interested people makes no sense and it is virtually impossible to ensure.

Access to personal genomics data and tools for its interpretation should become accessible to everyone.

Genomeslikemine

2014 11 03_bioinformatics_case_studies

methylation methylation

sample typesincl

epigenetics reversible

transfer of methyl groups

ras mutations

stem cells

prognostic use implementation

cancerrelated genes

Education

alroya newspaper 11-11-2014

2014/09/11 · created date 9/5/2014 11:28:23 am

· xls file · web view · 2014-12-0211/5/2014 10000000000...

grade 11 november 2014 tourism memorandum...

2014 14 j! 10 2014 09 i : 17.00 : 18.00 2014 11 i 13.00 09...

union daily (11-11-2014).pdf

11 11 2014 web

volume 11 – issue 11 july 2014

· 2014-11-20 · created date: 11/18/2014 2:42:40 pm

baird conference 11-11-2014 final wo notes · 11/11/2014...

cartaz 1ºleilão bh 26-11-2014 · title:...

tema 11 2014

kiwaniscope 11 11 2014

10 and 11 july 2014 10. und 11. juli 2014 forest machinery

1 - sprints & more 2014 02/11/2014 - 13:30 meet manager 11,...

buchtelite 2014 11 11

viewpoints issue #11 april 11, 2014

february 11 2014 01.gwb - 1/17 - tue feb 11 2014...

2014 sunfish world championship october 11-18, 2014 2014...

day 01-11-2014 saturday 03-11-2014 monday 05-11-2014...