dna – how it works part 1 the importance of dna clickthe importance of dna
Post on 05-Jan-2016
214 Views
Preview:
TRANSCRIPT
DNA – How it WorksPart 1Part 1
•The importance of DNA click
Chromosomes are made of DNA…
DNA has two sides, each made of nucleotides…
Another look at the nucleotide…
Base Pairs ALWAYS Match Up!
Adenine with Adenine with ThymineThymine and vice versa and vice versa Cytosine with Cytosine with GuanineGuanine and vice versa and vice versa
A & G are A & G are PurinesPurines – – doubledouble rings rings C & T are C & T are PyrimidinesPyrimidines – – singlesingle rings rings
A look at the base pairs…
DNA Replication – Making a copy…
How it works… HelicaseHelicase (an enzyme) (an enzyme)
“unzips” the DNA“unzips” the DNA
How it Works, con’t… Each strand is used as aEach strand is used as a template template to build a to build a
complementarycomplementary strand strand When the complementary strand is When the complementary strand is
complete, it twists with the template strand complete, it twists with the template strand to form a new to form a new double helixdouble helix!!!!
Replication of DNA
Click this image to view movie
•Replication of DNA
Also, keep in mind… The Point where the double helix separates The Point where the double helix separates
is called the is called the replication forkreplication fork ( (looks like alooks like a Y) Y)
Enzymes called Enzymes called DNA polymeraseDNA polymerase move move along each strand adding the corresponding along each strand adding the corresponding nucleotides!nucleotides!
New DNA – Exactly like the old!
You tell me the complimentary strand… ATGGCGTCATGCTTAGATTACAATGGCGTCATGCTTAGATTACA
TACCGCAGTACGAATCTAATGTTACCGCAGTACGAATCTAATGT
top related