genetic counseling for neurogenetic conditions karen kovak, m.s., c.g.c. child development &...
Post on 22-Dec-2015
216 Views
Preview:
TRANSCRIPT
Genetic Counseling for Neurogenetic ConditionsKaren Kovak, M.S., C.G.C.Child Development & Rehabilitation Center
Shriner’s Hospital
OHSU Cancer Center
Who Should Have a Genetics Consultation?
Individuals and families who are Individuals and families who are concerned about a genetic concerned about a genetic disease may benefit from a genetic disease may benefit from a genetic consultation consultation whether or not whether or not testing is availabletesting is available for that for that condition. Many people are condition. Many people are seeking information and coping seeking information and coping strategies as much as test results.strategies as much as test results.
Genetic Counseling as a ProfessionGenetic counseling is the process of helping people understand and
adapt to the medical, psychological and familial implications of genetic contributions to disease. This process integrates the following:
Interpretation of family and medical histories to assess the chance of disease occurrence or recurrence.
Education about inheritance, testing, management, prevention, resources and research.
Counseling to promote informed choices and adaptation to the risk or condition.
Genetic counseling needs vary depending on the context of the disorder in the family and the complexity of the disorder/testing options.
Genetics Clinic Evaluation
Family historyFamily history
Pregnancy, medical, developmental historyPregnancy, medical, developmental history
Physical exam Physical exam
Dysmorphology examDysmorphology exam
Diagnostic evaluationsDiagnostic evaluations
Genetic testingGenetic testing
Genetic counselingGenetic counseling
Support and Information ResourcesSupport and Information Resources
Clinical Features of Huntington Disease Movement Disorder involuntary movements/chorea impaired voluntary movements Psychiatric Disorder major DSM diagnoses nonspecific – irritability, apathy, disinhibition Cognitive Disorder organization, sequencing lack of initiation decreased insight/unawareness learning/memory
Age of Onset in Huntington Disease Range 2-28 years average around 40 years Juvenile Onset defined as <21 years 5-10% Late Onset defined as >60 years 10% Milder progression/severity?
Progression of Huntington Disease Early mild motor & mood impairment depression/irritability mild problems with coordination & thinking
Mid speech & swallowing problems chorea – falls, weight loss cognitive impairment leads to inability to work/drive
Late assistance with all ADLs nonverbal/nonambulatory chorea may decline & rigidity appear
Suicide Risk in early/mid stagesSurvival 3-42 years with average 15-20
Huntington Disease Gene•CAG trinucleotide repeat expansion
•Ranges of repeat size: normal
intermediate
reduced penetrance
affected
•Repeat size does not predict age of onset
•Repeat size instability
Categories of CAG Repeat Sizes…CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG…
26 27 35 36 39 40
Unaffected “Mutable” Unaffected“Reduced Penetrance” Affected
Repeat may be unstable when larger than 26 repeats
Inheritance of Huntington Disease
42 17 18 22
17 2244 18 42 22
Genetic Testing for Huntington Disease Diagnostic/Confirmatory absent family history early/atypical symptoms & family history but no DNA
Predictive/Presymptomatic testing in healthy person without symptoms no medical benefit
Prenatal parental status – gene status known or not prenatal vs. preimplantation
Genetic testing may be used for medical management and personal decision-making
Genetic test results usually apply not only to the patient but also to other family members
Genetic testing may be performed in the context of a genetics consultation and should include informed consent, test interpretation, and follow-up medical and psychosocial services
www.geneclinics.org
Genetic Discrimination
Definition Analysis of Risk (how big a problem?) Fear of discrimination in clinical &
research practice Several studies show fear of genetic
discrimination is the most common reason for declining genetic services
Legislation
Oregon Genetic Privacy Act 1995: goal of protecting individuals from employment and insurance discrimination on the basis of genetic test results
•HIPAA – Health Insurance Portability & Accountability Act 1996 (took effect 2003): 1)genetic information shall not be deemed a preexisting condition and 2)restricts group health plans from using genetic information to determine insurance eligibility and premiums
•Genetic Information Nondiscrimination Act of 2005: 1)prohibits discrimination in enrollment & premiums based on request for or receipt of genetic services and 2)prohibits requiring genetic testing
Diagnostic Testing for HD
Onset mild chorea at 45
Normal MRI, thyroid, B12, Vit E
Depression/anxiety/memory loss by 50
42 CAGs
Prolonged diagnosis
Focus on prognosis/management
Testing usually done by neurologist
How to contact biologic family
Applications for Genetic Testing
?
?
Diagnostic testing
Presymptomatictesting
Prenatal testing
= Huntington disease
Genetic Testing Guidelines
Genetic Counseling Results Support Psychological Consequences of Testing Testing Symptomatic Individuals Vs. Non-
symptomatic Family Issues/Communication Reproductive Decisions/Options Genetic Discrimination
Reproduction Options
Natural reproduction without genetic testing Prenatal testing by amniocentesis or chorionic
villus sampling –disclosing vs. non-disclosing testing
Egg or sperm donor Adoption Surrogate mother Pre-implantation genetic diagnosis
Most Common Concerns about HD
When will I get HD? Is there a cure for HD? How severe will my symptoms be? How do I tell my children about their risk
and how do I get them tested?
Common risks in Predictive Testing for Huntington Disease Negative results are not always a happy
ending
BTL at 25
Tested at 44
Not tested
4
Risks in Predictive Testing –survivor guilt & “unplanned future”
Youngest child was 17 at time of testing
No symptoms at age 45
Considering career change
6 months after normal test result, depression requiring hospitalization
Onset 20s
?
Risks in Predictive Testing Unanticipated Results
35 & 22 CAGs
Patient did not reveal existence of son until after test results
Son was product of brief relationship, and was adopted out through a state agency
Risks in Predictive Testing
Bad outcomes may occur regardless of result Time of risk differs Risk factors for suicide after testing include:
unemployment past history of depression
contact with persons with Huntington disease no children/no partner Suicide risk is 4-8 times higher than in non-HD population, and is 2-
4 times higher among partners of persons with HD Risks for depression higher with result discrepant from expectation
Risks in Predictive Testing
2 Onset 30s
Suicide following uncle’s death
Genetic Test Applications•Prenatal/preimplantation testing
•Diagnostic testing
•Presymptomatic testing
•Predisposition testing
•Carrier testing
•Newborn screening
Predisposition Genetic Testing
Testing of healthy/unaffected persons for a condition with incomplete penetrance
Examples include:
BRCA1/2 gene mutations
Hemochromatosis
Genetic Counseling needs affected by availability of interventions, certainty of disease
ELSI: Genetic Testing
Should testing be done for susceptibility genes? role of environmental factors in disease development
Should parents have the right to have their minor children tested for adult-onset diseases?
Are current genetic tests reliable and interpretable by the medical community?
Awareness of Family Health History as a Risk Factor for Disease Survey of consumers conducted by the
CDC 96.3% of respondents considered
knowledge of family history important to their personal health
30% reported actively collecting health information from relatives to develop a family health history
www.cdc.gov/mmwr/preview MMWR 11/12/04/53(44)
Genetic Tests Differ from Common Laboratory Tests
Because most genetic disorders are rare, genetic testing is often done only by specialized laboratories.
Intense research efforts in molecular genetics result in the rapid development and availability of new genetic tests; therefore, healthcare providers need to continuously update their knowledge.
In order for genetic testing to yield meaningful results: multiple test methodologies may be required other family members may need to be tested a genetics consultation may be appropriate
Charcot- Marie –Tooth Hereditary Neuropathy Disease characteristics: Charcot-Marie-Tooth (CMT) hereditary
neuropathy refers to a group of disorders characterized by a chronic motor and sensory polyneuropathy. The affected individual typically has distal muscle weakness and atrophy often associated with mild to moderate sensory loss, depressed tendon reflexes, and high-arched feet. The CMT hereditary neuropathies are categorized by mode of inheritance and causative gene or chromosomal locus.
20 years ago, known by mode of inheritance Currently: autosomal recessive - 7 genes autosomal dominant - type 1 with >4 genes type 2 with>6 genes X-linked - >2 genes
www.geneclinics.org; author Tom Bird, M.D.
Family History of CMT
8 yr.
No symptoms
3 yr.
toe-walker
Possible symptoms
No insurance ?
Should kids be tested?
Who decides?
What test?
CMT Gene Locations
Duchenne/Becker Muscular Dystrophy X-linked Cause may be family mutation, new mutation, or gonadal
mosaicism Caused by mutations in dystrophin gene Gene testing can involve multiple steps: 2/3 have large deletion in dystrophin gene 5-10% have point mutation 5-10% may have duplication rest unknown? DNA testing often obviates need for muscle biopsy New health issues for female carriers
Duchenne/Becker Muscular Dystrophy
p6 24
1) no deletion
2) sequencing normal
3) duplication testing not available clinically
Counseling Issues:
Who is at risk
Prenatal testing available?
What will happen to genetic testing over the next decade?Dr. Francis Collins www.genome.gov, A Brief Primer on Genetic Testing
Major genetic factors involved in susceptibility to common diseases like diabetes, heart disease, Alzheimer’s disease, cancer, and mental illness will be uncovered in the next 5-7 years
“It will be important to remember, however, that most of these tests will not be “yes” or “no” but rather will predict relative risk”
top related