lrp6 regulates ldlr mediated ldl uptake
Post on 12-Sep-2021
2 Views
Preview:
TRANSCRIPT
LRP6 regulates LDLR‐mediated LDL uptake
Zhi‐jia Ye1,2, Gwang‐Woong Go1, Rajvir Singh1, Wenzhong Liu1, Ali Reza Keramati1, and Arya Mani1,3*
From 1&3 The Departments of Internal Medicine and Genetics, Yale University School of Medicine,
New Haven, CT 06510, USA and 2) College of Preventive Medicine, Third Military Medical University,
Chongqing400038, China *Address correspondence to Arya Mani, MD, 333 Cedar Street, New Haven, CT 06510, Email:
arya.mani@yale.edu
Background: Elevated serum LDL cholesterol is a major risk factor for atherosclerosis. Mechanisms that regulate LDL homeostasis are not well understood. Results: LRP6 forms complex with LDLR and other endocytic proteins and its knockdown or mutation impairs LDLR endocytosis. Conclusion: LRP6 regulates LDLR‐dependent
LDL uptake.
Significance: LRP6 is a potential target for
development of novel lipid‐lowering drugs.
Genetic variations in LRP6 gene are associated with high serum LDL cholesterol levels. We have previously shown that LDL clearance in peripheral B‐lymphocytes of the LRP6R611C mutation carriers is significantly impaired. In the current study we have examined the role of wildtype LRP6 (LRP6WT) and LRP6R611C in LDL receptor (LDLR) mediated LDL uptake. LDL binding and uptake were increased when LRP6WT was overexpressed and modestly reduced when it was knocked down in LDLR deficient CHO (ldlA7) cells. These findings implicated LRP6 in LDLR‐independent cellular LDL binding and uptake. However, LRP6
knockdown in wildtype CHO cells resulted in a much greater decline in LDL binding and uptake compared to CHO‐ldlA7 cells, suggesting impaired function of the LDLR. LDLR internalization was severely diminished when LRP6 was knocked down and was restored after LRP6 was reintroduced. Further analysis revealed that LRP6WT forms a complex with LDLR, clathrin and ARH and undergoes a clathrin‐mediated internalization after stimulation with LDL. LDLR and LRP6 internalizations as well as LDL uptake were all impaired in CHO‐k1 cells expressing LRP6R611C. These studies identify LRP6 as a critical modulator of receptor‐mediated LDL endocytosis and introduce a mechanism by which variation in LRP6 may contribute to high serum LDL levels. Elevated serum LDL cholesterol is a major risk
factor for atherosclerosis and myocardial
infarction (1). Despite great advances in
development of effective lipid‐lowering drugs,
an adequate control of serum lipids in patients
with very high serum LDL levels is seldom
1
http://www.jbc.org/cgi/doi/10.1074/jbc.M111.295287The latest version is at JBC Papers in Press. Published on November 28, 2011 as Manuscript M111.295287
Copyright 2011 by The American Society for Biochemistry and Molecular Biology, Inc.
by guest on April 11, 2019
http://ww
w.jbc.org/
Dow
nloaded from
achieved (2). The major determinant of plasma
LDL cholesterol levels is the rate of LDL
clearance from the plasma. Much of our
knowledge about the LDL clearance and
trafficking comes from rare Mendelian
disorders that impair its endocytosis (3‐7).
However, the identified genetic variants
account for only a fraction of inherited lipid
abnormalities in the general population.
Accordingly, our knowledge about mechanisms
that regulate LDL clearance is far from
complete.
We recently reported that LDL receptor
related protein 6 (LRP6) regulates LDL
cholesterol clearance (8). Individuals with rare
nonconservative LRP6R611C mutation have in
their third or fourth decades of life LDL
cholesterol levels that are comparable to values
observed in patients with heterozygote familial
hypercholesterolemia (9). Furthermore,
common variations within LRP6 gene have been
associated with modest elevation in serum LDL
in the general population (10). We have
previously demonstrated that an intact LRP6
function is necessary for normal LDL uptake (8).
In the same study, we showed that the splenic
macrophages of LDLR+/‐ mice display reduced
LDL uptake compared to wildtype mice. We also
demonstrated that the peripheral B‐
lymphocytes of LRP6R611C mutation carriers
exhibit impaired LDL internalization compared
to their non‐carrier relatives (8). Conversely, In
vitro overexpression of LRP6 in NIH3T3 cells
increased cellular cholesterol uptake (same
reference). Since these studies were all carried
out in cells which express LDL receptor, it
remained to be determined as to whether and
to what extent the function of LRP6 in LDL
clearance is LDLR‐dependent. Furthermore, the
extent of ApoB binding of LRP6 was not
sufficiently strong to explain the severe degree
of hyperlipidemia in LRP6 mutation carriers. In
this study we examined the effect of LRP6 on
LDLR function and LDLR‐dependent LDL uptake .
In addition, the interaction between LRP6 and
key proteins involved in vesicular cholesterol
transport was investigated. Finally, the effect of
LRP6R611C on LDLR function and LDLR‐mediated
LDL uptake in CHO‐k1 cells was examined.
EXPERIMENTA PROCEDURES
Antibodies, cell lines and human skin
fibroblasts‐ Antibodies for LRP6, HA tag,
clathrin, caveolin‐1, CD44, and β‐actin were
purchased from Cell Signaling Technology (MA).
Antibody for Na+‐K+‐ATPase1 was from Santa
Cruz Biotechnology (CA). Dil‐LDL (BT‐904) and
human I‐125 LDL (BT‐913R, specific activity 0.20
µCi/µg) were purchased from Biomedical
Technologies Inc., MA. Antibodies for ARH, and
LDLR were purchased from Novus Biologicals
(CO). Clathrin specific shRNAs were purchased
from Santa Cruz Biotechnology. CHO‐ldlA7 cells
were gift from Dr. Monty Krieger. CHO‐k1 cells
2
by guest on April 11, 2019
http://ww
w.jbc.org/
Dow
nloaded from
and CHO‐ldlA7 cells were maintained in F12
medium supplemented with 10% FBS and 1%
pen‐strep. Wildtype and Cav‐1 knockout MEFs
were kindly provided by Dr. Martin Schwartz at
Yale. Human skin fibroblasts were obtained
from LRP6R611C mutation carriers and four
unaffected relatives by routine skin biopsies.
MEF, HepG2, HEK293 cells and human skin
fibroblasts were maintained in DMEM medium
supplemented with 10% FBS and 1% pen‐strep.
Plasmids, point‐mutant generation, and cell
transfection‐ Vectors expressing HA‐tagged
LRP6WT or HA‐tagged LRP6R611C were generated
as previously described (9). Plasmid LRP6‐EYFP
was a gift from Dr. Christof Niehrs. LRP6R611C‐
EYFP was generated by point‐mutation. Briefly,
a C for T mutation at the nucleotide position
1831 in human LRP6 gene was introduced using
QuikChange Site‐Directed Mutagenesis Kit
(Stratagen, CA) as instructed by the
manufacturer. Thermal cycling reaction was
carried out using high fidelity DNA polymerase
and complementary mutagenic primers. The
forward and reverse primer sequences were 5’
CTATAGACCTCAGGGCCTTTGCTGTGGCTTGCCCT
ATTG 3’ and 5’
CAATAGGGCAAGCCACAGCAAAGGCCCTGAGGTC
TATAG 3’ respectively. Cell transfections were
carried out with Fugene6 (Roche, IN) as per
manufacturer’s instructions.
Immunocoprecipitation‐ cell lysates (2 mg)
were subjected to overnight
immunoprecipitation with HA antibody in
presence of protein A/G Sepharose beads at
4 °C. The following day, the
immunoprecipitants were washed with lysis
buffer three times, applied to SDS‐gel
electrophoresis and subsequently analyzed
by western blotting using antibody against
LDLR, clathrin, and ARH.
Immunoprecipitation with LDLR antibody
and immunoblotting with HA antibody was
carried out similarly.
Metabolic labeling‐CHO cells were plated in 6‐
well plates and grew to 70% confluent. Cells
were washed multiple times and incubated in
0.2 mCi/mL of [35S]‐cysteine in MEM w/o cys +
1x Gln for 30 min for pulse‐chase labeling or 4 h
for continuous labeling at room temperature.
After several washes with cold PBS, 2 ml/well of
Chase media (37°C) were added. At the end of
each time point, cells were washed, lysed in
cold lysis buffer in presence of PMSF and placed
on a rocker for 30 min at 4°C. Lysates were
centrifuged for 1 min at 14,000 rpm in a 4°C
and the supernatant was transferred to a new
set of tubes where 500 µl/tube HA monoclonal
antibodies were added for
immunoprecipitation. Subsequently 50 µl/tube
Protein A beads were added to the samples,
3
by guest on April 11, 2019
http://ww
w.jbc.org/
Dow
nloaded from
placed on a rocker at 4°C overnight and
subsequently washed with cold PBS. Beads
were spun down for 1 min at 4,000 rpm, boiled
for 5 min and the supernatant was loaded onto
gel(s), fixed and exposed to films.
Stable shRNA knockdown of LRP6 and clathrin‐
The lentivirus vectors expressing LRP6 targeting
shRNA (5’ CGGCGAATTGAAAGCAGTGAT 3’)
were constructed as described (11). Briefly 0.5
million of CHO‐k1 or CHO‐ldlA7 cells were
plated in 6‐well plates one day before infection.
Polybrene was added into medium to the final
concentration of 5 μg/ml. Lentivirus particles
were added into the medium for 24 h. On the
next day medium was replaced and transduced
cells were transferred to medium
supplemented with 5 ug/ml of puromycin.
Binding and uptake of LDL‐ CHO‐k1 and CHO‐
ldlA7 cells either overexpressing wildtype LRP6
or LRP6R611C, or transfected with shGFP or
shLRP6 were cultured in F12 medium
supplemented with 5% human lipoprotein
deficient serum (LPDS) for 24 h, followed by
treatment with I125‐LDL for binding assay or with
dil‐LDL for uptake study. For binding assay, cells
were pre‐chilled for 30 min at 4 °C, followed by
adding I125‐LDL (10 µg/ml) in F12 culture
medium supplemented with LPDS for 2 h at 4°C.
Following several at 4°C with DPBS, cells were
incubated with 2 ml of sodium dextran sulfate
(4 mg/ml) in DPBS for 1 hour at 4 °C. An aliquot
was placed in liquid scintillation counter (LSC) to
determine the total amount of I125‐LDL bound to
the cell surface. Cells were harvested and the
lysate was used to measure protein
concentration. For LDL uptake, cells were
incubated in LPDS with dil‐LDL (10 μg/ml) for 2
h at 37°C. Cells were harvested and washed
twice with ice‐cold PBS and analyzed by FACS.
For treatment with lipoprotein lipase (LPL), cells
were incubated in medium B supplemented
with 1 µg/ml LPL inactivated with
tetrahydrolipostatin (1:2,000).
Confocal imaging‐ Cells were placed in 24‐well
plates containing poly‐D‐lysine coated
coverslips. After lipoprotein starvation, cells
were treated with human LDL (hLDL, 20 μg/ml).
Cells were fixed by 4% paraformaldehyde for 10
min, permeabilized with 0.05% Triton X‐100 in
PBS for 5 min, and blocked by 3% BSA in PBS for
1 h. Cells were then washed and incubated with
1:100 diluted antibodies for LRP6 (Abgent),
clathrin (BD), caveolin (BD), or LDLR (Abcam)
overnight at 4°C. Subsequently cells were
washed and incubated with 1:100 diluted Alexa
Fluor 488 and Alexa Fluor 568 fluorescence‐
conjugated secondary antibodies (Invitrogen) at
RT for 1 h. Coverslips were mounted with
ProLong Gold Antifade with DAPI (Invitrogen).
Specimens were examined by Nikon Ti‐E Eclipse
inverted microscope equipped with Perfect
4
by guest on April 11, 2019
http://ww
w.jbc.org/
Dow
nloaded from
Focus using excitation and emission filters at
488 nm and 561 nm, respectively.
Sucrose density gradient ‐Cultured CHO‐k1 cells
3 x 108 were harvested in cold PBS on ice and
were lysed in 700 µl extraction buffer (25 mM
HEPES (pH 6.5), 150 mM NaCl, 1 mM EDTA, 1%
Triton X‐100, 1 mM PMSF and protease
inhibitor cocktail). The lysate was mixed 1 ml of
with 80% sucrose cushion to yield a mixture of
40% sucrose gradient and then transferred into
a 12‐ml ultracentrifuge tube for SW41 rotor. At
top of the sample‐sucrose mixture (2 ml), 6.5 ml
of 30% sucrose and 3.5 ml of 5% sucrose
cushion were overlaid respectfully.
Ultracentrifugation was done at 34,500 rpm for
20 h at 4°C using Beckman SW 41 rotor. After
centrifugation, fractions were collected from
the bottom of the tube with 20‐gauge needles
and analyzed by immunoblotting with the
indicated antibodies.
Isolation of cell surface proteins‐ Endocytosis of
the LDLR or LRP6 was monitored using a
protocol described previously (12). HA‐tagged
LRP6WT or LRP6R611C transfected CHO cells were
used for LDLR endocytosis, and wildtype or
caveolin1 knockout MEFs were used for LRP6
endocytosis. After 24 h lipoprotein starvation,
monensin (25 µM) and human LDL (20 µg/µl)
were added and incubated for 0, 5, 20, or 60
min. Cells were plunged into ice‐cold PBS to
inhibit further endocytosis, washed with cold
PBS, resuspended in 1 ml of PBS plus
sulfosuccinimidyl‐6‐biotinamido hexanoate (1
mg/ml), and incubated for 30 min at 4 °C with
end‐over‐end mixing. Samples were then
processed for surface expression of LDLR using
neutravidin‐agarose. Cell surface proteins were
eluted from the beads by adding 1X SDS loading
buffer and were immunoblotted using indicated
antibodies.
Statistical analysis‐ All experimental data
represent results from four independent
experiments. Protein expression levels were
quantified by densitometry of Western blots.
Statistical analysis was carried out with two‐
factor analysis of variance (ANOVA). Statistical
Comparisons were done using Analyse‐it®
statistic software. A probability value of P < 0.05
was considered as statistically significant for all
experiments.
RESULTS
LRP6 regulates LDLR‐independent cellular LDL
uptake‐ To study LDLR‐independent effect of
LRP6 on LDL uptake, CHO‐ldlA7 were
transfected with plasmids containing HA tagged
LRP6WT or empty vectors. These cells lack LDLR
(Fig. 1A). Binding of I125 LDL to cell surface was
analyzed using liquid scintillation counter and
cellular uptake of dil‐LDL (LDL labeled with 1,1’‐
dioctadecyl‐3,3,3’,3’‐tetramethylindo‐
carbocynanine perchlorate) was examined using
FACS analysis. CHO‐ldlA7 cells expressing
5
by guest on April 11, 2019
http://ww
w.jbc.org/
Dow
nloaded from
LRP6WT showed significantly higher LDL binding
at 4°C compared to vehicle alone (P<0.001) (Fig.
1B). Accordingly, LDL uptake at 37°C was
increased in cells expressing LRP6WT by 25%
compared to cells transfected with vehicle
alone (P<0.01) (Fig. 1C).
We next knocked down LRP6 by RNA
interference in CHO‐ldlA7 cells and examined its
effect on LDL clearance. The shRNA reduced
LRP6 protein levels by greater than 80% (Fig.
1D). RNA interference (shLRP6) resulted in a
modest, but significant, reduction in LDL
binding and internalization of these cells
compared to cells transfected with GFP‐shRNA
(P<0.05) (Fig. 1E, F). These findings implicated
LRP6 in LDLR independent LDL uptake.
LRP6 modulates LDLR‐mediated LDL uptake‐ The
modest effect of LRP6 on LDL uptake could not
explain the severity of hyperlipidemia in
patients with loss of function LRP6 mutation. To
study the effect of LRP6 on LDLR‐ mediated LDL
uptake, wildtype CHO cells (CHO‐k1) were
transfected with plasmids containing HA tagged
LRP6WT or vehicle alone. LDL binding
significantly increased in cells overexpressing
LRP6WT (P<0.01) compared to vehicle alone (Fig.
2A). Baseline LDL uptake was significantly
higher in CHO‐k1 compared to CHO‐ldlA7 cells.
Analogous to CHO‐ldlA7 cells, CHO‐k1 cells
expressing LRP6WT exhibited increased LDL
internalization compared to vector alone (Fig.
2B) (P<0.05). Strikingly, there was much greater
increase in LDL uptake caused by LRP6WT
overexpression in CHO‐k1 vs. CHO‐ldlA7 cells.
Conversely, LRP6 knockdown with LRP6‐specific
shRNA reduced LDL binding (P< 0.05) and
internalization(P<0.01) in CHO‐k1 cells
compared to cells transfected with a GFP
shRNA(Fig. 2C, 2D). In these cells LDLR was
expected to compensate for the impaired
function of LRP6 in LDL uptake. On the contrary,
LRP6 knockdown resulted in a much greater
decline in LDL binding and internalization in
CHO‐k1cells compared to CHO‐ldlA7 cells.
Furthermore, opposite to CHO‐ldlA7 cells, CHO‐
k1 cells exhibited a steady decline in LDL
clearance after LRP6 knockdown. These
findings indicated impaired function of LDLR in
absence of LRP6 and strongly implicated LRP6 in
LDLR‐dependent LDL uptake. The lipoprotein
lipase (LPL)‐facilitated LDL uptake has shown to
be a LDLR‐dependent process (13). The effect of
LRP6 on LPL‐facilitated LDL uptake was
examined in CHO‐k1 cells. Cells overexpressing
LRP6WT exhibited >1.8 fold (P<0.01) increase in
LDL uptake in response to LPL compared to
vector alone (Fig. 2E). LPL did not change LDL
uptake in CHO‐ldlA7 cells before and after
overexpression of LRP6WT (data not shown). This
finding underscores the critical role of LRP6 in
LDLR‐mediated LDL uptake.
6
by guest on April 11, 2019
http://ww
w.jbc.org/
Dow
nloaded from
LRP6 is necessary for LDLR internalization‐ The
effect of LRP6 on LDLR function was assessed by
the LDLR internalization in response to LDL. The
rate of LDLR disappearance from the cell
surface in response to LDL (10 μg/ml) was
examined in CHO‐k1 cells after LRP6 was
knocked down by RNA interference. Cells were
infected with lentivirus vectors expressing LRP6
targeting shRNA and treated with monensin to
block LDLR recycling. LDLR on the cell surface
was biotinylated and were isolated using
neutravidin agarose. The isolated protein was
immunoblotted to assess for surface LDLR 30
and 60 min after treatment with LDL. In cells
expressing sham shRNA, LDLR internalization
was detectable 30 min after LDL was added to
the medium. The amount of LDLR in the cell
lysates before isolation of the biotinylated
protein was unchanged, indicating that the loss
of surface LDLR was not due to the reduction in
total LDLR content. The membrane LDLR in
response to LDL remained relatively unchanged
when LRP6 was knocked down, indicative of its
impaired internalization (Fig. 3A). The impaired
function of the LDLR was rescued when cells
were transfected with plasmid containing
LRP6WT (Fig. 3B). These results indicated that
LRP6 is indispensable for proper LDLR
internalization.
LRP6 colocalizes and forms complex with LDLR
and clathrin‐ The conventional wisdom is that
LRP6 is a lipid raft receptor protein which is
internalized after Wnt stimulation in a Cav‐1
mediated process (14). The intriguing effect of
LRP6 on LDLR internalization prompted us to
readdress this issue. The subcellular localization
of LRP6 in relationship to LDLR and clathrin was
examined by sucrose gradient fractionation in
CHO‐k1 cells. The analysis showed that the
majority of LRP6 resides in membrane fractions
which contain clathrin and LDLR (Fig. 3C) and
only a small quantity of LRP6 was present in
Cav‐1 containing fraction. These findings
prompted further studies to examine the
interaction between LRP6 and LDLR.
To determine whether LRP6 and LDLR
form a complex, immunocoprecipitation studies
in CHO‐k1 cells transfected with plasmids either
expressing HA tagged LRP6WT or vectors alone
were carried out. Proteins from cell lysates
were immunoprecipitated with anti‐HA or anti‐
LDLR antibodies followed by Western blotting
with anti‐LDLR or anti‐HA antibodies,
respectively. The analysis showed that LRP6
forms a complex with LDLR (Fig. 3D).
Associations between LRP6, clathrin
and ARH were also examined by
immunocoprecipitation studies (Fig. 3D). There
was only a weak association between LRP6 and
clathrin at baseline, which dramatically
increased in presence of LDL. In contrast, the
maximum physical association between ARH
and LRP6 was at baseline (see below). The
7
by guest on April 11, 2019
http://ww
w.jbc.org/
Dow
nloaded from
specificity of these reactions was demonstrated
by absence of coimmunoprecipitaion of LRP6
with IgG.
We examined cellular localization of the
LDLR and LRP6 in normal cultured human skin
fibroblasts by immunocytochemistry and
confocal microscopy (Fig. 3E). LRP6 and LDLR
colocalized both on the cell surface and within
the cytoplasm. After stimulation with LDL, both
membrane proteins translocated to the same
juxtanuclear region.
LDL‐mediated LRP6 internalization is clathrin‐
dependent‐ We examined membrane
expression of LRP6WT in CHO‐k1 cells over a time
course of 60 min after treatment with LDL and
in presence of monensin. There was no change
in total expression of LRP6WT (data not shown).
Membrane expression of the LRP6WT decreased
steadily during this time period, indicating its
internalization in response to LDL (Fig. 4A).
Non‐vesicular LDL uptake is a clathrin‐
independent process (15), that is associated
with upregulation of large network of
invaginations originating from the plasma
membrane (13). Cav‐1 promotes formation of
tubular invaginations (16,17) and has been
implicated in LDL trafficking within cells (18,19).
In addition, Cav‐1 is required for Wnt3a‐
mediated LRP6 internalization and activation
(14). We investigated if Cav‐1 is required for
LDL‐mediated LRP6 internalization. LRP6
internalization in Cav‐1(‐/‐) mouse embryonic
fibroblasts (MEFs) was compared to control
MEFs in presence of monensin. There was no
significant difference in LRP6 internalization
between the two cell types (Fig. 4C). This
finding suggested that the LDL‐mediated
internalization of LRP6 is caveolin independent.
The process of LDLR‐dependent LDL
clearance starts from binding of LDL by LDLR
and its endocytosis mediated by clathrin coated
vesicles. LRP6 is a member of LDLR family with
structural domains similar to LDLR. To examine
the role of clathrin in LRP6 endocytosis during
LDL uptake, clathrin was knocked down by RNA
interference in MEFs. The RNA interference
reduced expression of clathrin by more than 90
percent (Fig. 4B). LRP6 internalization in
response to LDL was significantly impaired
when clathrin was knocked down by RNA
interference (Fig. 4C). Immunohistochemical
studies of normal human skin fibroblasts
showed colocalization of LRP6 with clathrin and
their translocation to the juxtanuclear region 30
minutes after exposure to LDL (Fig. 4D).
Surprisingly, there was no significant
colocalization between LRP6 and Cav‐1 in these
cells before or after stimulation with LDL. These
findings suggest that clathrin mediates
internalization of both LDLR and LRP6.
We next examined the time course of
physical association between LRP6 and clathrin
in response to LDL by immunocoprecipitation
8
by guest on April 11, 2019
http://ww
w.jbc.org/
Dow
nloaded from
studies. The immunocoprecipitation of LRP6
and clathrin was examined in CHO‐k1 cells for
60 min after LDL (10 μg/dl) stimulation.
Complex formation between LRP6 and clathrin
was weak at baseline but peaked at 30 minutes
post stimulation with LDL (Fig. 4E). In contrast,
ARH and LRP6 formed a complex in absence of
LDL. This complex is barely detectable after 30
minutes and is undetectable after 60 minutes
stimulation with LDL (Fig. 4F). These findings are
consistent with the roles of clathrin and ARH as
endocytic and adaptor proteins, respectively
(20). Taken together, these results suggest that
LRP6 serves as a critical protein for vesicular LDL
uptake.
LRP6R611C impairs LDL uptake and LDLR
internalization‐ LRP6R611C mutation carriers have
such dramatically elevated serum LDL
cholesterol level, which could not be solely
explained by isolated impairment of the LDLR‐
independent LDL uptake. This raised the
question as to whether R611C mutation impairs
LDLR function. We expressed LRP6R611C in CHO‐
k1 and CHO‐ldlA7 cells and compared its effect
on cell surface LDL binding and LDL
internalization with those of the LRP6WT or
empty vector. There was no significant change
in total expression levels of LRP6WT and
LRP6R611C (Fig. 5A). Similarly, a pulse chase study
carried out for 120 min showed no decline in
total LRP6 at the given time points, suggesting
absence of protein degradation (Fig. 5B). The
membrane expression of LRP6R611C was slightly
lower than LRP6WT (Fig. 5C). This we had
previously shown to be caused by impaired
recycling of the mutant protein. Accordingly,
the amount of LRP6R611C protein
immunocoprecipitated with LDLR and clathrin
was significantly lower compared to LRP6WT (Fig.
3D). Expression of LRP6R611C in both CHO cell
types, however, completely failed to increase
LDL binding and internalization (Fig. 1A, B and
2A, B). The rate of LDLR disappearance from the
cell surface in response to LDL (10 μg/ml) was
examined between CHO‐k1 cells expressing
LRP6WT and LRP6R611C. The baseline expression
levels of the membrane LDLR were slightly
higher in cells expressing LRP6R611C compared to
LRP6WT, likely due to a feedback mechanism
triggered by the impaired LRP6‐dependent LDL
uptake. However, the LDLR internalization in
response to LDL (10 μg/ml) was markedly
reduced in CHO‐k1 cells expressing LRP6R611C
compared to LRP6WT and vector alone (Fig. 5D).
Immunostaining of the LDLR and clathrin in skin
fibroblasts of noncarriers of the LRP6 mutation
showed redistribution of the LDLR/clathrin
complex from cell surface to a juxtanuclear
region 30 minutes after stimulation with LDL
(Fig. 5E). However, LDLR/clathrin complex was
at this time point still significantly present on
the surface of the skin fibroblasts of LRP6R611C
mutation carriers. Taken together, these
findings strongly suggested impaired function of
9
by guest on April 11, 2019
http://ww
w.jbc.org/
Dow
nloaded from
the mutant receptor protein in promoting LDLR
internalization and LDL uptake.
We next compared internalization of
LRP6R611C and LRP6WT in CHO‐k1 cells treated
with monensin to block recycling. The
internalization of the LRP6R611C compared to
LRP6WT was dramatically reduced (Fig. 4A). At
the baseline, there was a modest association
between LRP6R611Cand ARH demonstrated by
immunocoprecipitation (Fig. 3E, 4E). This
association, however, remained unchanged
over a time course of 60 min after LDL exposure
(Fig. 4E). Taken together, these findings
suggested impaired vesicular endocytosis
caused by LRP6 mutation. Diminished LDL
uptake results in increased LDL synthesis
through a feedback mechanism (21).
Accordingly, the key enzyme of the cholesterol
biosynthesis, HMGCR, was expressed at
significantly higher levels in cells expressing
LRP6R611C compared to LRP6WT (Fig. 5E).
These studies imply the critical role of
LRP6 in vesicular trafficking and suggest that
the impairment of this function is an important
contributor to the elevated LDL cholesterol
levels in LRP6R611C mutation carriers.
DISCUSSION
LRP6 is a member of the LDL receptor‐
related family, which are transmembrane cell
surface proteins involved in receptor‐mediated
endocytosis. LRP6, however, is widely known
for its role as a Wnt coreceptor in the canonical
signaling pathway during embryonic
development (22). Although this protein is
ubiquitously expressed post‐embryonically (23),
its function in adult tissues has remained largely
elusive. We have previously shown that
individuals with rare nonconservative
LRP6mutations have LDL levels that resemble
those of the individuals with heterozygote
familial hypercholesterolemia (9, 10). Common
variants of this gene have been associated with
modest elevation of the LDL in independent
populations (10). These studies have implicated
the emerging role of LRP6 in regulation of the
circulating LDL and as a potential target for
lipid‐lowering therapy.
We have previously shown that LRP6
promotes LDL uptake and this function is
impaired in the lymphocytes of LRP6R611C
mutation carriers. However, whether LRP6‐
mediated LDL uptake is independent of LDLR
function was not examined. The most critical
finding of the current study is the identification
of LRP6 as a regulator for LDLR‐mediated LDL
uptake. The evidences came from much greater
alterations in LDL binding and clearance in
wildtype CHO compared to LDLR deficient CHO‐
ldlA7 cell when LRP6 was overexpressed or
knocked down. Most notably, the LDLR
endocytosis was significantly impaired in CHO‐
k1 cells when LRP6 was knocked down or
10
by guest on April 11, 2019
http://ww
w.jbc.org/
Dow
nloaded from
mutated. LRP6 colocalized and
immunocoprecipitated with LDLR. A sucrose
gradient centrifugation demonstrated that LRP6
resides in the same membrane fraction with
LDLR and clathrin. Immunohistochemical
studies confirmed the colocalization of LRP6,
clathrin and LDLR. Further analysis showed that
LRP6 forms a complex with LDLR, ARH and
clathrin and undergoes a clathrin‐dependent
endocytosis after exposure to LDL. These
findings suggested that LRP6 functions as a
critical scaffolding protein that promotes
formation of a complex between LDR and
endocytic machinery and triggers their
endocytosis. Dissection of the intracellular
trafficking of LRP6 requires additional
investigations that were beyond the scope of
the current study.
LRP6R611C expression in CHO‐k1
significantly impaired LDLR internalization and
failed to enhance LDL binding or uptake. Since
LDLR is the major regulator of the cellular LDL
clearance, its altered function has possibly a
major impact on the circulating LDL levels of
LRP6 mutation carriers. Impaired LDL uptake in
cells expressing LRP6R611C should also trigger LDL
biosynthesis. Such evidence comes from higher
HMGR expression in cells expressing LRP6R611C
vs. LRP6WT. Whether and to what extent
HMGCR inhibitors can reduce serum LDL in
LRP6 mutation carriers remains to be
determined.
In this study we also demonstrate a
modest, but significant, role of LRP6 in LDLR‐
independent LDL uptake. We have previously
shown that LRP6 binds apoB and is present in
early endosomes. Whether LRP6 is recognized
by the LDLR‐related adaptor proteins is
unknown at this point. LRP6 contains several
putative YXXϕ motifs for potential binding to
AP‐2 (where X stands for any amino acid and
ϕfor a bulky hydrophobic residue) (24‐26)
(27,28). One of these motifs is in close proximity
of the R611C mutation site. Interestingly, the
internalization of LRP6R611C was also significantly
impaired. Additional experiments are necessary
to determine which motif(s) of LRP6 is (are)
required for its recognition by adaptor proteins
and for its internalization.
Cav‐1 is a protein required for LRP6
internalization upon Wnt stimulation (14) and
has shown to be involved in LDL trafficking (18,
19). Cav‐1 was, however, not necessary for
LRP6 internalization in response to LDL.
Strikingly, sucrose gradient centrifugation
demonstrated that LRP6 resides mainly in
fractions containing clathrin as opposed to
caveolin. Taken together, these results suggest
that LRP6‐mediated LDL uptake is a clathrin but
not a caveolin dependent process.
In sum, our results strongly indicate
that LRP6 is a critical modulator of vesicular LDL
uptake. This conclusion comes from a collective
data ranging from identification of a rare LRP6
11
by guest on April 11, 2019
http://ww
w.jbc.org/
Dow
nloaded from
12
mutation in a large kindred with dramatically
elevated LDL cholesterols, demonstration of
defective LDL clearance in cells from mutation
carries and strong in vitro findings of impaired
LDLR function in cells expressing mutant LRP6
or deficient for it. Thus, LRP6 should be
regarded as a potential target for development
of novel therapeutics in hyperlipidemia.
by guest on April 11, 2019
http://ww
w.jbc.org/
Dow
nloaded from
FOOTNOTES
We thank Dr. Monty Krieger for kindly providing us with the CHO‐ldlA7 cells. We would also like to give
our thanks to Dr. Martin Schwartz for his critical advice and for providing us with wildtype and Cav‐1
knockout mouse embryonic fibroblasts. Our special thanks go also to Dr. Christof Niehrs for generously
sending us the LRP6‐EYFP plasmid. The work was supported by R01HL094784‐01 and R01HL094574‐03.
FIGURE LEGENDS
Fig. 1 (A‐F)LDLR independent binding and internalization of LDL by LRP6. CHO‐ldlA7 cells were transfected
with plasmids encoding HA‐tagged LRP6WT, LRP6R611C or with vector alone (CTL). CHO‐LdlA7 cells lack LDLR (A
). Cells were cultured in 5% human LPDS for 24 h followed by addition of I125‐LDL (10 µg/ml) for 2 h at 4°C.
For the binding assays. For LDL uptake dil‐LDL (10 μg/μml) was added to the medium at 37°C for 2 h and
analyzed by FACS. Cells expressing LRP6WT had significantly greater and those expressing LRP6R611C
significantly lower LDL binding compared to controls (B). Similarly cells expressing LRP6WT had significantly
higher LDL uptake compared to vector alone (CTL) and cells expressing LRP6R611C (C). LRP6 specific shRNA
knocked down LRP6 in CHO‐ldlA7 cells by more than 80% (D). LRP6 knockdown by RNA interference
modestly reduced LDL binding (E) and uptake (F) compared to GFP shRNA (mean±SEM. *P<0.05, **P<0.01,
***P<0.001 by ANOVA)
Fig. 2 (A‐E)Binding and internalization of LDL by LRP6 in presence of LDLR. CHO‐k1 cells were transfected
with plasmids encoding HA‐tagged LRP6WT, LRP6R611C or with vector (CTL) alone. LDL binding and
internalization assays were carried out as described. Cells expressing LRP6WT had significantly higher and
those expressing LRP6R611C showed significantly lower LDL binding compared to the vector alone (A). LRP6WT
caused higher LDL uptake compared to LRP6R611C or vector alone (B). LRP6 knockdown by RNA interference
significantly reduced LDL binding (C) and uptake (D). The decrement in LDL uptake of CHO‐k1 cells was more
dramatic compared to CHO‐ldlA7 cells suggesting impairment of the LDLR activity. Interaction between LRP6
and LDLR was further examined by examining the effect of the LPL on LDL uptake. LPL‐induced increase in
uptake of LDL in CHO‐k1 cells expressing LRP6WT was twice as high compared to vector alone (E)
(mean±SEM. *P<0.05, **P<0.01 by ANOVA).
Fig. 3(A‐E)LRP6 mediates LDLR internalization. LRP6 knockdown by RNA interference significantly
impaired LDLR internalization in CHO‐k1 cells treated with LDL and recycling inhibitor monensin (A). This
13
by guest on April 11, 2019
http://ww
w.jbc.org/
Dow
nloaded from
effect was rescued with transfection of LRP6WT (B). Sucrose density gradient centrifugation in CHO‐k1
cells shows that LRP6 resides predominantly in the membrane fractions containing clathrin and LDLR
compared to Caveoline‐1 (C). LRP6WT and LRP6R611C form complexes with LDLR, clathrin and ARH but not
IgG (used as control) (D). CHO‐k1 cells were transfected with plasmids containing either LRP6WT or
LRP6R611C. Proteins from cell lysates were immunoprecipitated with either anti‐HA or anti‐LDLR followed
by Western blotting with either anti‐LDLR or anti‐HA antibodies, respectively. In addition, after
immunoprecipitation with anti‐HA Western blottings were carried out with anti‐ARH and anti‐clathrin.
Immunohistochemical studies in skin fibroblasts of R611C mutation carriers and noncarriers showed
colocalization of LDLR and wildtype and mutant LRP6 (3E). However, LDLR/LRP6 internalization was
defective in the skin fibroblasts of R611C mutation carriers. In the upper corner of the right panels
higher magnification of the cell surface area shown by the arrows are depicted for better visualization
on).
Fig. 4 (A‐F) Clathrin‐dependent internalization of LRP6 and its impairment by R611C mutation. LRP6 on
the cell surface was biotinylated and were precipitated using neutravidin agarose. The
immunoprecipitated complex was immunoblotted to assess for surface LDLR 30 and 60 min after
treatment with LDL. Wildtype LRP6 started to internalize 30 min after LDL was added to the medium (A).
In contrast, internalization of LRP6R611C was significantly impaired. Clathrin specific shRNA knocked down
clathrin in MEF cells by more than 90 percent (B). LRP6 internalization in Cav1 (‐/‐) MEFs was
comparable to those of the wild type MEFs (C), but was significantly impaired in MEFs after clathrin was
knocked down. Immunohistochemical studies in normal human skin fibroblasts showed significant
colocalization of LRP6 with clathrin, but not with caveolin 1 (D). Clathrin and LRP6 but not Cav‐1
internalized in response to LDL stimulation. Immunocoprecipitation of LRP6, clathrin and ARH over a
time course of 60 min after LDL exposure were carried out. LRP6/clathrin immunocoprecipitation
peaked 30 min after stimulation with LDL (E). ARH andLRP6WTimmunocoprecipitated, but their
association decreased over time after exposure to LDL (F). LRP6R611C immunocoprecipitated with ARH but
its association with LRP6 remained unchanged over a time course of 60 min after LDL exposure,
suggesting impaired endocytosis.
Fig. 5(A‐F)R611C mutation impairs vesicular LDL uptake. CHO‐k1 cells were transfected with
vectors containing HA tagged LRP6R611C, LRP6WT or empty vectors. The total expression of LRP6R611C and
LRP6WT were not significantly different (A). A pulse‐chase study carried out to assess for decay of the
LRP6R611C protein showed no change in its expression at specified time interval (B). There was slight
14
by guest on April 11, 2019
http://ww
w.jbc.org/
Dow
nloaded from
reduction in membrane expression levels of LRP6R611C compared to LRP6WT (C). Membrane expression
levels of LDLR in response to LDL in CHO‐k1cells expressing LRP6R611C and LRP6WT were compared.
LRP6R611C significantly impaired LDLR internalization in (D). HMGCR, the key enzyme of the LDL synthesis,
was expressed at significantly higher levels in cells expressing LRP6R611C compared to LRP6WT (E).
Immunofluorescent staining of the skin fibroblasts from R611C mutation carriers and noncarriers using
antibodies against clathrin and LDLR was carried out (F). LDLR and clathrin internalized after LDL
stimulation in the fibroblasts of mutation noncarriers. In contrast, LDLR and clathrin in the skin
fibroblasts of the mutation carriers remained largely on the cell surface after stimulation with LDL.
15
by guest on April 11, 2019
http://ww
w.jbc.org/
Dow
nloaded from
REFERENCES
1. Rahilly‐Tierney, C. R., Lawler, E. V., Scranton, R. E., and Michael Gaziano, J. (2009) Prev
Cardiol12, 80‐87 2. Varma, R., Aronow, W. S., Gandelman, G., and Zammit, C. (2005) Am J Cardiol95, 269‐270 3. Cohen, J. C., Boerwinkle, E., Mosley, T. H., and Hobbs, H. H. (2006) N Engl J Med354, 1264‐1272 4. Hobbs, H. H., Leitersdorf, E., Leffert, C. C., Cryer, D. R., Brown, M. S., and Goldstein, J. L. (1989) J
Clin Invest84, 656‐664 5. Hobbs, H. H., Russell, D. W., Brown, M. S., and Goldstein, J. L. (1990) Annu Rev Genet24, 133‐170 6. Hobbs, H. H., Brown, M. S., and Goldstein, J. L. (1992) Hum Mutat1, 445‐466 7. Russell, D. W., Lehrman, M. A., Südhof, T. C., Yamamoto, T., Davis, C. G., Hobbs, H. H., Brown, M.
S., and Goldstein, J. L. (1986) Cold Spring Harb Symp Quant Biol51 Pt 2, 811‐819 8. Liu, W., Mani, S., Davis, N., Sarrafzadegan, N., Kavathas, P., and Mani, A. (2008) Circ Res103,
1280‐1288 9. Mani, A., Radhakrishnan, J., Wang, H., Mani, M., Nelson‐Williams, C., Carew, K., Mane, S.,
Najmabadi, H., Wu, D., and Lifton, R. (2007) Science315, 1278‐1282 10. Tomaszewski, M., Charchar, F. J., Barnes, T., Gawron‐Kiszka, M., Sedkowska, A., Podolecka, E.,
Kowalczyk, J., Rathbone, W., Kalarus, Z., Grzeszczak, W., Goodall, A. H., Samani, N. J., and Zukowska‐Szczechowska, E. (2009) Arterioscler Thromb Vasc Biol29, 1316‐1321
11. Tiscornia, G., Singer, O., and Verma, I. M. (2006) Nat Protoc1, 234‐240 12. Basu, S. K., Goldstein, J. L., Anderson, R. G., and Brown, M. S. (1981) Cell24, 493‐502 13. Loeffler, B., Heeren, J., Blaeser, M., Radner, H., Kayser, D., Aydin, B., and Merkel, M. (2007) J
Lipid Res48, 288‐298 14. Yamamoto, H., Komekado, H., and Kikuchi, A. (2006) Dev Cell11, 213‐223 15. Boucrot, E., Saffarian, S., Zhang, R., and Kirchhausen, T. (2010) PLoS One5, e10597 16. Yokomori, H., Oda, M., Yoshimura, K., Nagai, T., Fujimaki, K., Watanabe, S., and Hibi, T. (2009)
Liver Int29, 266‐276 17. Carozzi, A. J., Ikonen, E., Lindsay, M. R., and Parton, R. G. (2000) Traffic1, 326‐341 18. Fernández‐Hernando, C., Yu, J., Suárez, Y., Rahner, C., Dávalos, A., Lasunción, M. A., and Sessa,
W. C. (2009) Cell Metab10, 48‐54 19. Fernández‐Hernando, C., Yu, J., Dávalos, A., Prendergast, J., and Sessa, W. C. (2010) Am J
Pathol177, 998‐1003 20. Garuti, R., Jones, C., Li, W. P., Michaely, P., Herz, J., Gerard, R. D., Cohen, J. C., and Hobbs, H. H.
(2005) J Biol Chem280, 40996‐41004 21. Goldstein, J. L., and Brown, M. S. (1973) Proc Natl Acad Sci U S A70, 2804‐2808 22. Kokubu, C., Heinzmann, U., Kokubu, T., Sakai, N., Kubota, T., Kawai, M., Wahl, M. B., Galceran, J.,
Grosschedl, R., Ozono, K., and Imai, K. (2004) Development131, 5469‐5480 23. Lindvall, C., Zylstra, C. R., Evans, N., West, R. A., Dykema, K., Furge, K. A., and Williams, B. O.
(2009) PLoS One4, e5813 24. Nesterov, A., Kurten, R. C., and Gill, G. N. (1995) J Biol Chem270, 6320‐6327 25. Sorkin, A., Mazzotti, M., Sorkina, T., Scotto, L., and Beguinot, L. (1996) J Biol Chem271, 13377‐
13384 26. Fire, E., Brown, C. M., Roth, M. G., Henis, Y. I., and Petersen, N. O. (1997) J Biol Chem272, 29538‐
29545 27. Vincent, V., Goffin, V., Rozakis‐Adcock, M., Mornon, J. P., and Kelly, P. A. (1997) J Biol Chem272,
7062‐7068
16
by guest on April 11, 2019
http://ww
w.jbc.org/
Dow
nloaded from
28. Zhang, Y., and Allison, J. P. (1997) Proc Natl Acad Sci U S A94, 9273‐9278
17
by guest on April 11, 2019
http://ww
w.jbc.org/
Dow
nloaded from
ManiZhi-jia Ye, Gwang-Woong Go, Rajvir Singh, Wenzhong Liu, Ali Reza Keramati and Arya
LRP6 regulates LDLR-mediated LDL uptake
published online November 28, 2011J. Biol. Chem.
10.1074/jbc.M111.295287Access the most updated version of this article at doi:
Alerts:
When a correction for this article is posted•
When this article is cited•
to choose from all of JBC's e-mail alertsClick here
by guest on April 11, 2019
http://ww
w.jbc.org/
Dow
nloaded from
top related