section h cloning vectors molecular biology course
Post on 14-Dec-2015
238 Views
Preview:
TRANSCRIPT
Section H Cloning Vectors
Molecular Biology Course
vectorsCloning vectors:
to clone a gene in a vectorExpression vectors:
allowing the exogenous DNA to be inserted, stored, and manipulated mainly at DNA levelIntegration vectors:
allowing the exogenous DNA to be inserted, stored, and expressed.
Introduction
Cloning vectors
H1 Plasmid vectersH2 Bacteriophage vectorsH3 Cosmids and YACs H4 Eukaryotic vectors
H1 Design of Plasmid Vectors
H1-1 A plasmid vector for cloning
H1-2 A plasmid vector for gene expression
Cloning vectors
1. autonomously replicating independent of host’s genome.
2. Easily to be isolated from the host cell. (Plasmid preparation)
3. Selective markers: Selection of cells (1) Containing vector: one marker is
enough (2) Containing ligation products:
# twin antibiotic resistance # blue-white screening
4. Contains a multiple cloning site (MCS)
H1-1 A plasmid vector for cloning
H1 Design of Plasmid Vectors
Ampicillin resistant? yes yesTetracycline resistant? No yes
B X B
B
B
XAmpr
ori
Ampr
Tcr
ori
pBR322
Ampr Tcr
ori
Screening by insertional inactivation of a resistance gene
Replica plating: transfer of the colonies from one plate to another using absorbent pad or Velvet ( 绒布 ).
transfer of colonies
+ampicillin + ampicillin+ tetracycline
these colonies have bacteria with recombinant plasmid
H1 Design of Plasmid Vectors
H1 Design of Plasmid Vectors
Blue white screening
Ampr
ori
pUC18(3 kb)
MCS (Multiple cloning sites,多科隆位点)
Lac promoter
lacZ’
Screening by insertional inactivation of the lacZ gene
The insertion of a DNA fragment interrupts the ORF of lacZ’ gene, resulting in non-functional gene product that can not digest its substrate x-gal.
H1 Design of Plasmid Vectors
lacZ encode enzyme b-galactosidase
lacZ’: a shortened derivative of lacZ, encoding N-terminal a-peptide of b-galactosi
dase. Host strain for vectors containing lacZ’:
contains a mutant gene encoding only the C-terminal portion of b-galactosidase which can then complement the a-peptide to produce the active enzyme
IPTG
X-gal (substrate of the enzyme)
lac promoter
Blue product
The expression of active b-galactosidase has to be vector dependent for the selection purpose
H1 Design of Plasmid Vectors
Recreated vector: blue transformantsRecombinant plasmid: containing inserted DNA: white transformants
Recreated vector (no insert)
Recombinant plasmid (contain insert)
H1 Design of Plasmid Vectors
Multiple cloning sitesMultiple restriction sites enable the convenient insertion of target DNA into a vector
Ampr
ori
pUC18(3 kb)
MCS (Multiple cloning sites,多科隆位点)
Lac promoter
lacZ’
…ACGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCA…
. T h rA s n S er S e r Val Pro Gly Asp Pro Leu Glu Ser Thr Cys Arg His Ala Ser…
EcoRI SacI KpnISmaIXmaI BamHI XbaI
SalIHincIIAccI PstI SphI
Lac Z
H1 Design of Plasmid Vectors
H1-2 A plasmid vector for gene expression
Expression vectors: allowing the exogenous DNA to be inserted, stored and expressed.
1.Promoter and terminator for RNA transcription are required.
2.Intact ORF and ribosomal binding sites (RBS) are required for translation.
H1 Design of Plasmid Vectors
• Some cloning vector can be used to transcribe a gene. (pUC vectors)
• Special transcriptional vectors: pGEM series containing promoters from bacteriophages T7 and SP6 for in vitro transcription with the corresponding polymerases.
• Expression vector (transcription & translation).
H1 Design of Plasmid Vectors
Ampr
ori
pUC18(3 kb)
MCS (Multiple cloning sites,多科隆位点)
Lac promoter
lacZ’
1.The ORF of the inserted gene has to be in the same direction as that of the lacZ
2.A fusion protein contains the N-terminal sequence of lacZ and the inserted ORF will be produced
H1 Design of Plasmid Vectors
Expression vector (transcription & translation).
Promoters1. lacUV-5: a mutant lac promoter
which is independent of cAMP receptor protein. (constitutive expression)
2. lPL promoter
3. Phage T7 promoter
Fused proteins
Individual proteins
H1 Design of Plasmid Vectors
T7 promoterRBS
Start codon
MCS
Transcription terminator
Ampr
ori
T7 expression
vector
H1 Design of Plasmid Vectors
Fused proteins
Lac fusions: (discussed)His-tag fusions: A sequence encodes His-tag was inserted at the N- terminus of the target ORF, which allows purification of the fusion protein to be purified by binding to Ni2+ column.
H1 Design of Plasmid Vectors
H2 Bacteriophage vectorTow examples:H2-1 λ phage bacteriophageλ λ replacement vector H2-2 M13 phage M13 phage vector Cloning in M13 Hybrid plasmid-M13 vectors
Cloning vectors
• viruses that can infect bacteria. •48.5 kb in length•Linear or circular genome (cos ends)
λ phage
Lytic phase (Replicate and release)
Lysogenic phase (integrate into host genome)
H2 Bacteriophage vector
DNAProtein coat
cos cosNonessential region
Long (left)arm
short (right)arm
Exogenous DNA(~20-23 kb)
H2-1λ phage
H2 Bacteriophage vector
5‘-CGGGGCGGCGACCTCG-3’
3’-GCCCCGCCGCTGGAGC-5’
Cleavage Ligation(during packaging) (after infection)
GGGCGGGCGACCTCG-3’
5’-CG + GC-5’
3’-GCCCCGCCGCTGGA
The phage λ cos ends
Circular form
Linear form
H2 Bacteriophage vector
λ phage
H2 Bacteriophage vector
λ replacement vector
• Replace the nonessential region of the phage genome with exogenous DNA (~ 20 kb)
• high transformation efficiency (1000-time higher than plasmid)
H2 Bacteriophage vector
λ replacement vector
2. Packing with a mixture of the phage coat proteins and phage DNA-processing enzymes
1. Ligation
3. Infection and formation of plaques
H2 Bacteriophage vector
Plaques: the clear areas within the lawn where lysis and re-infection have prevented the cells from growing.
Recombinant DNA may be purified from phage particles from plaques or from liquid culture.
H2 Bacteriophage vector
Genes or foreign sequences may be incorporated essentially permanently into the genome of E.coli by integration of a vector containing the sequence of interest.
lysogens in cloning techniques
H2 Bacteriophage vector
• A filamentous phage• Phage particles contain a 6.7kb circular single strand of DNA.•After infection of a sensitive E.coli host,the complementary strand is synthesized,and the DNA replicated as a double-stranded circle,the replicative form(RF) with about 100 copies per cell. •Contrasting to phage ,the cell are not lysed by M13,but continue to grow slowly,and single-stranded forms are continuously packaged and released from the cells as new phage particles.
H2-2 M13 phageH2 Bacteriophage vector
M13 phage vectors1. Replication form (RF, dsDNA) of M13 pha
ge can be purified and manipulated like a plamid.
2. Phage particles (ssDNA): DNA can be isolated in a single-stranded form
• DNA sequencing (Topic J2)• Site-directed mutagenesis (Topic J5)
Cloning (RF, like plasmid) transfection (recombinant DNA) growth (plating on a cell lawn) plaques formation (slow growth)
H2 Bacteriophage vector
Blue-white selection
• Small plasmid vectors (pBluescript) being developed to incorporate M13 functionality• Contain both the plasmid and M13 origin of replication• Normally propagate as true plasmids• Can be induced to form single-stranded phage particles by infection of the host cell with a helper phage.
Hybrid plasmid-M13 vectors
H2 Bacteriophage vector
H3 Cosmids and YACs
H3-1 Cloning large DNA fragments ( > 20 kb)
H3-2 Cosmid vectorsH3-3 YAC vectorsH3-4 Selection in S. cerevisiae ( 啤
酒酵母)
Cloning vectors
Analysis of eukaryotic genes and the genome organization of eukaryotes requires vectors with a larger capacity for cloned DNA than plasmids or phage .
Human genome (3 x 109 bp): large genome and large gene demand vectors with a large size capacity.
H3-1 Cloning large DNA fragments
(Eukaryotic Genome project)
H3 Cosmids and YACs
H3-2 Cosmid vectors
1. Utilizing the properties of the phage l cos sites in a plasmid vector.
2. A combination of the plasmid vector and the COS site which allows the target DNA to be inserted into the l head.
3. The insert can be 37-52 kb.
H3 Cosmids and YACs
Digestion
Ligation
C) Packaging and infect
Formation of a cosmid clone
Cloning in a cosmid vector
cosB
SmaI
B BS S
cos cos
cos
B
B
H3 Cosmids and YACs
Essential components of YAC vectors :• Centromers (CEN), telomeres (TEL) and autonomous replicating sequence (ARS) for proliferation in the host cell. • ampr for selective amplification and markers such as TRP1 and URA3 for identifying cells containing the YAC vector in yeast cells. • Recognition sites of restriction enzymes (e.g., EcoRI and BamHI)
H3-3YAC vectorsCan accommodate genomic DNA fragments of more than 1 Mb, and can be used to clone the entire human genome, but not good in mapping and analysis
H3 Cosmids and YACs
Yeast selection
H3 Cosmids and YACs
Cloning in YAC vector
insertion site for red-white selection
SUP4:
CEN4ARSTRP1
TEL B B TEL
SnaB
Digest with BamHI/SnaI
Ligate with blunt ends
Transfect into yeast
H3 Cosmids and YACs
1.Saccharomyces cerevisiae selectable markers do not confer resistance to toxic substances
2.Growth of yeast on selective media lacking specific nutrients can serve for selection. Auxotrophic yeast mutants ( 营养缺欠型 ) are made as host strains for plasmids containing the genes complementary to the growth defect .
For example: TRP1 mutants can’t make tryptophan, and can only grow on media supplemented with tryptophan. The presence of a plasmid containing gene encoding tryptophane enables the cell to grow on media without tryptophan.
H3-4 Selection in S.cerevisiae
H3 Cosmids and YACs
H4 Eukaryotic Vectors
• Transfection of eukarotic cells• Shuttle vectorsH4-1 Yeast episomal plasmids (Yeasts)H4-2 Agrobacterium tumefaciens ( 农杆菌 )
Ti plasmid (Plants)H4-3 Baculovirus (Insects)H4-4 Mammalian viral vectors (Mammalia
n)
Cloning vectors
The take-up of DNA into eukaryotic cells
Transfection:
1. more problematic than bacterial transformation
2. Much lower efficiency in the progress
3. Transfection methods• Electroporation• Microinjection• liposome
H4 Eukaryotic Vectors
Shuttle vectors
Vectors contain sequences required for replication and selection in both E. coli and the desired host cells, so that the construction and many other manipulation of the recombinant plasmids can be completed in E. coli.
Most of the eukaryotic vectors are constructed as shuttle vectors
H4 Eukaryotic Vectors
MCS
A Shuttle vectorH4 Eukaryotic Vectors
H4-1 Yeast episomal plasmids (YEps)
Vectors for the cloning and expression of genes in Saccharomyces cerevisiae.1. Based on 2 micron (2m) plasmid
which is 6 kb in length.• One origin • Two genes involved in replication• A site-specific recombination protein
FLP, homologous to l Int.2. Normally replicate as plasmids, and
may integrate into the yeast genome.
H4 Eukaryotic Vectors
Insert Figure 1
MCS
A YEp vectorH4 Eukaryotic Vectors
Replicate as plasmid from 2m origin
integrate by recombinantion
YEp vector
H4 Eukaryotic Vectors
H4-2 Agrobacterium tumefaciens Ti plasmid
Ti plasmid 200kb
T-DNA
plant chromosome
Integrated T-DNA
Gene induce crown gall
H4 Eukaryotic Vectors
crown gall or tumor
H4 Eukaryotic Vectors
Recombinant Ti plasmid
1. Place the target gene in the T-DNA region of a Ti plasmid, then transform the recombinant Ti plasmid. (WT is not good because of the crown gall formation)
2. Recombinant T-DNA transformed into the A. tumefaciens cell carrying a modified Ti plasmid without T-DNA (T-DNA that are responsible for crown gall formation. The deleted T-DNA is called disarmed T-DNA shuttle vector).
H4 Eukaryotic Vectors
Plant gene engineering using T-DNA vector
H4 Eukaryotic Vectors
H4-3 Baculovirus
1. Infects insect cells2. The strong promoter expressing polyhe
drin protein can be used to over-express foreign genes engineered. Thus, large quantities of proteins can be produced in infected insect cells.
3. Insect expression system is an important eukaryotic expression system.
H4 Eukaryotic Vectors
H4-4 Mammalian viral vectors
1. SV40: 5.2 kb, can pack DNA fragment similar to phage l.
2. Retroviruss: • single-stranded RNA genome, which co
py to dsDNA after infection.• Have some strong promoters for gene e
xpression• Gene therapy
H4 Eukaryotic Vectors
Gene transfer
Genes may be transiently or permanently introduced into cultured eukaryotic cells without the use of vector in strict sense.
• Transient expression• Integration
H4 Eukaryotic Vectors
top related