selective dna extraction with microparticles in segmented … · 2017-08-29 · selective dna...
Post on 29-Jun-2018
213 Views
Preview:
TRANSCRIPT
RESEARCH PAPER
Selective DNA extraction with microparticles in segmented flow
Bert Verbruggen • Karen Leirs • Robert Puers •
Jeroen Lammertyn
Received: 20 February 2014 / Accepted: 26 May 2014 / Published online: 8 June 2014
� Springer-Verlag Berlin Heidelberg 2014
Abstract Droplet-based segmented flow microfluidic
systems have proven their potential for high throughput
detection and quantification of analytes. However, the
required sample preparations are often performed off-chip,
as on-chip methods are lacking. Microparticles are espe-
cially suited for the extraction and purification of target
molecules from a sample and are successfully used in other
microfluidic systems and in laboratory-scale methods. The
current magnetic separation methods in segmented flow
microfluidics are limited in their function to purify, as only
a limited part of the original droplet volume can be
removed from the particles. In this paper, we report the
implementation of a selective DNA extraction assay with
microparticles in a segmented flow microfluidic system.
The combination of magnetic separation with asymmetric
droplet splitting allows the removal of 90 % or even 95 %
of the original sample volume in a single separation step. It
is shown that the hybridization and capture efficiency of
the particles are identical for off-chip and on-chip methods.
Next, the effect of the particle separation efficiency on the
extraction efficiency is tested for different splitting
regimes. When up to 90 % of the droplet volume is
removed, nearly all particles are correctly separated and the
non-separated particle fraction remains below 5 %. Only if
95 % of the original volume is removed, the unseparated
fraction becomes significant ([10 %). Finally, the impact
of separation at a higher splitting ratio for the repeated
washing of the particles is discussed. With this novel sys-
tem, more complex and relevant bioassays can be imple-
mented completely in a droplet-based segmented flow
context.
Keywords Magnetic microparticles � DNA extraction �Droplet-based segmented flow � Segmented flow
microfluidics � On-chip magnetic separation
1 Introduction
Since the first reports of laboratory-on-a-chip technologies
and micro total analysis systems, more than 20 years ago,
the field has grown strongly and diversified into different
categories (Whitesides 2006). Transferring bioassays from
the laboratory to the microfluidic scale has plenty of
advantages, most notably the reduced sample and reaction
volumes and a shorter diffusion time (Huebner et al. 2008).
In segmented flow or droplet microfluidics, the reaction
volumes are separated by an immiscible fluid forming
discrete droplets or plugs and thus preventing cross-con-
tamination. This method combines the general microfluidic
advantages with a forced internal mixing and the ability to
generate droplets at rates between 1 Hz and 100 kHz. This
allows the high throughput screening of multiple samples
sequentially or a single sample in varying dilutions, by
gradually changing the sample flow rate. Many discrete
repetitions allow for statistical information at an unseen
short timescale (Song and Ismagilov 2003). The high
throughput and small volumes also make segmented flow
especially suited for digital assays, where readout is not
based on the signal intensity itself, but on the number of
droplets that generate a signal. An excellent example is the
B. Verbruggen � K. Leirs � J. Lammertyn (&)
MeBioS - Biosensor Group, Department of Biosystems,
KU Leuven - University of Leuven, Willem de Croylaan 42,
3001 Louvain, Belgium
e-mail: jeroen.lammertyn@biw.kuleuven.be
R. Puers
Department of ESAT - MICAS, KU Leuven - University
of Leuven, Kasteelpark Arenberg 10, 3001 Louvain, Belgium
123
Microfluid Nanofluid (2015) 18:293–303
DOI 10.1007/s10404-014-1433-8
digital qPCR (Beer et al. 2007), already commercially
available for Raindance Technologies (USA). All these
characteristics make segmented flow microfluidics a
promising microfluidic subcategory with the potential to
change the way analytical laboratories work (Whitesides
2011).
An indispensable part of most detection or quantification
methods is the sample preparation, and more specifically,
the target molecule extraction and purification. In case of
DNA-based assays, the DNA is captured on a solid support
through hybridization in order to remove the sample matrix
(Berensmeier 2006). Microparticles are popular as solid
support due to a high surface-to-volume ratio, which allows
the concentration of a large number of capture probes in a
small volume. Often superparamagnetic microparticles are
used, adding the potential of noninvasive magnetic sepa-
ration. With the general trend toward microfluidic systems,
the microparticles are also used in microfluidic environ-
ments. Indeed, solid-phase DNA hybridization on micro-
particles was first reported more than 20 years ago (Fan
et al. 1999). Many applications of magnetic microparticles
in microfluidic chip and the manipulations of the micro-
particles have been reported, and the topic has been well
reviewed (Gijs et al. 2010; Gijs 2004; Pamme 2006, 2012;
Verpoorte 2003).
Over the years, many authors have contributed to the
toolbox of basic droplet operations: Droplet formation by
flow-focusing or T-junction (Anna et al. 2003; Thorsen
et al. 2001), sample mixing and incubation (Song et al.
2003), sorting (Baroud et al. 2006; Tang et al. 2009),
retention (Huebner et al. 2009), splitting (Link et al. 2004)
and merging of droplets (Christopher et al. 2009; Niu et al.
2008). We previously reported on a novel droplet splitting
system to dynamically control the droplet splitting ratio
with an additional oil flow. Reliable droplet splitting could
be achieved for splitting ratios ranging from 1:1 up to 1:20
(Verbruggen et al. 2013).
The magnetic manipulation of microparticles has been
combined with segmented flow microfluidics, as the mi-
croparticles are separated from the droplet to extract cap-
tured targets from the sample matrix (Lee et al. 2012;
Lombardi and Dittrich 2011; Pan et al. 2011). However, the
current methods of particle separation in segmented flow
remain insufficient, as only half of the original droplet
volume is removed. The other half remains with the sep-
arated microparticles, thus failing to meet the purification
requirements of many bioassays. Improved systems are
clearly needed to bridge the gap with magnetic separation
on macroscale and on continuous microfluidic systems
(Lacharme et al. 2009) and EWOD-based digital micro-
fluidic platforms (Sista et al. 2008).
Recently, we reported on the development of a novel
microfluidic and magnetic setup to separate
superparamagnetic microparticles from sample droplets
(Verbruggen et al. 2014). First, the conditions for particle
aggregation, attraction and immobilization were determined
and used to predict good separation conditions. Second, the
magnetic forces at the splitting T-junction were simulated
for different magnet orientations and positions. Next, the
most promising setups were tested and compared. Finally,
we were able to remove 90–95 % of the volume with a
single particle separation step, which is a significant
improvement compared to previously reported systems.
However, the DNA extraction efficiency of the micro-
fluidic system goes beyond the efficiency of the particle
separation and is a combination of the capture efficiency of
the microparticles and the separation efficiency of the
microfluidic setup. Furthermore, the practical implemen-
tation of selective DNA extraction in the droplet-based
segmented flow system is more than the miniaturization of
macroscale protocols. In this work, we report for the first
time the practical implementation of microparticle-based
selective DNA extraction in a segmented flow microfluidic
chip. First, the capture efficiency and underlying DNA
hybridization reaction are experimentally determined,
using both off-chip and on-chip methods. Next, the
extraction efficiency at different splitting regimes is stud-
ied. Finally, the impact of the improved splitting system for
the repeated washing of the particles is discussed. An
overview of the DNA extraction assay is given in Fig. 1.
2 Experimental
2.1 Reagents and buffer solutions
109 SSC buffer solution (1.5 M NaCl, 1.50 9 10-1 M
Trisodiumcitrate, pH 7.0) and 29 Tris–HCl buffer solution
(1.0 9 10-2 M Tris–HCl, 1.0 9 10-3 M EDTA, 2.0 M
NaCl, pH 7.5) were prepared from analytical grade
reagents (Sigma-Aldrich, Bornem, Belgium) using auto-
claved and deionized water. All DNA was custom syn-
thesized and purified by Integrated DNA Technologies
(Haasrode, Belgium). The various sequences used in this
work are listed in Table 1.
M-280 superparamagnetic microparticles with a strep-
tavidin coating were purchased from Dynal Biotech
(Invitrogen, Carlsbad, USA). All experiments were per-
formed in DNA Lobind tubes (Eppendorf, Hamburg, Ger-
many) to minimize sticking of DNA.
HFE-7500 fluorocarbon oil was obtained from 3 M
(Zwijndrecht, Belgium) and contained 1 % (w/w) of a
custom-made polytetrafluoroethylene–polyethyleneglycol
block–copolymer surfactant (PFPE–PEG–PFPE) kindly
provided by the Weitz lab at Harvard University, USA
(Holtze et al. 2008). It had a viscosity of 1.24 9 10-3 Pa s,
294 Microfluid Nanofluid (2015) 18:293–303
123
a density of 1,614 kg m-3 and the surface tension between
the oil and pure water was 3.5 9 10-3 N m-1.
2.2 Fabrication of the microfluidic system
The poly-dimethylsiloxane (PDMS) chip was fabricated
using the softlithographic methods described by Duffy et al.
(1998). Summarized, a layer of SU-8 epoxy resin (Micro-
chem, USA) was spin-coated on a 3-in. wafer, baked and
exposed to UV-light through a photomask with the design.
After developing the SU-8, a 3D negative mold of the
microfluidic system was obtained. To improve PDMS liftoff,
a thin PTFE layer (DuPont, USA) was spin-coated over the
mold. Next, a 0.5-mm Sylgard 184 PDMS (Dow Corning,
USA) layer was spin-coated on the mold and baked. Using
plasma oxidation a thicker slab of PDMS was sealed locally
above the tube connections to prevent leakage, without
covering the rest of the chip. Finally, the complete chip was
sealed to a glass wafer, closing the channels.
2.3 Design of the microfluidic system
The microfluidic design used in this work was based on the
system developed in Verbruggen et al. (2013) and is
schematically represented in Fig. 2. All channels were
60 lm high, and the width of the main channel was
200 lm, while the particle and sample inlets were 100 lm
Fig. 1 Overview of the DNA extraction assay. Top Immobilization
of capture probes: The superparamagnetic microparticles coated with
streptavidin are mixed with an excess of biotinylated capture probes
and incubated for 20 min allowing the immobilization of the probes.
Then, the microparticles are magnetically separated from the unbound
probes. Bottom left On-chip extraction: The microparticles and a
sample containing ssDNA targets are injected into one droplet. While
the droplet is transported through the channel for 1 min, the
microparticles and targets are mixed and hybridize spontaneously.
At the T-junction, the microparticles are magnetically separated from
the droplet, extracting the target DNA from the sample. Part of the
original droplet volume remains with the particles. Bottom right Off-
chip extraction: The microparticles and target are mixed in a tube,
incubated for 1 min and the particles a magnetically extracted
Table 1 Used DNA sequences
Short biotinylated
probe
Bt-50TTCGCACACACGGACTTACG30
Short fluorescent
and biotinylated
probe
Bt-50TTCGCACACACGGACTTACG
30-6FAM
Long free strand 50TCGCACATTCCGCTTCTACCGGGGCAC
GTTTATCCGTCCCTCCTAGTGGCGTGC
CCCTTACGTAAGTCCGTGTGTGCGAA30
Forward primer
qPCR
50TCGCACATTCCGCTTCTACC30
Reverse primer
qPCR
50TTCGCACACACGGACTTACG30
Microfluid Nanofluid (2015) 18:293–303 295
123
wide. Two aqueous solutions were jointly injected into the
oil flow (1), forming a single droplet and mixed rapidly due
to the internal circulating flow profile. After 5.5 cm in the
channel, corresponding to 60 s of incubation, the main
channel narrowed down to 50 lm at the splitting zone (2),
elongating the droplets and thus limiting the variation on
the splitting ratio. Behind the splitting T-junction, the two
channels broadened back to 100 lm and were reconnected
to equalize the pressure and avoid oscillating splitting
ratios (3). A line of pillars (50 lm) prevented the droplets
from changing channel. In the lower branch of the split, an
additional channel (50 lm) was used to regulate the split-
ting ratio (4). Control of the oil flow rate through this oil
inlet also permitted control of the total flow rate and
pressure in branch B. This in turn allowed steering of the
flow rates at the split (2) and thus the asymmetric droplet
splitting (Verbruggen et al. 2013).
An external magnet was placed on top of the thin PDMS
layer, 0.5 mm above the extra oil channel, at 1 mm dis-
tance from the main channels and the loop, to collect the
magnetic particles in the small daughter droplet. Without
the controlling oil flow, the droplets split equally, as is the
case in any regular T-junction droplet splitting. With the
additional oil flow, the droplets split asymmetrically, with
the smallest daughter droplet going to outlet 1 and the
largest droplet going to outlet 2.
2.4 Setup of the microfluidic system
The inlets of the microfluidic chip were connected to glass
syringes (Hamilton, Switzerland) by FEB tubes (IDEX,
Germany), while PHD 2000 syringe pumps (Harvard
Apparatus, USA) were used to precisely control the flow rate
in the channels. A 5-mm NdFeB cubic permanent magnet
(Supermagnete, Germany) was used to separate the magnetic
particles. During the hybridization experiments, the system
was installed on a temperature controlled hotplate.
2.5 Capture probe immobilization on magnetic
particles
For the capture probe immobilization, biotinylated
ssDNA stands and streptavidin-coated microparticles
were used, following the manufacturer’s protocol. In a
reaction, volume of 1 mL Tris–HCl buffer 1 mg of
particles was incubated with the biotinylated probes at
room temperature for 20 min. To remove any unbound
probes, the particles were washed three times in 1 mL of
the Tris–HCl buffer. Unless otherwise mentioned, an
excess of 10-6 M probes was used to saturate 1 mg of
particles. Particles of multiple batches were mixed to
remove any batch effect.
The number of capture probes in an experiment was
varied by varying the number of microparticles, while
keeping the surface density of probes constant at saturation.
To facilitate the calculation of efficiencies and Kd of the
hybridization reactions, the concentrations were always
expressed in M, as opposed to surface densities, absolute
number of probes or average probes per particle.
2.6 Target capture efficiency of the functionalized
microparticles
First, the microparticles with immobilized probes were
diluted to 0.5, 0.1 or 0.02 mg/mL and magnetically sep-
arated from the Tris–HCl buffer solution in about 30 s.
Next, the particles were washed three times in the 109
SSC hybridization buffer to remove any trace of the
Fig. 2 Schematic overview of the microfluidic design. 1 Sample
solutions and particle suspensions are jointly injected into the oil flow,
forming droplets. 2 At the T-junction, the channel is narrowed to
improve the split. 3 The loop and pillar system is used to equalize
pressure in both branches of the split, removing oscillating variability
during the split. 4 A second oil flow is used to control the droplet
splitting ratio. The magnet is placed on top of this channel, to attract
the magnetic microparticles into the lower branch of the split. This
results in the collection of the particles in the smaller daughter droplet
296 Microfluid Nanofluid (2015) 18:293–303
123
immobilization buffer. The target ssDNA was diluted in
the hybridization buffer and heated to 94 �C for 2 min.
Next, the target ssDNA was added to the particles and
temperature was reduced to 53�. Keeping the temperature
constant, the suspended particles were incubated for
1 min, allowing hybridization. Subsequently, the super-
natant was removed and the particles were washed three
times with the SSC buffer. All fractions and washing
volumes were collected for analysis.
The reference method, off-chip, used a volume of
100 lL in LoBind Eppendorfs, to minimize DNA sticking.
After adding the target ssDNA to the microparticles, the
mixture was stirred with a vortex for 5 s and placed in a
heating block at 53 �C. For the on-chip extraction exper-
iments, the microparticle suspension and target DNA
solution were pumped into the dual sample inlet and
injected in the oil flow together, forming a droplet. On
average, 150, 30 or 6 microparticles were encapsulated
per droplet, using the 0.5, 0.1 or 0.02 mg/mL dilutions,
respectively. Inside the droplets, the particles and target
strands were mixed rapidly. Incubation happened during
the 1-min transport to the splitting zone. After the split,
droplets were collected at both outlets for 3 min, corre-
sponding to about 180 droplets. The droplets were col-
lected in 100 lL water and shaken to break the droplets.
The water and perfluoroil were separated by gravity within
1 min, and the magnetic particles were magnetically
separated. Both the hybridized targets on the microparti-
cles and the free target in the aqueous fraction were
analyzed with qPCR and this for both outlets.
2.7 Microparticle separation efficiency
of the microfluidic system
The efficiency of the magnetic separation of particles
during the droplet splitting was determined with com-
pletely saturated and washed particles. First, 0.1 mg/mL
magnetic particles—corresponding to 30 particles per
droplet and 1.6 9 10-8 M immobilized capture probes—
were incubated with 1.6 9 10-7 M target probes, in
100 lL 109 SSC buffer, completely saturating the capture
probes. Next, the particles were washed three times in 109
SSC buffer to remove all unbound target strands. This
particle suspension was then used in the microfluidic
magnetic separation system and separated at various
splitting regimes. The particles were collected at both
outlets for 3 min and analyzed as described above. The
ratio of captured target concentrations in each outlet was
used to calculate the microparticle separation efficiency of
the splitting regime. Denaturation of the hybridized target
during transport in the microfluidic system was not an issue
as the free target concentrations in the droplets remained
below the detection limit of the qPCR.
2.8 Quantification of DNA
As the capture probes immobilized on the surface of the
microparticles cannot be directly quantified using qPCR,
fluorescent capture probes (Table 1) were used for a satu-
ration experiment. Every probe concentration was analyzed
three times with a SpectraMax spectrophotometer (molec-
ular Devices, USA) and this for both the immobilized and
the unbound capture probes.
Target concentrations were analyzed using qPCR on a
Rotorgene Q HRM (Qiagen, Belgium) using the protocol
described by Janssen et al. (2012). Two microliter of
sample was mixed with 15 lL of PerfeCTa SYBR green
fast mix (Quanta, USA), 9 lL of water and 2 lL of each
primer (5 lM) to a total of 30 lL. Following manufac-
turer’s recommendations, the polymerase was activated at
95 �C for 2 min. Subsequently, the thermal cycling started
with annealing and extension at 60 �C for 30 s and dena-
turing at 95 �C for 5 s. This cycle was repeated 50 times.
To quantify captured targets, hybridized to the capture
probes, the microparticles were resuspended in 100 lL
deionized water and heated to 95 �C to cause dehybridization,
releasing the target DNA strand. The experiments were
repeated three times to cover variability. All samples and
standards solutions were analyzed twice and averaged. Blank
samples were used as a no template control (NTC) to deter-
mine the cycle number where false positive results occur, as
eventually the primers will create product on themselves.
2.9 Kd of the hybridization reaction
The Kd of the hybridization reaction of two complementary
DNA strands in free solution can be estimated using the
nearest neighbor method (SantaLucia 1998). In short, the
order of nucleotides, the number of matches and the total
length of the overlap between the strands will determine
the overall binding strength of the double strand. For the
sequences used in this work, the estimated Kd in function of
the temperature is presented in Fig. 3. The theoretical
melting temperature in free solution, where half the strands
are hybridized, is at 69 �C.
This theoretical estimation assumes free diffusion of
both strands in a standard buffer solution. The actual Kd
can be several orders of magnitude higher when immo-
bilized strands are used, highly depending on the packing
density of the immobilized ssDNA (Erickson et al.
2003). However, the temperature dependency is expected
to be similar for experimentally determined Kd values. In
this work, the term of apparent Kd is used and the Kd
determination was not performed in ideal conditions. The
experimental apparent Kd was fitted using MATLAB
(Mathworks, USA) surface fitting tool at standard
settings.
Microfluid Nanofluid (2015) 18:293–303 297
123
3 Results and discussion
3.1 Immobilization of the capture probes
According to the manufacturer’s specifications, 1 mg of
streptavidin-coated microparticles can bind up to 200 pmol
of biotin-coupled short oligonucleotides. This value is seen
as an upper boundary, and actual values vary between
batches and depend on the nucleotide sequence and buffer
conditions. However, knowing the exact number of the
immobilized capture probes is necessary to interpret the
results of hybridization experiments. A saturation experi-
ment was used to determine the binding capacity of the
particles and the concentration of capture probes needed to
achieve maximum immobilization. Figure 4 shows the
results of the saturation experiment. The binding was linear
up to 1.2 9 10-7 M and needed an initial capture probe
concentration of at least 5 9 10-7 M to reach saturation at
1.6 9 10-7 M immobilized probes.
To avoid variation on the number of immobilized
probes, an excess of 10-6 M is used to saturate the mi-
croparticles completely. Also, multiple batches of the mi-
croparticles with immobilized capture probes were mixed
and all experiments were done with the same stock solu-
tion. Storage was not a problem, as the streptavidin–biotin
bond is known to be very stable (DeChancie and Houk
2007) and no dissociation was observed over time.
3.2 qPCR standard curve
To quantify the target concentration in the various fractions
of the extraction experiments, a logarithmic calibration
curve was built for every experiment, using 5 9 10-8 M,
5 9 10-10 M, 5 9 10-12 M, 5 9 10-14 M and
5 9 10-16 M (Fig. 5). A fluorescent threshold value to
determine the threshold cycle numbers (CT) was automat-
ically selected by the software for an optimal R2 of the
calibration curve, which was always above 0.997 in this
work. The slope (M) of -3.333 in the calibration curve
(Fig. 5) corresponds to a multiplication factor of 1.995 per
round or an efficiency of 99.5 %. The efficiency was
always between 97 and 101 %, with 100 % being the
theoretical ideal system with a DNA multiplication factor
of 2 per round.
The earliest NTC crosses the threshold value at 36
cycles or later, corresponding to about 2 9 10-17 M and
thus concentrations around this value cannot be quantified.
Therefore, all samples with a concentration below
5 9 10-16 M (the fifth point of the standard curve) were
considered blank and were not used in any conclusion or
result. Concentrations above the upper limit of linear range
(5 9 10-8 M) were diluted and analyzed again.
3.3 Temperature and hybridization rate
The high salt concentration of the 109 SSC hybridization
buffer ensures good hybridization conditions. To avoid
changing the surface tension and other fluid properties of
Fig. 3 Calculated theoretical Kd for free hybridization of the used
sequences as a function of the temperature. The order of magnitude of
this value is marked in red for 25, 37, 53, 63 and 95 �C, temperatures
used in the experiments
Fig. 4 Immobilized probes on 1 mg/mL particles, in function of the
initial probe concentration. The curve depicts the fitted binding model
and puts the saturation at 1.6 9 10-7 M (red dotted line). Each point
was measured three times, with error bars representing one standard
deviation
Fig. 5 Left Typical standard curves for qPCR analyses plotting
normalized fluorescence intensity versus the thermal cycle number:
a = 5 9 10-8 M, b = 5 9 10-10 M, c = 5 9 10-12 M,
d = 5 9 10-14 M, e = 5 9 10-16 M, f = 0 M (NTC). Right The
calibration curve plotting the cycle number at threshold value (CT)
versus the log DNA concentration. The dotted part of the line
indicates the NTC value and was not used for quantification
298 Microfluid Nanofluid (2015) 18:293–303
123
the microfluidic system, no additional surfactants or addi-
tives, such as Tween or BSA, were added to the hybrid-
ization buffer. Settling or sticking of the microparticles was
not observed inside the droplets.
As the typical residence time in the microfluidic system
ranges from several seconds up to 1 or 2 min, hybridization
should reach equilibrium within this short time. The effect
of temperature on the hybridization speed and capture
efficiency was examined in an off-chip setup, at four
temperatures, corresponding to room temperature (25 �C),
physiological temperature (37 �C), the optimal PCR tem-
perature (53 �C) and a higher temperature (63 �C). Fig-
ure 6 shows the target capture efficiency of the magnetic
microparticles at the different temperatures after 1, 2 and
3 min, as longer reaction times proved unnecessary.
Attempts to analyze reaction times below 1 min proved
very unreliable, and they were therefore not used. The off-
chip separation of microparticles from the matrix solution
takes up to 30 s and the hybridization reaction obviously
continues during this time, probably causing the variability
of short reaction times.
1.6 9 10-8 M of both immobilized capture probes and
free target were used in 100 lL hybridization buffer. At 25
and 37 �C, hybridization reached equilibrium within
3 min, while at higher temperatures, it was already reached
within 1 min. Only around 40 % of the DNA strands are in
the hybridized state at 63 �C, and thus, this is close to
melting temperature of these DNA strands. This data cor-
responds well with literature and the solid-phase hybrid-
ization model of Erickson et al. (2003).
The effect of temperature on hybridization speed and
efficiency was clearly a trade-off between the reaction
speed and the capture efficiency. At 53 �C, equilibrium
was reached within 1 min and the capture efficiency was
still above 94 %, meaning 94 % of the target ssDNA was
captured within a minute with an equal target and probe
concentration of 1.6 9 10-8 M. This temperature was used
for all following solid-state hybridization experiments.
3.4 On-chip hybridization
The first parameter studied to compare off-chip and on-
chip extraction methods was the apparent Kd of the
hybridization reaction. The on-chip experiments were
performed both in a 60/40 and in a 90/10 splitting regime.
Three concentrations of targets were incubated with three
concentrations of capture probes to obtain nine different
measuring points (Table 2). Each individual experiment
was repeated three times to reveal variation in the capture
efficiency. Next, the particles with the captured target were
extracted and both captured and unbound targets were
separately quantified with qPCR. All data points combined
allowed the reliable fitting of the hybridization Kd, using
the least squares method. Figure 7 represents the capture
efficiency for the different combinations of capture probe
and target concentrations and the fitted Kd for each method.
Some of the initial target ssDNA was not accounted for
after all steps (10 ± 4 %), assumed lost due to sticking to
tubes and pipets. This number was identical in both off-
chip and on-chip experiments. As these strands did not
participate in the equilibrium, experimental results were
adjusted for this loss.
The overall fitted apparent Kd of the hybridization
reaction was about 3 9 10-10 M in the off-chip experi-
ments and 8 9 10-10 and 6 9 10-10 M in the 60/40 and
90/10 on-chip splitting regimes, respectively. As the dif-
ference was very small and no statistically significant dis-
tinction could be made, the switch toward the microfluidic
environment was considered successful. Potential inhibi-
tors such as the perfluor surfactants or the oil–water
interface appeared to have no measurable effect on the
hybridization reaction.
The apparent Kd of both off-chip and on-chip experi-
ment was two orders of magnitude higher than the theo-
retically calculated value for free hybridization at 53 �C
(10-12 M). This difference was expected as the conditions
for the experimental and theoretical Kd were different: the
diffusion speed of immobilized capture probes is lower
than that of free capture probes. The hybridization also
depends on the packing density of the probes (Erickson
Fig. 6 Solid-phase hybridization at 25, 37, 53 and 63 �C. Both the
initial capture probe and the target ssDNA concentration were
1.6 9 10-8 M. At 53 �C (red) and 63 �C, equilibrium is reached
within 1 min, the lower temperatures equilibrate between 2 and
3 min. Error bars show one standard deviation of three repetitions
Table 2 Ratio of capture probes over targets
Target concentration (M) Capture probe concentration (M)
8.0 9 10-8 1.6 9 10-8 3.2 9 10-9
1.6 9 10-8 5 1 0.2
3.2 9 10-9 25 5 1
6.4 9 10-10 125 25 5
Microfluid Nanofluid (2015) 18:293–303 299
123
et al. 2003), as the alignment between target and probe can
be spatially hindered.
3.5 Capture efficiency and saturation
The Kd is the best constant to compare the intrinsic reaction
properties of the hybridization reaction in off-chip and on-
chip conditions. However, in order to capture a maximum
of target strands, a low Kd is necessary, but not sufficient.
The capture efficiency also depends on the concentration of
target molecules and capture probes. The capture efficiency
and the saturation of the probes are shown in Fig. 8.
First and most importantly, the difference between off-
chip and on-chip methods for any of the used combinations
is smaller than the variation between repetitions and is thus
insignificant. The capture efficiency is thus independent of
the used separation system and even independent of the
splitting regime. While this is not unexpected, it is
important for all future applications of DNA extraction in
this segmented flow system. Secondly, Fig. 8 also illus-
trates that the capture efficiency is obviously dependents on
the concentration of capture probes and target DNA. It is
clear that for good capture efficiencies, the saturation of the
capture probes has to remain low (Fig. 9). A fivefold
excess of capture probes appears sufficient to bind nearly
all targets, but even equal concentrations of probe ssDNA
and target ssDNA lead to about 80 % hybridization. A
moderate excess thus appears sufficient when the target
extraction is used to purify a concentrated sample. How-
ever, to quantify an unknown target concentration, satura-
tion might be harder to avoid. This can be avoided in a
segmented flow framework, as the ratio of sample and
particle suspensions can be gradually changed and a whole
range of target and capture probe concentrations can be
combined in one run.
3.6 Microparticle separation and total DNA extraction
efficiency
The separation efficiency of the off-chip method approa-
ched 100 %, as practically all particles could be retained.
In the on-chip methods, however, part of the particles was
not separated to the correct daughter droplet during the
split. For all three particle concentrations, working at
splitting regimes between 50/50 and 90/10, the separation
efficiency was very good, respectively, 98 and 96 %.
Increasing the split ratio to 95/5 resulted in a separation
efficiency of 83 %. As the extraction efficiency of target
DNA from the sample is determined by the target capture
efficiency and the microparticle separation efficiency, the
total DNA extraction efficiency of the 95/5 splitting regime
was thus lower as well. Figure 10 illustrates this for
1.6 9 10-8 M capture probes and 3.2 9 10-9 M target, a
condition with a capture efficiency of 97 %. Increasing the
Fig. 7 Hybridization results for
the off-chip method and the on-
chip method at two splitting
regimes: 60/40 and 90/10.
Hybridized targets are plotted
over the total quantified targets
for three different probe
concentrations. The markers
express the adjusted
experimental values, while the
dotted lines show the values
calculated with the overall fitted
apparent Kd
300 Microfluid Nanofluid (2015) 18:293–303
123
Fig. 8 Capture efficiency for
the off-chip method and the on-
chip method at two splitting
regimes: 60/40 and 90/10. Each
of the nine combinations was
repeated three times, and the
error bars show one standard
deviation
Fig. 9 Saturation of the probes
for the off-chip method and the
on-chip method at two splitting
regimes: 60/40 and 90/10. Each
of the nine combinations was
repeated three times, and the
error bars show one standard
deviation
Microfluid Nanofluid (2015) 18:293–303 301
123
splitting ratio further was not possible in this system, as
some droplets ceased to split (Verbruggen et al. 2013).
In absolute numbers, the 60/40 and 90/10 regimes
extracted equal numbers of targets. Yet, the purpose of the
increasingly asymmetric splitting during the particles sep-
aration was obviously the removal of more of the original
sample matrix. Using the 60/40 splitting regime, the target
was concentrated 245 % (98 % of targets in 40 % of the
volume) and the 90/10 regime concentrated 950 %. Even
with a significantly lower extraction efficiency, the 95/5
splitting regime concentrated most at 1,577 %.
However, for some future applications, this might not be
sufficient as high purification of the extracted target is needed.
Coupling multiple splitting systems sequentially to wash the
particles in order to improve the purification has already been
reported for a fixed splitting regime of about 60/40 (Pan et al.
2011) and could be applied for this separation system as well.
Actually, this is similar to off-chip methods, consisting of one
extraction step followed by several washing steps. Each
additional splitter requires one additional water inlet to wash
the particles, one additional oil flow to control the splitting
regime and one additional outlet to remove the waste. This
could rapidly become unstable in practice.
If, for example, 99 % of the original matrix needs to be
removed, the 60/40 splitting regime would need to be
repeated five times, while the 90/10 regime can reach this
in two repetitions. The 95/5 splitting regime would do even
better, but as the particle separation efficiency is low, this
might not add value compared to the 90/10 regime. The
cumulative extraction efficiency, the fraction of extracted
DNA after repeated separation, decreases considerably
(Fig. 11). Coupling three 95/5 splits would remove
99.99 % of the matrix, but only extract about half of the
target DNA. Reducing the splitting ratio to 90/10 would
still remove 99.9 % of the matrix solution while extracting
86 % of the target.
4 Conclusions
In this paper, we investigated the transfer of a solid-state
DNA hybridization assay on microparticles from a typical
laboratory-scale volume to a segmented flow microfluidic
system. A temperature of 53 �C was chosen to achieve
hybridization equilibrium within 1 min, an acceptable
residence time inside the microfluidic system. Nine com-
binations of capture probe and target concentrations were
mixed and incubated using both the off-chip and on-chip
method. The capture efficiencies and the apparent Kd very
closely matched, and there was no significant difference
between off-chip and on-chip strategies. Using the
hybridization assay in the segmented flow setup resulted in
very similar loss of target strands (10 ± 4 %) compared to
the reference method, confirming the good selection of oil,
surfactants and surface coating.
The capture efficiency of the magnetic particles was equal
at different splitting regimes, but the separation of the par-
ticles did change. Splitting the droplets at ratios between
60/40 and 90/10 resulted in high particle separation effi-
ciencies of 97 %. Increasing the ratio to 95/5 resulted in a
higher particle loss and a separation efficiency of 83 %. The
best method obviously depends on the application, as a trade-
off exists between maximal extraction and maximal matrix
Fig. 10 Capture, separation and extraction efficiency at three differ-
ent splitting regimes, using 0.1 mg/mL microparticles. The capture
probe and target concentration are 1.6 9 10-8 and 3.2 9 10-9 M,
respectively. Error bars show the standard deviation of three
repetitions. The red line illustrates the splitting ratio, marking the
volume percentage of the small daughter droplet that contains the
separated microparticles
Fig. 11 Sequential splitting
with 60/40, 90/10 and 95/5
splitting regimes. Left the
remaining percentage of the
original sample matrix. Right
the cumulative extraction
efficiency. The extraction
efficiency of the 95/5 splitting
regime is practically too low to
couple sequentially
302 Microfluid Nanofluid (2015) 18:293–303
123
removal. This effect becomes more pronounced when
sequentially coupled separation systems are considered.
Using a low splitting ratio to wash the particles is impractical
as the number of separations and thus additional inlets and
outlet is too high. Higher ratios rapidly remove the original
matrix, but at 95/5, the separation efficiency is probably too
low for many applications.
The novel approach to separate the magnetic particle into
a smaller droplet, thus improving the washing capacities of
microparticles in segmented flow, will facilitate the devel-
opment of true digital laboratory-on-a-chips. In particular,
the combination with digital qPCR is very promising.
Acknowledgments The research leading to the reported results has
received funding from the European Commission’s Seventh Frame-
work Programme (FP7/2007-2013) under the grant agreement BIO-
MAX (Project No. 264737) (TT and MC), the Institute for the
Promotion of Innovation through Science and Technology in Flanders
(IWT-SB 83166) and the Fund for Scientific Research Flanders
(Project No. G.0997.11).
References
Anna SL, Bontoux N, Stone HA (2003) Formation of dispersions
using ‘‘flow focusing’’ in microchannels. Appl Phys Lett 82:364.
doi:10.1063/1.1537519
Baroud CN, Delville J-P, Gallaire F, Wunenburger R (2006)
Thermocapillary valve for droplet production and sorting. Phys
Rev E Stat Nonlinear Soft Matter Phys 75:046302. doi:10.1103/
PhysRevE.75.046302
Beer NR, Hindson BJ, Wheeler EK et al (2007) On-chip, real-time,
single-copy polymerase chain reaction in picoliter droplets. Anal
Chem 79:8471–8475. doi:10.1021/ac701809w
Berensmeier S (2006) Magnetic particles for the separation and
purification of nucleic acids. Appl Microbiol Biotechnol
73:495–504. doi:10.1007/s00253-006-0675-0
Christopher GF, Bergstein J, End NB et al (2009) Coalescence and
splitting of confined droplets at microfluidic junctions. Lab Chip
9:1102–1109. doi:10.1039/b813062k
DeChancie J, Houk KN (2007) The origins of femtomolar protein-
ligand binding: hydrogen-bond cooperativity and desolvation
energetics in the biotin-(strept)avidin binding site. J Am Chem
Soc 129:5419–5429. doi:10.1021/ja066950n
Duffy DC, McDonald JC, Schueller OJ, Whitesides GMG (1998)
Rapid prototyping of microfluidic systems in poly(dimethylsi-
loxane). Anal Chem 70:4974–4984. doi:10.1021/ac980656z
Erickson D, Li D, Krull UJ (2003) Modeling of DNA hybridization
kinetics for spatially resolved biochips. Anal Biochem
317:186–200. doi:10.1016/S0003-2697(03)00090-3
Fan ZH, Mangru S, Granzow R et al (1999) Dynamic DNA
hybridization on a chip using paramagnetic beads. Anal Chem
71:4851–4859. doi:10.1021/ac9902190
Gijs MAM (2004) Magnetic bead handling on-chip: new opportuni-
ties for analytical applications. Microfluid Nanofluidics 1:22–40.
doi:10.1007/s10404-004-0010-y
Gijs MAM, Lacharme F, Lehmann U (2010) Microfluidic applica-
tions of magnetic particles for biological analysis and catalysis.
Chem Rev 110:1518–1563. doi:10.1021/cr9001929
Holtze C, Rowat AC, Agresti JJ et al (2008) Biocompatible
surfactants for water-in-fluorocarbon emulsions. Lab Chip
8:1632–1639. doi:10.1039/b806706f
Huebner A, Sharma S, Srisa-Art M et al (2008) Microdroplets: a sea
of applications? Lab Chip 8:1244–1254. doi:10.1039/b806405a
Huebner A, Bratton D, Whyte G et al (2009) Static microdroplet
arrays: a microfluidic device for droplet trapping, incubation and
release for enzymatic and cell-based assays. Lab Chip
9:692–698. doi:10.1039/b813709a
Janssen KPF, Knez K, Spasic D et al (2012) Multiplexed protein
detection using an affinity aptamer amplification assay. Anal
Bioanal Chem 404:2073–2081. doi:10.1007/s00216-012-6252-8
Lacharme F, Vandevyver C, Gijs MAM (2009) Magnetic beads
retention device for sandwich immunoassay: comparison of off-
chip and on-chip antibody incubation. Microfluid Nanofluidics
7:479–487. doi:10.1007/s10404-009-0424-7
Lee H, Xu L, Ahn B et al (2012) Continuous-flow in-droplet magnetic
particle separation in a droplet-based microfluidic platform. Micro-
fluid Nanofluidics 13:613–623. doi:10.1007/s10404-012-0978-7
Link DR, Anna SL, Weitz DA, Stone HA (2004) Geometrically
mediated breakup of drops in microfluidic devices. Phys Rev
Lett 92:054503. doi:10.1103/PhysRevLett.92.054503
Lombardi D, Dittrich PS (2011) Droplet microfluidics with magnetic
beads: a new tool to investigate drug-protein interactions. Anal
Bioanal Chem 399:347–352. doi:10.1007/s00216-010-4302-7
Niu X, Gulati S, Edel JB, DeMello AJ (2008) Pillar-induced droplet
merging in microfluidic circuits. Lab Chip 8:1837–1841. doi:10.
1039/b813325e
Pamme N (2006) Magnetism and microfluidics. Lab Chip 6:24–38.
doi:10.1039/b513005k
Pamme N (2012) On-chip bioanalysis with magnetic particles. Curr
Opin Chem Biol 16:436–443. doi:10.1016/j.cbpa.2012.05.181
Pan X, Zeng S, Zhang Q et al (2011) Sequential microfluidic droplet
processing for rapid DNA extraction. Electrophoresis 32:1–7.
doi:10.1002/elps.201100078
SantaLucia J (1998) A unified view of polymer, dumbbell, and
oligonucleotide DNA nearest-neighbor thermodynamics. Proc
Natl Acad Sci USA 95:1460–1465
Sista RS, Eckhardt AE, Srinivasan V et al (2008) Heterogeneous
immunoassays using magnetic beads on a digital microfluidic
platform. Lab Chip 8:2188–2196. doi:10.1039/b807855f
Song H, Ismagilov RF (2003) Millisecond kinetics on a microfluidic
chip using nanoliters of reagents. J Am Chem Soc
125:14613–14619. doi:10.1021/ja0354566
Song H, Tice JD, Ismagilov RF (2003) A microfluidic system for
controlling reaction networks in time. Angew Chemie
115:792–796. doi:10.1002/ange.200390172
Tang SKY, Li Z, Abate A et al (2009) A multi-color fast-switching
microfluidic droplet dye laser. Lab Chip 9:2767–2771. doi:10.
1039/b914066b
Thorsen T, Roberts RW, Arnold FH, Quake SR (2001) Dynamic
pattern formation in a vesicle-generating microfluidic device.Phys Rev Lett 86:4163–4166. doi:10.1103/PhysRevLett.86.4163
Verbruggen B, Toth T, Atalay YT et al (2013) Design of a flow-
controlled asymmetric droplet splitter using computational fluid
dynamics. Microfluid Nanofluidics 15:243–252. doi:10.1007/
s10404-013-1139-3
Verbruggen B, Toth T, Cornaglia M, Puers R, Gijs MAM, Lammer-
tyn J (2014) Separation of magnetic microparticles in segmented
flow using asymmetric splitting regimes. Microfluid Nanofluid.
doi:10.1007/s10404-014-1409-8
Verpoorte E (2003) Beads and chips: new recipes for analysis. Lab
Chip 3:60N–68N. doi:10.1039/b313217j
Whitesides GMG (2006) The origins and the future of microfluidics.
Nature 442:368–373. doi:10.1038/nature05058
Whitesides GMG (2011) What comes next? Lab Chip 11:191–193.
doi:10.1039/c0lc90101f
Microfluid Nanofluid (2015) 18:293–303 303
123
top related