spectrum of tp53 tumor suppressor gene pakistani...
Post on 30-Dec-2019
2 Views
Preview:
TRANSCRIPT
SPECTRUM OF TP53 TUMOR SUPPRESSOR GENE
MUTATIONS AND CODON 72 POLYMORPHISM IN
PAKISTANI FEMALE BREAST CANCER PATIENTS
ISHRAT AZIZ
M.Phil. (Punjab)
Dissertation in partial fulfillment of the requirement for
the award of Ph. D degree in Biological Sciences from
University of the Punjab, Lahore, Pakistan
School of Biological Sciences, University of the Punjab,
New Campus, Lahore 54590, Pakistan.
2011
A thesis submitted to university of the Punjab for the award of Ph. D degree in Biological Sciences (Molecular Genetics)
SPECTRUM OF TP53 TUMOR SUPPRESSOR GENE MUTATIONS IN
PAKISTANI FEMALE BREAST CANCER PATIENTS
By
ISHRAT AZIZ
M.Phil. (Punjab)
Supervisor
Prof. Dr. A. R. Shakoori
Distinguished National Professor & Director,
School of Biological Sciences,
University of the Punjab, New Campus,
Lahore 54590, Pakistan.
Place of Work
School of Biological Sciences, University of the Punjab, New Campus, Lahore 54590,
Pakistan.
The pink ribbon is an international symbol of breast cancer
awareness.
CONTENTS
Page no. Acknowledgements i List of Tables ii List of Figures iii Abstract v Introduction 1
Breast morphology and cancer 1 Possible causes of breast cancer 4 Tumor suppressor gene, TP53 gene 6 TP53 protein 8 TP53 pathway in normal cell 11 TP53 pathway in breast cancer 18
The TP53 pathway in breast cancer lacking TP53 mutations 18 The TP53 pathway in breast cancer by TP53 mutations 22
Sporadic mutations by TP53 gene 23 TP53 and hereditary breast cancer 23 TP53 gene polymorphisms 24 Progression in research on TP53 26 Status of breast cancer research in Pakistan 28 TP53 gene studies in Pakistan 32 Present study 35
Materials and Methods 36 Questionnaire preparation for patients and determining the status of Molecular epidemiology 36
Subjects 36 Sample preservation and transport 36 Pedigrees of families included in the present study 37
Family no. 1 37 Family no. 2 37 Family no. 3 38
DNA isolation 39 From blood samples 39 From frozen tissue 39
PCR amplification of specific region of Tp53 gene 40 Mutation detection 41 Heteroduplex formation 41 Mutation detection by temporal gradient gel electrophoresis (TTGE) 41 Sequencing of PCR amplified product 42 Analysis of TP53 mutations by IARC bioinformatics tools 42 Detection and restriction analysis of codon 72 polymorphisms 42 Analysis of questionnaires for determining epidemiology of breast cancer and the status of TP53 gene mutations in Pakistani population 43
Results 44 Mutations in exon 5-8 of TP53 gene. 44
Normal population 44 Sporadic breast cancer patients 45 TP53 gene mutation detection in familial breast cancer 49
Codon 72 polymorphism of TP53 gene. 51 Normal subjects 51 Sporadic breast cancer patients 52 Breast cancer families 53
Family 1 and family 2. 53 Family 3(Li.Fraumeni Syndrome family (LFS) 55
Epidemiological considerations based upon the samples included in this study 56 TP53 non- mutated patients 56
Provincial representation 56 Education status 57 Income level and feeding habit 57 Smoking status 58 Exposure to X-rays and type of food used for cooking food 58 Age of visitation 59 Menarche 59 Marital status 60 Number of children 60 Size of tumor 61 Hormonal level and nature of carcinoma 61 Familial breast cancer 63 Breast cancer patients with TP53 mutated genes 63
Conclusion. 65 Discussion. 66
TP53 gene mutations and polymorphisms in normal population of Pakistan 66 TP53 mutations 67
TP53 gene mutations in sporadic breast cancer patients of Pakistan 67 TP53 gene mutations in familial breast cancer patients 68
TP53 gene mutations in Li. Fraumeni Syndrome 68 TP53 polymorphism 69 Molecular significance of TP53 gene mutations detected in the present research 70 Significance of TP53 gene mutations and breast cancer in Pakistan 72
An early event in breast tumorigenesis 72 Frequency of mutations and its clinical value 73 Relation of BRCA1 to TP53 gene mutations 73 Relation of codon 72 polymorphism to TP53 gene mutations 74 Hotspots mutations of TP53 gene 74 Importance of the CpG site in TP53 mutations 74 TP53 as an epidemiological tool to test mutations in breast cancer 75 Prognostic significance 75 Predictor of the response 76
Relationship of TP53 gene mutations to classical and molecular epidemiology of breast cancer in Pakistan 76
Geographic variations 77
Urban, rural population and religion. 78 Socio-economic and education status 78 Cooking, eating habits and radiation exposure 79 Addiction and use of contraceptives 80 Early age breast cancer 80 Menstruation status 81 Marital status, parity and breast feeding 81 Family history 82 Clinical value of TP53 gene mutations 82
Tumor size 83 Tumor grade 83 Node involvement. 84 Laterality 84 Estrogen/ Progesterone (ER/PR) status 84 Type of Carcinoma 84
Conclusions 85 References 86 Appendices 118
Appendix-1 118
i
ACKNOWLEDGEMENTS
I am very thankful to my best friend, my Allah sohna, who never left me alone whenever I felt alone. Thousands drood and salams on Mohammad (SAW), the ideal of humanity. He taught me that how I can use my work for consoling my own soul by helping others. It is indeed my honor and pleasure to express my gratitude to Dr. A. R. Shakoori, my respected supervisor for his supervision, guidance, precious advice and kind behavior. How to think about a scientific problem beyond the boundaries and to write it in the boundaries of scientific writing rules was taught to me by him. Thank you sir. I am also thankful to Dr. Qasim Ahmed (Shaukat Khanum Hospital & Research Centre, Lahore, Pakistan) and Dr. Ute Hamman (Deutsches Krebsforschungszentrum, division of Molecular Genome Analysis Heidelberg, Germany) for their help in designing my scientific experiments. I am grateful to Higher Education Commission of Pakistan (HEC) for financial support and Central Cotton Research Institute (CCRI) and especially the secretary Pakistan Central Cotton Committee (PCCC), Mr. Gul Mohammad for moral support. The sampling for this research was made possible by the help of breast cancer families, research staff of Mayo hospital and Shaukat Khanum Hospital & Research Centre. I am really grateful to all of them. This work was performed at the School of Biological Sciences, University of the Punjab, Lahore, Pakistan in a friendly and intellectual environment provided by the Diractor General of the School Dr. Mohammad Akhtar, all the directors of school and administrative staff. I am thankful to all of them. I cannot forget the fragrant, brilliant and naughty environment of lab 7 of School of Biological Sciences. The circle of seven talkative persons who love to talk at the same time on same topic with different opinion. So thanks dear friends, Saadat Ali, Mohammad Shahid Nadeem, Akbar Ali, Mohammad Zawar Mustafa, AbduRauf, Shehzada Nadeem and Zaid Ullah. I am thankful to my friends at School of Biological Sciences, Sunbal, Asia and Nazia for their sincere friendship.My especial gratitude are also for Mehwish Khan, Arifa and Dr. Zubair for what they have done for me. My gratitude is for all the members of my family who prayed for my success, my ammi jaan (mother in-law), Qazi Tamam Abdullah (brother in-law); Nadia (sister in-law); Nuzhat (sister in-law); Eram (sister in-law); Hinna (sister in-law); their families and especial thanks to Ibtasam (sister in-law) who made my ways free to complete Ph.D and looked after my home and my children in my absence. The memories of innocent actions of my children, Eehab, Mujtaba and Abdul-Manan always made easy to work at lab. I like to express thanks to my dear brothers Sami, Shafqat , Tausif and beloved sister Iffat who always helped and prayed for my success. May Allah fulfill all the dreams of my father Abdullah (late) and my mother, Parveen who sacrificed their lives for us. How much can I thank my ammaji, Mumtaz and abbaji, Aziz ullah Khan, who reared me till now after the death of my father when I was of eleven years old. I am really thankful to Saad, my husband, for his love, really means for me. And, finally, to all of you that I did not mention in particular, THANK YOU!!!
ISHRAT AZIZ
ii
LIST OF TABLES Page no.
Table I. Genes involved in familial breast cancer 5 Table II. Comparison of the biological activities of the two polymorphic TP53 26 Table III. Primers for amplification of the TP53 gene 40 Table IV. Frequencies (%) of TP53 genotypes in control and breast cancer patients 53 Table V. Frequencies of TP53 genotype among F1 and F2 family members 54 Table VI. Clinical and genetic status of LFS family 56 Table VII. Comparison of breast cancer risk factors in patients having TP53 mutations 63
iii
LIST OF FIGURES
Page no.
Fig. 1. Breast anatomy 1 Fig. 2. Simplified anatomy of the female breast showing the major structural
components of the breast 3 Fig. 3. Progression of the breast cancer 4 Fig. 4.Localization of human TP53 gene is on large arm of seventeenth
chromosome and mapped on 13.1 position 6 Fig. 5. Organization of the humanTP53 gene 7 Fig. 6. Dendrogram showing sequence homology of TP53 gene 8 Fig. 7. TP53: from gene to protine 9 Fig. 8. Anatomy of TP53 gene and protein 10 Fig. 9. Control and release of TP53 11 Fig. 10. TP53 activation pathway by stress signals 12 Fig. 11. TP53 and metabolism 14 Fig. 12. Regulation of life and death by TP53 15 Fig. 13. Human TP53 isoforms 17 Fig. 14. Relationship between BRCA1 and TP53 gene signaling pathway 21 Fig. 15. Pedigree of familial breast cancer patient of family 1 37 Fig. 16. Pedigree of familial breast cancer patient of family 2 37 Fig. 17. Li. Fraumeni Syndrome like characters in Family 3 38 Fig. 18: Amplification of exons 5-8 of TP53 gene from two
tumor samples SKH86 and NUS10 44 Fig. 19. Detection of TP53 mutations in normal samples by
Temporal Temperature Gradient Gel Electrophoresis (TTGE) showing no difference in band mobility pattern 45
Fig. 20. TP53 mutation detection by TTGE in exon 7 of sporadic breast cancer patient SKH85 46 Fig. 21. Sequence of mutated band showing point mutation
at codon 248 in exon7 of TP53 gene 46 Fig. 22. TP53 mutation detection by TTGE in exon 7 of sporadic breast cancer patient, SKH86 47 Fig. 23. Sequence of mutated band showing point mutation at
codon 238 in exon7 of TP53 gene 47 Fig. 24. TP53 mutation detection in exon 8
of sporadic breast cancer patient (NUS-10) 48 Fig. 25. Sequence of mutated band showing point mutation at
codon 278 in exon 8 of TP53gene 48 Fig. 26. Detection of TP53 mutations in exon 5-8 of familial samples by
Temporal Temperature Gradient Gel Electrophoresis (TTGE) showing no difference in band mobility pattern 50
Fig. 27. RFLP gel (4%) showing TP53 codon 72 polymorphism in blood samples of normal subjects 51
Fig. 28. RFLP gel (4%) showing TP53 codon 72 polymorphism in blood samples of sporadic breast cancer patients 52
Fig. 29. RFLP gel (4%) showing TP53 codon 72 polymorphism in blood,
iv
tumor and normal samples of sporadic breast cancer patients 52 Fig. 30. RFLP gel (4%) showing TP53 codon 72 polymorphism
in blood, tumor and normal samples of sporadic breast cancer patient 53 Fig. 31. RFLP gel showing TP53 codon 72 polymorphism in family 1 and 2 54 Fig. 32. RFLP gel showing TP53 codon 72 polymorphism in family 3 (LFS) 55 Fig. 33. Breast cancer patients from four provinces of Pakistan,
that reported at ShaukatKhanum Memorial Cancer Hospital for treatment and included in the present study 57
Fig. 34. Education status of patients registered at SKMCH 57 Fig. 35. (A) Income level and (B) feeding habit 57 Fig. 36. Smoking status of breast cancer patients 58 Fig. 37. Rays emission to cancer patients 58 Fig. 38. Age of patients at visitation 59 Fig. 39. Status of menarche 59 Fig. 40. Marital status, contraceptives use and menstruation 60 Fig. 41. Number of children of breast cancer patients 60 Fig. 42. Status of breast cancer 61 Fig. 43. Status of breast cancer 62 Fig. 44. Family history of breast cancer patients 63 Fig.45. 3 dimentional structures of TP53 gene mutations in breast 71
v
ABSTRACT
The tumor suppressor gene TP53 encodes a nuclear protein that prevents the cells from
dividing before DNA damage is repaired. Mutations in TP53 gene have effects on its
biological activities. The objectives of present study aims at determining the frequency TP53
mutations in sporadic, genetic lineage and analysis of the data i.e. questionnaire collected
from breast cancer patients from Pakistan, during the study.
Female breast cancer patients were recruited at Shaukat Khanum Memorial Cancer Hospital
& Research Centre and Mayo Hospital, Lahore Pakistan, from January 2005-December 2008.
A total of 150 sporadic breast cancer patients and three families with breast cancer cases
were included in the study. From all study participants, a blood sample and a piece of tissue
of normal and tumor both were collected. DNA was extracted and exons 5-8 (central region)
of TP53 gene were PCR amplified. Each sample was heteroduplexed with a normal control
sample (confirmed by sequencing). To screen TP53 mutations Temporal Temperature
Gradient Gel Electrophoresis (TTGE) was performed. The mutations were confirmed by
sequencing. Restriction Fragment Length Polymorphism (RFLP) was used for understanding
the status of codon 72, exon 4 of TP53 gene polymorphism (arg/arg) in Pakistan. The data
was analyzed using the R15 programme, provided by International Agency for Research on
Cancer. Three deleterious mutations were detected in the sporadic breast cancer patients, viz.,
codon 238 where TGT is mutated to TAT (cys to tyr), codon 248 where CGG is mutated to
CAG ( arg to glu), and codon 278 where CCT is mutated to TCT (pro to ser). These
mutations were not detected in normal breast tissue and blood samples of these patients. R15
analysis (IARC, 2011) of TP53 gene mutations showed that the mutations detected in
Pakistani breast cancer patients are reported most prevalent somatic mutations (codon 238 =
79 tumors, codon 248 = 779 tumors and codon 278 = 74 tumors) in breast cancer patients of
the world. Three-dimensional structures were predicted by 3D Viewer (software given on
IARC website) and found that all these three mutations are in DNA binding region of TP53
and could change the structure of protein and, therefore, affect its function. TP53 mutation
has not been observed in normal persons and breast cancer families blood samples. One
family was detected with Li-Fraumeni syndrome characters but TP53 mutations are not
found in it.
Although the polymorphism arg/arg, codon 72, exon 4 of TP53 gene is reported as a
functional relevant polymorphism that contributes to breast cancer development yet in the
vi
present study, genotype arg/pro and pro/pro, both polymorphisms were found more
significant in Pakistani breast cancer patients as compared to arg/arg with corresponding ratio
of arg/pro (53.3): pro/pro (34.6): arg/arg (12). Normal controls showed about the same
difference in ratio of arg/pro: pro/pro: arg/arg, (50:40:10).
Correlation of TP53 mutations with clinicopathological parameters (data collected by
questionnaire) was observed. Patients were divided into two groups; group 1 (TP53 non
mutated) and group 2 (TP53 mutated). As both groups have not shown any difference so no
prominent correlation between TP53 mutations and clinicopathological parameters was
found.
It is concluded that the frequency of TP53 gene mutations in DNA coding region (5-8 exon )
is low in Pakistani breast cancer patients. However, present study is in favor of the fact that
the frequency of TP53 gene mutations is different in different geographical areas. Genotype
arg/arg is less prevalent in the female breast cancer patients and normal population of
Pakistan. There was no significant correlation between TP53 mutation and tumor
aggressiveness e.g. nodal status, size, ER/PR, histopathology etc. Epidemiologically, no
carcinogen was found important as a causative factor of TP53 gene mutations in Pakistani
breast cancer patients.
1
INTRODUCTION
Breast morphology and cancer
The human breast is the upper ventral region in primates having left and right sides.
Both men and women develop breasts from the same embryological tissues. Female
contains the mammary gland that secretes milk used to feed infants. Anatomically, the
breasts are glands which produce milk in women and attached to rib’s wall by pectoral
muscles (Fig. 1). Each breast has one nipple surrounded by the areola and has several
sebaceous glands. The mammary glands are distributed throughout the breast. These are
drained to the nipple by 4 -18 lactiferous ducts, each duct has its own opening. The
remainder of the breast is composed of connective tissue (collagen and elastin) and
adipose tissue (fat). Each breast has 15 to 20 lobes. Through ducts milk gets to the nipple.
Blood vessels and lymph vessels are also present in the breast. The lymph nodes are
small, equal to pea and filter the lymph. Most of these nodes are under the arm (Reid and
Robert, 2008).
Fig. 1. Breast anatomy.
Upon receiving a pro-mitotic extracellular signal, G1 cyclin-CDK (Cycline dependent
kinases) become active to prepare the cell for S phase, promoting the expression of
transcription factors which promote the DNA replication. Unregulation of the cell cycle
components may lead to tumor formation. Some genes like TP53 etc. when mutate, may
cause the cell to multiply uncontrollably, forming a tumor (Cooper, 2000).
2
Primarily, the breast cancer begins in the cells of milk producing glands, or lobules
which are the passage for milk from the lobules to the nipple with little involvement of
the stromal tissues. The tumor cells may invade the healthy tissue of the breast and if they
get way into the lymph nodes they have a path to other parts of the body (Kumar et al.,
1997). The older cells remain alive along with new cells which formed regularly result in
the mass of extra cells called tumor (Oncolink, 2007; Reid and Robert, 2008). Following
changes take place in the breast, at stromal, ductal and glandular level due to any
abnormality in signaling pathway (Fig. 2):
Type I cyst
Type II cyst
Papiloma
Ductal hyperplasia ( malignant form is ductal carcinoma)
Sclerosing adenosis ( malignant form is inflammatory carcinoma)
Fibrocystic ( malignant form is lobular carcinoma)
Fibroadenoma ( malignant form is lobular carcinoma)
Figure 2 shows important histologic structure of breast where appearance of
common lesions usually appear. More severe form of these lesions causes breast cancer.
The breast cancer may be ductal cancer (effects the ducts), lobular (begins in the lobes of
the breast and often is found in both breasts) and inflammatory cancer (the breast appears
swollen and hot) (Grey, 1918; Reid and Robert, 2008). Formation of lump or thickening
in the breast or underarm, change in size or shape of the breast, nipple discharge or nipple
turning in scaling of the skin or nipple and ridges or pitting of the breast skin are
symptoms for alarm. The development of breast cancer can pass through the following
five stages:
Stage 0:
Recognized by abnormal cells
i. lobular carcinoma in situ, LCIS, lining the gland in the breast. This is a risk
factor for the future development of cancer, but this is not a cancer itself.
ii. ductal carcinoma in situ, DCIS, lining the duct.
LCIS is a risk factor for future development of cancer. Whereas women with DCIS have
an increased risk of getting invasive breast cancer in that breast.
3
Fig. 2. Simplified anatomy of the female breast showing the major structural components of the breast. The anatomic location of different lesions, the histology and sites of origin of potential lesions (taken from Santen , 2010).
Stage I: The tumor is less than 1 cm across, and has not spread into the surrounding
areas.
Stage II: The cancer is anywhere from 1-2 cm across, and has spread into the
surrounding areas including the lymph nodes.
Stage III: Cancer in the advanced stages, more than 2 cm across and has spread to the
lymph nodes. A type of cancer, associated with this is called inflammatory breast
cancer, the breast is inflamed because cancer is blocking the lymph nodes.
Stage IV: the cancer has spread out in the whole breast and the lymph nodes.
Remission: there is extremely high risk of reoccurrence of cancer in the first 5 years
after the absence of last known cancer.
Fig. 3. explains the progression from the earliest changes to breast cancer takes 5-10
years, based upon cancer doubling times of 1-6 months (Santen , 2010).
4
Fig. 3. Progression of the breast cancer. gradual progression from the HELU ( hyperplastic elongated lobular unit), ADH ( atypical ductal hyperplasia), DCIS and invasive breast cancer (IBC).
Possible causes of breast cancer
The sporadic breast cancer is caused by environmental factors, including
geographical variations (Denissenko et al., 1996), diet (Colditz et al., 1995), age (Hedau
et al., 2004), age of menarche, age of menopause, nulliparity, age of first child (Parkin et
al., 1992), chemical exposure, radiation, contraceptives intake (Stanford et. al., 1995),
smoking, alcohol intake (Perera et al.,1982) and due to gene mutations like TP53 (Martin
et al., 2003).
The Aneuploidy, change in chromosomal numbers and nucleotide changes are the
basis of origins of breast cancer. It is also related to many risk factors e.g. life-styles
associated with the hectic, consumer based trends of western countries. Like, the
consumption of more calories, eating fewer nutritive foods, doing less exercise, leading
to early menarche, obesity and ingestion of naturally occurring compounds which
quenches the free radicals and reduce oxidative stress on DNA.
A woman having family history (a mother, sister, or daughter with breast cancer),
previous history of breast cancer and having a genetic mutation, is more susceptible to
5
breast cancer (Martin et al., 2003). Three to ten percent of breast cancers may be due to
BRCA1 or BRCA2 gene or any of these genes with relation to TP53. If a woman is found
to carry either mutation, she has a 50% chance of getting breast cancer before she is 70
(IARC, 2011).
National institute of cancer of America (2011) has observed that breast cancer is
the most common malignant tumor in women of America and Europe. Every woman has
a risk of breast cancer. About 200,000 cases of breast cancer were diagnosed in the
United States in 2001. Breast cancer is the second cause of cancer death in American
women after lung cancer. The lifetime risk of any particular woman getting breast cancer
is about 1 in 8. Estimated new cases of 207,090 (female); 1,970 (male) and deaths 39,840
(female); 390 (male) from breast cancer were reported in the United States in 2010.
Table I: Genes involved in familial breast cancer (Bennett et al., 2000).
Disease Gene(s) Function Locus
Hereditary early onset breast
cancer BRCA1
cell cycle & DNA
repair 17q
BRCA2 DNA repair 13q
Ataxia-telangiectasis ATM DNA repair 11q
Cowden’s disease PTEN signal transduction &
cell cycle
10q
Li-Fraumeni syndrome TP53 cell cycle & DNA
repair
17q
CHK2 cell cycle & DNA
repair
Hereditary non polyposis colon
cancer also involved in familial
breast cancer
MSH 2, MLH
1
DNA repair 2p, 3p
PMS 1 & 2 DNA repair 2q, 7p
MSH6 DNA repair 2p
Human cancer or neoplasia is called as genetic disease at cellular level. Several
genes are involved in tumorigenesis (Table I). Nowel (1992) has explained the process
that the activation of transforming genes and inactivation of tumor suppressor genes get
started side by side. Detection of genetic disorders at DNA level is an important event in
6
tumorigenesis. In this process expression of genes causes production of unique proteins
in certain organs which governs the signals in cell cycle. These genes may get clustered
in certain families and populations and act like a genetic marker to understand the
epidemiology of disease and genetic susceptibility of certain populations (Oliver et al.,
2009). One of these genetic markers is TP53 which is widely used as prognostic marker
for understanding the genetics of certain population and epidemiology of certain endemic
disease like breast cancer.
Tumor suppressor gene, TP53 gene
TP53 with gene bank accession no. NM_000546; MIM#191170. It has
chromosomal location 17p13 (Fig. 4) and has eleven exons (Fig.5). The gene
encompasses 20 kb of DNA; 3.0 kb mRNA and 1179 bp open reading frame. Two new
genes homologous to TP53 have been discovered, p73, localized at lp36 and p63
localized at 3q27 (IARC, 2011). The reported work of Soussi et al. (2011) shows that
TP53 gene consists of 20303 nucleotides expressed into 393 amino acids. Out of eleven
exons. the first is non coding.
Fig. 4. Localization of human TP53 gene is on large arm of seventeenth chromosome and mapped on 13.1 position. The arrow indicates the 17p13.1 position on chromosome.
Functionaly active exons are, exon 2 (1-25 amino acids), exon 3 (26-33 amino
acids), exon 4 (34-126 amino acids), exon 5 (127-187 amino acids), exon 6 (187-225
amino acids), exon 7 (226-261 amino acids), exon 8 (262-307 amino acids), exon 9 (308-
332 amino acids), exon 10 (333-367 amino acids), exon 11 (368-393 amino acids).
7
Fig. 5. Organization of the humanTP53 gene. 22 000 bp; 11 exons (blue) coding for a 2.2 Kb mRNA. Translation begins in exon 2. Sizes of exons and introns are shown in bp (Taken with permission from Soussi , 2011).
TP53 gene is used as a model for study of molecular epidemiology. According to
Dumaz et al. (1994) for studying the origin of mutagenesis in the human population, a
model gene must exhibit the following properties:
i. Must be mutated in a large number of cancers.
ii. Mutation rate must be high
iii. Must be of small size and should alter mainly by point mutations.p
Dumaz et al.(1994) suggested that at present these characteristics are found in two
genes, the HRAS (Harvey rat sarcoma viral oncogene homolog (Homo sapiens))
oncogene and the TP53 gene. One of the disadvantages of HRAS is the less number of
codons (three) that are the target of mutations. In contrast, more than 100 of the 393
codons in the TP53 gene can be mutated. TP53 like gene is located also in other animals.
On the basis of sequence homology, Soussi et al. (2011) has given the evolutionary tree
(Fig. 6). TP53 gene is located on different chromosomes in other mammals (Vousden and
Lane, 2007):
chromosome 17 Chimpanzee chromosome 16 Macaque chromosome 11 Mouse chromosome 10 Rat chromosome 5 Dog chromosome 19 Cow chromosome 12 Pig chromosome 11 Horse
8
chromosome 2 Opossum
Fig. 6. Dendrogram showing sequence homology of TP53 gene (taken with the permission from Soussi., 2011). TP53 protein
In human, tumor repressor protein TP53 is encoded by the TP53 gene. The name
TP53 is given due to its molecular mass apperaence. It runs as a 53-kilo-Daltan proteine
on polyacrylamide gel. But on the basis of its amino acids residues, TP53’s mass is only
43.7 kDa. The high number of proline residues in the protein slows its migration and it
appears heavier (Ziemer et al., 1982). It comprises 393 amino acids. It is localized in
nucleus, widely expressed and it has five conserved domains between species. TP53
activity lost in human cancer by mutation of the TP53 gene itself and by loss of cell
signaling upstream or downstream (Vousden and Lane, 2007). TP53 can be divided into
five domains, from N-term to C-term (Baker et al., 1989; Crawford, 1983; Cho et al.,
1994; Soussi et al., 1994) (Fig.7).
I. A transactivation domain (1-42 codons)
II. A proline rich domain (63-97 codons)
III. A specific DNA binding domain (zinc binding) (102-292 codons)
IV. A tetramerization domain that includes a nuclear export signal (325-355 bp) with
nuclear localization signals (305-322 codons)
V. A negative regulatory domain (360-393 codons).
9
Fig.7. TP53: from gene to protin. TP53 gene which is localized on chromosome no. 17, has eleven exons and transcribed into a protein of five domains (transactivation domain (1-42 codons); Proline rich domain (63-97 codons); specific DNA binding domain (102-292 codons) (zinc binding); A oligomerization domain that include a nuclear export signal (323-356 bp) and a negative regulatory domain (360-393 codons). Phosphorylation and acetylation sites of protein are located in oligomerization and regulatory domains (taken from IARC., 2011). .
TP53 regulates the cell cycle so it is called as guardian of the genome. It is
encoded by a gene, which on mutations results into a cancer. This gene is mutated by
several ways e.g. genetic factors, viruses like adenoviruses and human papilloma viruses
(IARC, 2011). Mutations in TP53 gene are considered as the single most common cancer
DNA alteration and ultimately high susceptibility to cancer formation (Debra and
Leonard, 2007). Most of the TP53 gene mutations are clustered between exons 5 and 8
and are localized in four evolutionailry conserved domains i.e. domain II- V (Levine et
al., 1991, Caron-de-Fromentel and Soussi, 1992). Berns et al.(2000) found that 90%
mutations residing in DNA binding domain were related with the poorest prognosis.
These findings were confirmed by Soussi et al. (2011) where patients with missense
mutations affecting DNA binding or zinc binding displayed a very aggressive phenotype
with a short survival.
From N-terminus to C-terminus the eleven exons of TP53 are divided into three
major regions which are functionally important (Fig. 8) (Takahashi et al., 1989; Feki and
Irminer-Finger, 2004). The first functionally significant region is L2 loop (exon 6-7)
which is important for folding and stabilization of central part of the protein; L3 loop
(exon 7) containing 248 residue which contacts DNA directly and LSH motif (exon 8)
10
contacts DNA directly. According to IARC (2011), 90% of TP53 mutations are reported
from core domin having structural motifs.
Oren et al. (1981) reported that TP53 has a half-life of about 20 min and is
generally located in the cell nucleus. The protein is found in the cytoplasm during G1
then enters the nucleus during the G1/S transition, where it remains until the end of the
G2/M phase, after DNA synthesis it again is found in the cytoplasm Shaulsky et al.
(1990). TP53 preserves the genetic integrity of the cell by arresting the cell division to
repair DNA damage. As the tumor cells contain mutant TP53 so they are not able to
receive a growth arrest signal. If cell is incapable of DNA repair, TP53 would induce cell
death by inducing apoptosis (Lane et al., 1992).
Fig. 8. Anatomy of TP53 gene and protein. TP53 consists of 20303 nucleotides and 393 amino acids.
There are eleven exons. Functionaly active exons are, exon 2 (1-25 amino acides), exon 3 (26-33 amino
acides), exon 4 (34-126 amino acides), exon 5 (127-187 amino acides), exon 6 (187-225 amino acides),
exon 7 (226-261 amino acides), exon 8 (262-307 amino acides), exon 9 (308-332 amino acides), exon 10
(333-367 amino acides), exon 11 (368-393 amino acides). N- terminus (Amino terminal), contains a large
number of acidic residues, no basic residues and a large number of prolines (including many Pro-Pro pairs)
and is transcriptional activation domain of TP53 gene. Core domain (central region) of the protein which
contains several very hydrophobic regions and very few charged amino acids. This region is important for
the sequence specific complex with DNA binding. C-termius (carboxy terminal) is very hydrophilic and
contains many charged residues. It contains a domain necessary for the TP53 oligomerization, one primary
and two secondary nuclear localization signal sequences, mediated non specific DNA binding. Several
structural domains are involved in DNA binding region, L2 loop (exon 6-7) important for folding and
stabilization of central part of the protein; L3 loop (exon 7) containing 248 residue which contacts DNA
directly and LSH motif (exon 8) contacts DNA directly. According to IARC (2011), 90% of TP53
mutations are reported from core domain having structural motifs.
L2 LSHL3
11
TP53 pathway in normal cell
TP53 is situated at the crossroads of a network of those signalling pathways
which are important for cell growth, regulation and apoptosis, induced by genotoxic and
non-genotoxic stresses. In normal unstressed cells, the level of TP53 is downregulated by
the binding of proteins such as MDM2 that promote TP53 degradation via the ubiquitin
pathway. As MDM2 is up regulated by TP53, it leads to a regulatory loop which keeps
TP53 level very low in a normal cells (Vousden & Lu, 2002). After stresses, activation of
TP53 takes place in two steps process. First TP53 protein level is increased by the
inhibition of its interaction with MDM2. Second, a series of modulator (kinases,
acetylases) will activates TP53 transcriptional activity. The phenomenon of control and
release of TP53 is illustrated in (Fig. 9).
Fig. 9. Control and release of TP53. After genotoxic or non-genotoxic stresses, activation of TP53 takes
place in two steps process. First TP53 protein level is increased by the inhibition of its interaction with
MDM2 and the other negative regulators. Second, a series of modulator (kinases, acetylases) will activates
TP53 transcriptional activity.
Release of the tight control over TP53 and activation of TP53 is a well established
response to stress. TP53 is sensitive to even low levels of DNA damage. According to
Vousden and Lane, (2007) after activation of TP53 many proteins have been found to
bind various regions of TP53 in order to regulate the specificity of its activity (Fig. 10).
Stress signals activate the pathway, the mediators intercept the pathway signals (ATM
sensitize the DNA damage, Chk2 is protein kinase involves in cell cycle arrest, P19ARF
12
stabilizes the TP53 by blocking shuttling of Mdm2). Mdm2 is negative regulator of TP53
so the mediators save the stability of TP53 activity in this main switch. The effectors of
this signaling pathway includes p300 and CBP which are the members of co activator
family, apoptosis stimulating protein of TP53 (ASPP1) and tumor necrosis factor
receptor-associated factors (TRAF and PCAF) (Soussi et al. 2011).
Fig. 10. TP53 activation pathway by stress signals. Upstream mediators (ATM, Chk2, p19, etc) detect the upstream signals. The master switch get off and after breaking the MDM2- TP53 relation, core regulation of TP53 takes place by its interaction with many proteins (ASPP family etc.) modulate its stability. After breakage of TP53-MDM2 relation by the help of effectors, downstream events get activated mainly transcriptional activation of transducers causes angiogenesis, growth arrest, DNA repair and apoptosis .
13
Downstream signaling (Fig. 10) includes a large series of genes that are activated
by the transactivating properties of TP53. This occurs by specific DNA binding of the
TP53 protein to a TP53 response element (TP53 RE) that is found either in the promoter
or in the intron of target genes. Regardless of the type of stress, the final outcome of
TP53 activation is either cell cycle arrest and DNA repair or apoptosis, but the
mechanism leading to the choice between these fates has not yet been discovered
(Vousden and Lane, 2007). In the case of downstream pathway, the active TP53
enhances the protein-protein interaction during transcriptional activation of transducers
(GD1, Glyceraldehyde 3- phosphate dehydrogenase;TSP1, Thrombospondin
antiagiogenesis; p21, RAS protein activator; The 14-3-3 (sigma) protein, a negative
regulator of the cell cycle, is a human mammary epithelium-specific marker that is
downregulated in transformed mammary carcinoma cells; Gadd45- Growth arrest and
DNA repair enhancer); p48, suppresses UV induced mutagenisis; p53 R2, ribo-
nucleotide reductase; XPC, Xerodermum pigmatosum gene; BAX gene of Bcl2 gene
family and involves in apoptosis; Puma is also modulator of apoptosis; Pig3, involved in
TP53 mediated cell death, Noxa, also a member of Bcl2 family and involves in apoptosis,
DR5, TNF-receptor family member and involves in apoptosis and FAS is considered as
receptor of death at surface of cell). The outcome of TP53 pathway is in the form of
angiogenesis, growrh arrest, DNA repair and apoptosis.
Recent studies have indicated a role for TP53 in determining the response of cells
to nutrient stress and in regulating pathways of glucose usage and energy metabolism
(Fig.11). Levine and Oren (2009) explained that metabolic stress results in low glucose
levels which activate TP53 through a pathway that involves AMP kinase (AMPK) and
has been proposed to contribute to the short-term survival of cells. . However, the loss of
this response in tumors that lack functional TP53 might also contribute to the capability
of these cells to continue to proliferate in nutrient-poor conditions, and so provide a
proliferative advantage to tumor cells that are attempting to grow abnormally. TP53 has
been shown to induce the expression of the copper transporter SCO2, which is required
for the assembly of cytochrome c.
14
Fig. 11. TP53 and metabolism. In response to nutrient stress, TP53 can become activated by AMP kinase (AMPK), promoting cell survival through an activation of the cyclin-dependent kinase inhibitor p21. Other functions of TP53include regulating respiration, through the action of SCO2, or in decreasing the levels of reactive oxygen species (ROS), through the actions of TIGAR (TP53-inducible glycolysis and apoptosis regulator).
One of the most interesting functions of TP53 is in the regulation of lifespan,
although whether TP53 helps or hinders the ageing process of human is not yet clear but
Sharpless and DePinho (2004) had observed that even a slight constitutive hyper
activation of TP53 results in an alarming premature ageing phenotype in mice. Vousden
and Lane (2007) had designed a model which explains the role of TP53 in deciding the
cell survival and death in condition of stress. In this model, TP53 responds to conditions
of low stress to play an important part in decreasing oxidative damage, and provides
repair functions to mend low levels of DNA damage. These activities of TP53 contribute
to the survival and health of the cell as well as to the prevention of the acquisition of
tumorigenic mutations, and might contribute to over all longevity and normal
development. By contrast, acute stress that results in a more robust induction of TP53
leads to the activation of apoptotic cell death and thereby the elimination of the damaged
cells (Fig.12).
15
Fig. 12. Regulation of life and death by TP53. TP53 responds to conditions of low stress to play an important part in decreasing oxidative damage, and provides repair functions to mend low levels of DNA damage. These activities ofTP53 causes the survival and health of the cell as well as the prevention of tumorigenic mutations, and control over all longevity and normal development. By contrast, acute stress that results in a more induction of TP53 leads to the activation of apoptotic cell death and so the elimination of the damaged cells.
TP53 protein has eight alternative splicing isoforms. The first isoform was first
described in 1987 (Matlashewski et. al., 1987). TP53 has following isoforms along with
wild type full length TP53 protein (Soussi et al., 2011) (Fig. 13).
(a) Wild type full length TP53
(b) TP53 beta: alternative splice of intron 9
(c) TP53 gamma: alternative splice of intron 9
(d) Delta 40: Initiation of translation at codon 40.
(e) Delta 40 beta: Inition of transition at codon 40,alternative splice of intron 9
(f) Delta 40 gamma: Initiation of translation at codon 40 alternative splice of intron 9
(g) delta 133: initiation of translation at codon 133
(h) delta 133 beta: initiation of translation at codon 133 + alternative splice of intron 9
(i) delta 133 gamma: initiation of translation at codon 133 + alternative splice of
intron 9
16
These isoforms are expressed in a wide range of normal tissues, so that the internal
promoter and the splicing of TP53 can be regulated. Moreover, TP53 protein isoforms
have different subcellular localizations, suggesting that each isoform can have different
biological activities.
Immunofluorescence experiments of the TP53 isoforms revealed that delta133p53
and p53beta are mainly localized in the nucleus with a minor staining in the cytoplasm.
Additionally, p53gama was found in the nucleus in most cells and in the cytoplasm in
some others, suggesting that p53gama could be shuttling between the nucleus and the
cytoplasm and that its subcellular localization can be regulated. Furthermore,
delta133p53beta protein was seen in the nucleus and the cytoplasm in most cells, with
10% of cells revealing the formation of delta133p53beta foci in the nucleus. Whereas
delta133p53beta and delta133p53gama isoforms differonly by the last 15 carboxy-
terminal amino acids, dalta133p53gama is exclusively localized in the cytoplasm,
indicating that the carboxy-terminal amino acids can modify the subcellular localization
of these isoforms (Bourdon et al., 2005).
TP53 isoforms can regulate fate of cell outcome in response to stress, by
modulating TP53 transcriptional activity in a promoter and stress-dependent manner. The
TP53 isoforms are abnormally expressed in several types of human cancers, suggesting
that they play an important role in cancer formation. The determination of TP53 isoforms
expression may help to link clinical outcome to TP53 status and to improve cancer
patient treatment. So the TP53 isoforms are expressed both at the mRNA and protein
levels. Moreover, the abnormal expression of the TP53 isoforms in different cancer types
suggests that their differential expression may disrupt the TP53 response and contribute
to tumor formation. Furthermore, it may provide an explanation to the difficulties in
many clinical studies to link TP53 status to cancer prognosis and treatment (Khoury and
Bourdon, 2010). Concerning to breast tissue, normal breast tissue expresses TP53,
p53beta, and p53gama but not the other TP53 isoforms. Only 25% of tumors present a
mutation of the TP53 gene, suggesting that TP53 and its pathway are inactivated by other
mechanisms (Chen et al., 2009).
17
Fig. 13. Human TP53 isoforms (taken with the permission of Soussi et al., 2011). Scheme of the TP53 gene and protein of Homo sapiens. Iniciation of transcription is indicated by red arrows. Exons are numbered. Noncoding exons are represented by blue boxes, intron 9 (i9) is represented by black box and coding exons are represented by white boxes. The size of the boxes is not proportional to the size of the exons. The second row of each diagram represents the protein and the black boxes represent amino-acid domains conserved through evolution. The icon (a) represents the wild type TP53 and remaining icons (b-i) represent the TP53 isoforms.
a) Wild type full length TP53 (393 residues) b) TP53 beta: normal splicing of exon 1-9 and alternative splice of intron 9 c) TP53 gamma: normal splicing of exon 1-9 and alternative splice of intron 9 d) Delta 40: Initiation of translation at codon 40. No splicing of intron 2. Intron 9 is fully spliced e) Delta 40 beta: Inition of transition at codon 40. No splicing of intron 2. Alternative splice of intron
9 f) Delta 40 gamma: Initiation of translation at codon 40. No splicing of intron 2. Alternative splice
with intron 9 g) delta 133: initiation of translation at codon 133. Splicing of exons 5-11. Intron 9 is fully spliced h) delta 133 beta: initiation of translation at codon 133. Splicing of exons 5-9. Alternative splicing
with intron 9 i) delta 133 gamma: initiation of translation at codon 133 + alternative splice of intron 9
18
TP53 pathway in breast cancer
Although the function of TP53 gene is the elimination of abnormal cells and
preventation of the neoplastic development but abrogation of the negative growth
regulatory functions of TP53 occurs in about all human tumors. The TP53 signalling
pathway is in ‘standby’ mode under normal cellular conditions. Activation occurs in
response to cellular stresses and upstream regulatory kinases. There are two TP53
dependent pathways which causes breast cancer:
1. The TP53 pathway in breast cancer lacking TP53 mutations.
2. The TP53 pathway in breast cancer by TP53 mutations.
1. The TP53 pathway in breast cancer lacking TP53 mutations
The frequency of mutations in breast cancer is lower than that in many other
common cancers (IARC, 2011). Following changes are reported in molecular
mechanisms which may affect tumor suppressor properties of wild-type TP53:
Changes in upstream regulators of TP53
ATM- TP53
The normal role of the ATM gene (ataxia telangiectasia) controls cell division and
its mutated form is involved in breast cancer. ATM invades TP53 cascade by affecting the
Chk2 pathway which directly affects TP53 gene. The altered form of the ATM gene is
closely linked to a childhood disorder of the nervous system called ataxia telangiectasia
(AT) which normally afflicts 1 in 40,000 children in the U.S. and 1 in 200,000 worldwide
each year (Hainaut and Hollstein, 2000).
Chk2- TP53
Chk2 is an upstream protein which transduces DNA damage to phosphorylation
of TP53. Chk2 is activated by ATM in response to double strand breaks and catalyses
phosphorylation of TP53. Raman et al., (2002) had studied that Chk2 mutations in
sporadic breast cancers are rare, but a significant proportion of such cases exhibit no or
reduced expression of Chk2.
19
HoxA5- TP53
Analysis of TP53 promoter has revealed the presence of several consensus-
binding sites for the homeo box protein HoxA5. In most of primary breast carcinomas,
expression of HoxA5 is significantly reduced. This is attributable to aberrant methylation
of the Hox A5 promoter (Levine and Oren, 2009).
Changes in TP53 transcriptional target genes:
14-3- 3σ - TP53
Changes in TP53 transcriptional target genes also affect the tumoregenesis
process. One such gene is 14-3- 3σ. This gene was originally identified in squamous
epithelium and down regulated in breast cancer cell lines. It is a direct transcriptional
target for TP53 and helps in maintenance of a G2 checkpoint. Analysis in primary breast
carcinomas showed that despite the absence of intragenic mutation, 14-3- 3σ reveled
methylation-dependent silencing in a very high proportion of cases (Ferguson et al.,
2000).
MDM2 - TP53
An important gene whose expression is directly up regulated by wild-type TP53 is
MDM2. Amplification and overexpression of MDM2 causes TP53 inactivation, but
amplification of MDM2 is not frequent in breast cancer (Quesnel et al.,1994).
p21Waf1 - TP53
p21Waf1 (also known as Cip1) is an inhibitor of the cyclin dependent kinases and
is directly induced by TP53. The Waf1 gene is not a frequent target for mutational
inactivation in breast cancers (Lukas et al.,1997).
PIG8- TP53
One of the most commonly deleted chromosomal regions in breast cancer is
11q23-q25. It contains a number of tumor suppressor loci, including ATM, Chk1 and
PIG8. The important gene is PIG8, a mediator of TP53 dependent apoptosis (Gentile et
al., 2001). So the any change in PIG8 causes impaired apoptosis in breast cancer.
20
Changes in TP53 co activators:
ASPP - TP53
Cofactors stimulate one or more of the wild-type properties of TP53. One such
family with possible involvement in breast cancer is ASPP. Two members of this family
(ASPP1 and ASPP2), are recently described. Expression of either ASPP1 or ASPP2
stimulates the pro-apoptotic function of wild-type TP53 by increasing TP53- dependent
induction of apoptotic effectors such as Bax and PIG3, while expression of non-apoptotic
proteins like p21Waf1 was much less affected. In primary breast cancers lacking TP53
mutation, expression of both ASPP1 and ASPP2 was reduced (Samuels-Lev et al., 2001).
BRCA1 - TP53
Another transcriptional coactivator for TP53 is BRCA1. BRCA1 gene on
chromosome 17q21 comprises about 100 kb of genomic DNA around the marker
D17S855 at 17q21.1 and consists of 24 exons, 22 of which encode a protein 1863 amino
acids long (Miki et al., 1994). The protein has a zinc-finger motif close to the N-
terminus. BRCA1 loss or mutation is highly associated with hereditary breast and ovarian
cancer (Rashid et al., 2006). Altered levels of BRCA1 expression are frequently found in
sporadic forms of breast cancer Malik et al. (2008), suggesting that control of BRCA1
transcription may also play a significant role in tumorigenesis (Siervi et al., 2010). As it
is a transcription factor gene and by ChK2 cascade it interacted with TP53 pathway
(Fig.14). The high proportion of breast and ovarian tumors from BRCA1 patients have
TP53 mutations, so loss of the TP53 checkpoint may further contribute to their tumor
genesis (Soussi et al., 1994; Crook et al., 1997; Xu et al.,1999).
Although somatic mutations in BRCA1 have not been described in sporadic breast
cancer but it is well known that germ-line mutations in BRCA1 causes breast and ovarian
cancer. Marin et al. (2000) have observed the frequency of deleterious TP53 mutations in
172 breast cancer families which have already BRCA1 and BRCA2 mutations. Greenblatt
et al. (2001) reported that patients having both TP53 and BRCA gene disorders have
mutations at A:T base pairs due to influence of DNA repair abnormalities.
21
Fig. 14. Relationship between BRCA1 and TP53 gene signaling pathway
So it may be suggested that BRCA1/BRCA2 function influences the type and
distribution of TP53 mutations seen in breast cancer (Gasco et al., 2003). According to
Blackwood and Weber (1998) and Crook et al. (1998), families with multiple cases of
early-onset of breast and ovarian cancers often carry mutations in tumour suppressor
genes, BRCAI (Chromosome #17) and BRCA2 (chromosome #13).
BRCA2- TP53
BRCA2 encodes a protein of 3418 amino acids. BRCA2 is composed of 27 exons
distributed over 70 kb of genomic DNA (Connor et al., 1997). The highest levels of
expression of BRCA2 have been found in breast. Friedman et al. (1998) and Lee et al.
(1999) also found the involvement of BRCA2 in tumor genesis but no direct relation of
TP53 and BRCA2 had been seen.
According to Bertwistle and Ashworth (1998) the majority (90%) of familial
breast cancers were found due to involvement of high penetrance genes BRCA1 or
BRCA2. Knudsen (1971) suggested that as the sporadic or germline mutations are found
important for most cases of familial breast cancer due to involvement of tumors
suppressor genes (e.g., BRCA1, BRCA2, TP53), so the model for the development of
22
tumors which was proposed by Knudson in his two-hit mutation theory get importance.
According to that theory, “germline loss-of-function mutation is inherited in one allele of
the gene and this is then followed by a second mutation involving a deletion or loss of
function in the remaining normal (wild-type) allele, which then initiates the path to
tumourigenesis”.
TP53 family members in breast cancer
Two structural and functional homologues of TP53 (p63 and p73) have been
described. Exclusive expression of p63 has been studied in myoepithelial cells of breast
cancer. Mutations in p73 are uncommon in human neoplasia, overexpression of p73. The
association of p73 with lymph node metastasis, vascular invasion and high-grade
malignancy is also studied (Dominguez et al., 2001).
2. The TP53 pathway in breast cancer by TP53 mutations
TP53 mutations are found in about 50-55% of all human cancers except breast
cancer (20%) (Hollstein et al., 1994). Most of these mutations are missense and found in
DNA binding sequence area which is important for its tumor suppressor function. The
pattern of missense mutations is important in deciding the status of prognosis in different
cancers (IARC, 2011). According to Petitjean et al. (2007) the intrinsic mutagenicity rate,
loss of transactivation activity and dominant negative activity are the important driving
forces that decides the TP53 mutation pattern.
According to Friedlander et al. (1996) some TP53 mutant proteins can activate
TP53 responsive sequence in the p21 gene (G1 arrest) but not usually the bax gene
(apoptosis). According to Levine (1997), in some cancers, MDM2 gene (an inhibitor of
TP53 transcriptional activation) gets amplified and effects TP53 cascade. The cancer
patients having genetic background of cancer are also important in getting TP53 gene
mutations. Soussi et al. (1994) has reported that four hot spots (codons 175, 248, 249 and
273 in 5-8 exons) contain 28% of all mutations. According to the Andersen et al. (1993),
more than 70% of TP53 mutations are related to 5-8 exons but not hot spot mutations and
about 4.4% of these mutations have been reported only once and their significance needs
to be analyzed.
23
Sporadic mutations by TP53 gene
The occurrence of missense mutations is more common in TP53 gene. Sporadic
mutations of TP53 gene are related to specific carcinogen exposure like tobacco smoke,
aflatoxin and UV etc. Soussi et al. (1994) has observed that TP53 is biological marker of
cancer in certain populations. While Crawford (1983) and Cho et al. (1994) has observed
that mutations in TP53 gene are derived from endogenous processes e.g., from errors
occurring during the various biological processes linked to DNA metabolism. The non-
mutated allele is usually lost. Due to presence of TP53 gene mutations only in tumour
tissue and its absence in healthy tissue from the same patient, Ory et al. (1994) has
suggested that TP53 mutations are truly deleterious and can inactivate TP53 function.
Rossner et al. (2009), has studied that the spectrum of sporadic mutations in
breast cancer is similar to that of other cancers, with less G:C to T:A transversions, and
more A:T to G:C transitions. It was observed in same studies that the frequency of TP53
mutations in breast cancer is related to geographical location, the environmental factors
and ethnicity. Deletions in TP53 gene of breast cancer patients of Japan and higher
frequency of transitions in African-American women had been reported (IARC, 2011).
TP53 and hereditary breast cancer
Hereditary breast cancer accounts for only 5–10% of all cases. Bennett et al.
(2000) has reviewed the population based studies of breast cancer and found that TP53
germline mutations are present in less than 1% of cases, even at young ages. Anderson
(1974) has postulated that the first degree relatives of affected individuals have a
considerably increased risk of breast cancer, and this risk is further increased by an early
age presence of the disease. Additionally, the susceptibility to breast cancer occurs
through both paternal and maternal lines and risk increases according to the number of
relatives affected. The involvement of different types of familial breast cancer genes had
been shown in Table I (page 5). Bennett et al. (2000) and Bertwistle and Ashworth
(1998) reviewed that the majority (90%) of familial breast cancer is due to the BRCA1 or
BRCA2 genes. The germline mutations of high risk cancer genes such as PTEN, TP53
and HNPCC-related genes are quite rare. Malkin et al. (1990) has reported the
association of TP53 gene with a rare Li-Fraumeni syndrome (LFS), an autosomal
24
dominant cancer syndrome in which gene carriers have a high risk of sarcomas in
childhood, breast cancer, brain tumors, leukemia and adrenocortical carcinoma. LFS was
first reported by Li and Fraumeni in 1969. Lavigueur et al. in 1989 and Patel and
Sakamoto in 2006 have reported the LFS incidence in the general population of America
which is rare. Each year, about 5-10 cases of soft tissue sarcoma occur per 1 million
children younger than 15 years. Li et al. (1992) observed no evidence for involvement of
a specific ethnic group for LFS or some frequency based on nationality. Birch et al.
(1994) observed that the probands in LFS families are mostly males diagnosed with soft
tissue sarcoma.
Malkin et al. (1990) reported that in comparison with general population, children
in families with LFS who survive an initial cancer have 83 times more risk of developing
a second cancer. Chances of developing a second cancer are 57% at 30 years after
developing the first cancer. The features of classical LFS are found in very small no, of of
families. Germline mutations of TP53 are present only in a very small number of familial
breast cancer cases outside LFS. Bell et al. (1999) has studied the presence of breast
cancer in LFS which is usually at a very early age (20–30 years) but germline mutations
were not related to the TP53 but Chk2 gene, the gene directly phosphorylates the site
where TP53 binds to Mdm2. This process prevents Mdm2 inhibition of TP53, increasing
the TP53’s stability and enhancing its DNA repairing role in response to DNA damage.
TP53 gene polymorphisms
Polymorphisms are variations in TP53 DNA sequence that have been found in
unaffected human populations. Most of TP53 polymorphisms are located in introns,
outside consensus splicing sites. The functional consequences of most of these single
nucleotide polymorohisms (SNPs) are unknown. Theoretically, they may affect TP53
protein function through enhanced mutability due to altered DNA sequence context,
increased splicing events and tissue-specific expression. According to the database IARC
(2011), as the protein of some intronic polymorphisms has not been described yet so
these polymorphisms are marked by their coding descriptions like intron 1 (c.1-10673
T>C, Hahn et al., 1993), intron 2 (c.74+ 38 C>G, Pleasants and Hansen, 1994), intron 3
(c96+41_96+ 56 del 16, Lazar et al., 1993), intron 6 (c.672+ 31 A>G, Peller et al.,1995),
25
intron 7 (c 782 + 72 C>T, Prosser and Condie,1991), intron 10 (c 1100 + 30 A>T, Buller
et al.,1995).The polymorphisms having defined proein description are codon 21 ( Ahuja
et al., 1990), codon 36 (Felix et al., 1994), codon 213 (Serra et al., 1992) and codon 47
(Felley-Bosco et al., 1993). Codon 72 (Arg/Pro) polymorphism has been reported to have
wide implications (Ara et al.,1990).
Among all these polymorphisms, three have been extensively studied (Whibley et
al., 2009). The Ser47 variant is a rare polymorphism in codon 47. which replaces the
proline residue necessary for recognition by proline-directed kinases. This polymorphism
is functionally significant and shows a decreased ability to transactivate two TP53 target-
genes, p53AIP1 and PUMA, but not other TP53 response genes, and to induce apoptosis
(Li et al., 2002). The intron 3 duplication has been found to be associated with increased
risk of colorectal cancer in a case-control study and correlated with a reduced level of
TP53 mRNA in lymphoblastoid cell-lines (Lazar et al., 1993).
The third most studied polymormphism of TP53 gene is of codon 72 which is
located within the proline-rich region. Due to codon 72 polymorphism, three varients are
observed in humans. Which are arg/pro, pro/pro and arg/arg. Although the protein with
arg/arg was reported to be more efficient in inducing apoptosis than the one with the pro
variant however, ethnic differences influenced the codon 72 allele frequencies (Ara et al.,
1990; Delacalle-Martin et al., 1990).
In the Northern hemisphere, the pro allele shows a North-South gradient, from
0.17 in Swedish Saamis to 0.63 in African Blacks (Beckman, 1994). In Western Europe
(France, Sweden, and Norway), North America (USA), Central and South America
(Mexico, Costa-Rica, Peru) and Japan, the most common allele is Arg72, with
frequencies ranging from 0.60 to 0.83. However, frequencies of Pro72 superior to 0.40
have been observed in African-Americans (Jin, 1995). A study suggests that these
latitude-dependent variations may be due to selection related to winter temperature and
not to UV radiation. Shi et al. (2009) observed that low average temperature, but not UV
radiation, was associated with high frequency of Arg72 in Eastern Asia.
IARC (2011) has provided the data for proving the significant association
between the codon 72 polymorphism and risk of cancer, although the results with regard
to most cancers, including breast are still under observation. According to Olschwang et
26
al. (1991) the arg/pro polymorphism is located in a proline rich region (residues 64–92)
of the TP53 protein. The region is involved in growth suppression and apoptosis
mediated by TP53 but not for cell cycle arrest. The two polymorphic variants of wild-
type TP53 have some different biochemical and biological properties (Table II).
Table II : Comparison of the biological activities of the two polymorphic TP53 (Olschwang, 1991). Properties TP53 arg 72 TP53pro72
Sensitivity to HPV protein E6 Sensitive Resistant
Induction of apoptosis High Moderate
Interaction with p73 (in the case
of mutant p53)
High Low
Association with response to
treatment
Poor Better
Interaction with transcriptional
machinery
Low High
Transactivation Moderate Higher
DNA binding Identical Identical
According to Beckman et al. (1994) the distribution of this polymorphism in the
general population is heterogeneous with a frequency of the Pro/Pro haplotype of 16% in
Scandinavian populations and 63% in Nigerian populations. The reason for this
North/South gradient is unknown at the present time. Many studies have investigated
whether one of the haplotypes could be associated with a higher susceptibility to develop
cancers. The results of these studies are very contradictory and have not demonstrated
any highly significant findings.
Progression in research on TP53
Crawford et al. (1981) discovered TP53 in 1979 as a protein which forms
oligomeric complex with the T antigen in the SV40 transformed cells and was considered
as an oncogene (Levine et al., 1991). Later on it was demonstrated that only the mutant
forms of TP53 had transforming properties and the gene was involved in the spectrum of
human cancers. These findings ranked this gene as tumor suppressor gene (Caron-de-
Fromentel and Soussi. 1992). First human TP53 gene was cloned by Matlashewski et al.
27
(1984). Maltzman (1984) demonstrated that TP53 is effected by UV damaged DNA.
Kaston and Kuerbitz (1993) reported the role of TP53 in signal transduction that helped
cells respond to cell damage. According to IARC (2011) TP53 has passed the following
journey from its discovery to 2010.
1979: Discovery of TP53 gene.
1983: TP53 was defined as an oncogene.
1985: Cloning of human TP53 gene.
1989: Wild type TP53 is defined as tumor suppressor.
1990: TP53 is found mutated in Li-fraumeni syndrome.
1990: TP53 is found as transcription factor.
1991: TP53 induces apoptosis.
1992: TP53-/- mice develop tumor spontaneously.
1993: TP53 is associated with worse prognosis in breast cancer.
1994: Discovery of crystal structure of TP53 with DNA.
1996: Hypoxia induces TP53.
1997; Role of Mdm2 with TP53 is discovered in mice.
1997: First TP53 associated gene TP73 is discovered.
1999: 10,000 TP53 mutations are described in human.
1999: TP53 plays role in cell repair.
2002: TP53 accelerates aging in mice.
2002: N-terminally truncated variant of TP53 discovered.
2003: Role of TP53 in remodeling of chromatin.
2004: Wild and mutant TP53 is targeted in gene therapy.
2005: Nine isoforms of TP53 are described.
2006: Direct role of TP53 in metabolism is discovered.
2007: TP53 regulates micro RNA.
2008: A dual role of TP53 in autophagy is discovered.
2009: Deficiency of TP53 plays an important role in cellular reprogramming
and stem cell production.
2010: The isoform D133P53 is directly transactivated by TP53 mediated apoptosis
28
Status of breast cancer research in Pakistan
Islamic Republic of Pakistan is an agricultural country. The administrative
divisions of the country are 4 provinces (Sindh, Punjab, Baluchistan and Pakhtoonkhua),
a territory (Federally Administered Tribal Area), 1 capital territory (Islamabad), and the
Pakistani administered portion of the Jammu and Kashmir region (Azad Kashmir and the
Gilgit-Baltistan).The estimated population of Pakistan is 162,419,946, with an annual
population growth rate of 2.03% (CIA, 2005).
Breast cancer is the most frequent cancer of women in Pakistan. The rate of breast
cancer in Pakistan is the highest in Asia, except for the Jews in Israel. Reproductive
factors as early marriages, multiple births and prolonged breast-feeding are the norm.
Early menarche, late menopause are the possible risk factors along with dietary factors
and obesity. The roles of BRCA1, BRCA2 and other genetic factors have not been
adequately studied in this population (Bhurgri et al., 2006).
Sohail and Alam (2007) reported that about one in every nine Pakistani women is
likely to suffer from breast cancer incidence. The incidence of breast cancer rate in
Pakistani women is higher as compared to the neighboring country India with similar
socio-cultural background; which may be due to the differences in diet, racial or genetic
factors. Mamoon et al. (2009) has compared the status of breast cancer of three decades
in Pakistan and observed that the age of presentation of cancer to doctor remains younger
as compared to the Western countries, decreasing tumor size due to relatively earlier
presentation in some cases, but no specific guidelines were given to the patients for early
presentation.
In absence of proper cancer registry system in Pakistan, the exact number of
patients is not known. However from the reports of research groups working in some
developed urban areas of Pakistan.Most of the work in Pakistan has been done on
determining the incidence rate, risk factors and clinico-pathological study of breast
cancer. A small number of reported works shows the research on molecular and genetic
aspects of breast cancer in Pakistan (Mamoon et al., 2009).
Kakarala et al. (2010) found that the incidence of breast cancer is higher in
Indian/Pakistani women as compared to Caucasians. According to Ahmad et al. (1991)
and Usmani et al. (1996) breast cancer is the most common malignancy in Pakistani
29
women, with an incidence of 15 –26% in the 30 to 49-year-old age group. The highest
incidence of breast cancer is reported from Karachi (Sindh province), the major city of
Pakistan (Bhurgri et al., 2000). According to the website of Shaukat Khanum Memorial
Cancer Hospital 92011) situated in Lahore, Punjab (the second biggest city of Pakistan)
the incidence of breast cancer is highest (24.18%) of all other cancers. Aziz et al. (2003)
from southern Punjab also shows the highest incidence of breast cancer in female breast
cancer patients. Zeb et al. (2008) reported high frequency of breast cancer from
Pakhtunkhua province of Pakistan. The reported work of Hussain et al. (2008) and Hanif
et al. (2009) also confirmed the given results from Pakhtunkhua province.
No study on incidence of breast cancer has been reported from Pakistani
administered portion of the Jammu and Kashmir region (Azad Kashmir), Balochistan and
the Gilgit-Baltistan. From Islamabad, Faheem et al. (2007) has studied the risk factors for
breast cancer in women who attended Nuclear Medicine, Oncology and Radiotherapy
Institute (NORI) hospital, Islamabad. A total of 150 female breast cancer patients were
included in the study. It was concluded that lack of breast-feeding, less parity, and
smoking are most significantly associated with breast cancer in females of Islamabad.
Breast cancer risk factors reported from capital city of Pakistan are comparable to
Western countries probably due to topographical factors and life style resemblance.
Different risk factors are considered liable for highest incidence of breast cancer
in Pakistan. According to Gilani and Kamal (2004) obesity in pre-menopausal women,
late menarche and consanguinity are the risk factors for breast cancer in Pakistani women
having age less than 45 years. Aziz et al. (2004) found a strong association between low
socio economic status, delay in diagnosis and limited access to doctors with advance
stage of cancer.
The paradigm of risk factors, which are seriously effective in western countries
are working inversely in Pakistan. Old age, family history, use of contraceptive, hormone
replacement therapy, exposure to radiation, alcoholism, smoking, higher socioeconomic
class, nulliparity, non breast feeding and unmarried females are considered as more prone
to breast cancer in West but clinico-pathologically the tumor status is not worse (Hall et
al., 2005).
30
In Pakistan however, most of the patients were reported in early age and were
sporadic cancer with no family history. Use of contraceptives, hormone replacement
therapy, radiation exposure, alcoholism and smoking is not common. Breast cancer
patients are usually of lower socioeconomic background. Mulltiparity, breast feeding and
marriages are in vogue. Clinico-pathologically patients came in last stages of cancer on
their first visit to oncologist. Usmani et al. (1996) had reported that most of the patients
came to see doctor when the size of the tumor was greater than 5 cm (66%) in grade III,
the morphological type of cancer was invasive ductal carcinoma (58%) and lymph node
metastases were present in 73% of the patients. They reported that 30-39 years is the peak
age of breast cancer incidence in Pakistani women. Most of the patients are multiparous
with an average of five children.
Ahmed et al.(1997) had carried out a retrospective study of breast cancer on 193
cases that were divided into 2 groups i.e. less than and more than 50 years age groups. In
the former group, 93% tumours were of grades II or III and approximately 51% were
estrogen receptors negative. In more than 50 years age group, 75% tumors were in grade
II and III, with almost 37% being estrogen negative tumors. Majority (75%) of the
patients had over 6 cms lump with equal number having positive lymph node status. All
these factors pointed to the fact that besides presenting late, the Pakistani population has
additional unfavourable prognostic factors.
The epidemiological and clinicopathological study of breast cancer patients in
Pakistan is done by Malik et al. (1992) reported the same results. In western countries, a
sharp increase in the detection of breast carcinoma, due to widespread use of
mammography, has led to a fall in breast cancer severances and mortality (Ahmed et al.,
2009).
The analysis of breast cancer patients data from two authentic institutes of cancer
treatment showed that (71% patients of Institute of Nuclear Medicine of Lahore and 63%
of Shaukat Khanum Memorial Cancer Hospital) presented in grade III and IV of breast
cancer due to lack of awareness of early detection of breast cancer (Gillani et al., 2003).
It is also confirmed by some other researchers that in Pakistani females, breast carcinoma
occurs at a younger age group with large size tumors at the time of first visit to doctor
and had frequent axillary lymph node metastasis. Infiltrating ductal carcinoma was the
31
most common type of tumour with predominance of high grade lesions (Siddiqui et al.,
2000, Malik 2002 and Ahmad et al., 2009).
Usmani et al. (1996) worked on epidemiology of breast cancer in 595 pregnant
and lactating women. They had reported that 61 patients who were pregnant or lactating
came to visit doctor first time at a late stage (70% in grade III) of disease because of
ignorance, social taboos, or fear of hospitalization and operation. The largest diameter of
the breast mass at presentation was 15 cm. Lymph nodes were involved in 70.5% of
cases. Multiparity, young marriages, malnutrition, and unhygienic conditions are ripe in
the rural environment of Pakistan. No oral contraceptives are used. Modern and
conventional methods of treatment did not increase the survival rate of these cancer
patients. Women delayed seeking medical evaluation because of their fears of disease,
disfigurement, and rejection by their husbands. Also implicated were a lack of training in
breast self-examination and the belief breast enlargement resulted from engorgement.
Despite modern treatment methods (mastectomy, radiation, and chemotherapy), the
median survival time was under 36 months in both groups. A survival analysis of
metastatic breast cancer in Pakistani patients was done by Siddiqui et al. (2000) and
noted that overall median survival was 2.83 years. Survival analyses of breast cancer
patients was done at Shaukat Khanum Memorial Cancer Hospital, Lahore, Pakistan by
Badar et al. (2005) and applied the Wilcoxon statistics for testing the equality of disease-
free survival distributions between groups of patients with tumor size greater than 5
versus less than or equal to 5 cm. For overall survival descending order was found with
the increased tumor diameter and nodal involvement. The work of Maqsood et al. (2009)
revealed that the lack of awareness regarding breast cancer and its screening practices are
main factors of worse situation of breast cancer in Pakistan.
Influence of the genetic and molecular factors on incidence of breast cancer has been
studied by some research groups. Liede et al. (2002) had studied the contribution of
BRCA1 and BRCA2 mutations to breast and ovarian cancer in Pakistan. To explore the
contribution of these genetic factors they have conducted a case-control study of 341 case
subjects with breast cancer. Female control subjects were from two major cities of
Pakistan (Karachi and Lahore). The prevalence of BRCA1 or BRCA2 mutations among
case subjects with breast cancer was 6.7%. Mostly mutations were unique to Pakistan.
32
Five BRCA1 mutations (2080insA, 3889delAG, 4184del4, 4284delAG, and IVS14-1A--
>G) and one BRCA2 mutation (3337C-->T) were found in multiple case subjects and
represent candidate founder mutations. The penetrance of deleterious mutations in
BRCA1 and BRCA2 is comparable to that of Western populations. These results suggest
that recessively inherited genes may contribute to breast cancer risk in Pakistan.
Prevalence of BRCA1 and BRCA2 mutations in Pakistani breast and ovarian cancer
patients was also observed by Rashid et al. (2006). The prevalence of BRCA1 or BRCA2
mutations was 42.8% for families with multiple cases of breast cancer, and was 50.0%
for the breast/ovarian cancer families. The prevalence of mutations was 11.9% for single
cases of early-onset breast cancer and was 9.0% for single cases of early-onset ovarian
cancer. There findings showed that BRCA mutations account for a substantial proportion
of hereditary breast/ovarian cancer and early-onset breast and ovarian cancer cases in
Pakistan.
Contribution of BRCA1 germline mutation in patients with sporadic breast cancer of
Pakistan was studied by Malik et al. (2008). From the sequence analysis no germline
mutation, one novel splice site mutation at exon 13 and five missense mutations were
detected. Rashid et al. (2008) has found no association of miscarriage and BRCA carrier
status in Pakistani breast/ovarian cancer patients with a history of parental consanguinity.
Rashid et al. (2008) has also found no association between BRCA mutations and sex ratio
in offspring of Pakistani BRCA mutation carriers.
TP53 gene studies in Pakistan
Due to alarming rate of breast cancer increase, molecular and genetic aspects of
breast cancer has been also studied in Pakistan. The prevalence of polymorphisms and
haplotypes of TP53 in Pakistani ethnic groups has been studied by Khaliq et al. (2000).
They also have investigated TP53 gene mutation (4-9 exons) in forty-one breast cancer
patients. The three biallelic polymorphisms studied in the TP53 gene were 16-bp
duplication in intron 3 and BstU I and Msp I restriction fragment length polymorphisms
in exon 4 and intron 6. The absence of the 16-bp duplication was recorded highest in the
Hazara; Msp I A1 allele frequency was higher in Makrani peoples. The absence of the 16-
bp duplication in combination with the BstU I pro and absence of Msp I restriction site
33
were observed in cancer patients. In the breast cancer patients, ten substitution mutations
were detected in the TP53 gene. The correlation of TP53 mutations with
clinicopathological presentation in seventy-four females with breast cancer has been
studied by Khaliq et al. (2001). Age, tumour size, nodal status and histopathology
assessed in patients with and without TP53 mutations were studied. It was found that ten
patients showed TP53 mutations in their tumor specimens while sixty-four had normally
functioning TP53 gene. Patients were divided into two groups, A (normally functioning
TP53), and B (mutated TP53). Intraductal carcinoma was found most frequent in group
A, while lymph nodes were involved in 67.19% in group A and 60% in group B. The age
of patients and clinical parameters (tumour size, nodal status and histopathological
diagnosis) were compared between the two groups and no statistically significant
correlation between TP53 mutations and clinicopathological parameters was found.
Immunohistochemical staining is considered an important tool for seeing the TP53
expression. This technique also provides help in detecting subgroups of those breast
carcinoma patients who are at high risk for decisions regarding chemotherapy. Some
researchers in Pakistan have used this technique for understanding the status of TP53 in
Pakistan. Aziz et al. (2001) had studied the relationship of TP53 expression with
clinicopathological variables and disease outcome in breast carcinoma patients. They
studied the expression of TP53 protein immunohistochemistry in 315 patient's tumour
specimens of infiltrating ductal carcinoma of breast from 1992 to 1997. These patients
also had axillary lymph nodes sampling. Axillary lymph node metastasis had found
significantly correlated with positivity of TP53 expression. Over expression of TP53 was
not proved as an independent prognosis marker. Bukhari et al. (2008) had reported a new
TP53 immunohistochemistry (IHC) scoring system. They concluded that the newly
proposed TP53 IHC scoring system will help histopathologists in making their
differential diagnosis among benign, premalignant, and malignant tumors. The
relationship of immunohistochemistry and scores of altered TP53 protein expression was
found closely related to the habits of the patients and histological grades and stages by
Bukhari et al. (2009) who worked on squamous cell carcinoma patients of Pakistan.
Estrogen and progesterone receptor and TP53 expression relation has been studied in
male breast carcinoma of Pakistani patients by Jamal et al. (2009). They reported that 45
34
cases of male breast carcinoma, including all the histological subtypes were assessed with
original pathology reports of each case investigated for the age, laterality of breast,
histological type of tumour and tumour grade. Tumour blocks of each case were retrieved
for immunohistochemical staining of estrogen and progesterone receptors and TP53
expression. According to their study majority of the cases were above 65 years of age,
invasive ductal carcinoma was the predominant carcinoma, estrogen- progesterone (ER
and PR) receptor was found positive in 95.5% of the cases and in 77.7% of the cases
TP53 gene expression was positive.
Except in Li faumeni syndrome families, TP53 gene mutations are not very frequent
in germline breast cancer cases. Ginsburg et al. (2009) have studied the TP53 gene
mutations in germline breast cancer patients of Pakistan. The entire TP53 gene was
screened in the germline DNA from ninty-five women of Pakistan, who were diagnosed
with breast cancer before age 30, and had previously been found to be negative for
BRCA1 and BRCA2 mutations. No TP53 mutation was found.
Status of TP53 gene mutations in other carcinomas had also been studied in Pakistan.
Ali (2009) has searched out the human papiloma virus association and TP53 mutation in
oral cavity cancer (squamous cell carcinoma) of Pakistani patients. A disrupted cell cycle
progression of hepatocytes was reported by Sarfraz et al. (2008) in chronic hepatitis C
virus (HCV) infection. Archival liver biopsy specimens of chronic HCV-infection of
fourty-six patients and five normal persons were analyzed by immunohistochemistry
using antibodies against proliferation marker Mdm-2, G1 phase marker Cyclin D1, S
phase marker Cyclin A, cell cycle regulators p21 (CDK inhibitor) and TP53 (tumor
suppressor protein), apoptotic protein Caspase-3 and anti-apoptotic protein Bcl-2. They
found an arrested cell cycle state in the hepatocytes of chronic HCV infection, regardless
of any association with genotype 3. They studied that cell cycle arrest is characterized by
an increased expression of p21, in relation to fibrosis, and of TP53 in relation to
inflammation. Furthermore, expression of p21 was independent of the TP53 expression
and coincided with the reduced expression of apoptotic protein Caspase-3 in hepatocytes.
The altered expression of these cell cycle proteins in hepatocytes which is suggestive of
an impaired cell cycle progression, could limit the regenerative response of the liver to
ongoing injury, leading to the progression of disease.
35
Present study
As the nature of TP53 mutations gives clues on the mechanisms that might have
caused the mutation and the presence of a TP53 mutation may provide information of the
tumor response to treatment and patient survival. In the absence of any previous
comprehensive study on TP53 gene mutations in breast cancer patients of Pakistan, it is
important to comprehensively investigate the prevalence of TP53 gene mutations and
codon 72 polymorphism in breast cancer patients of Pakistan. The present study aims at
determining the frequency of Sporadic TP53 mutations and codon 72 polymorphism
among the Pakistani breast cancer patients reporting at Shaukat Khanum Memorial
Cancer Hospital and Mayo Hospital of Lahore.
36
MATERIALS AND METHODS
Questionnaire preparation for patients and determining the status of mlecular
epidemiology
Every subject, recruited in this study was required to fill in a consent form
indicating his/her free willingness for participation in this study. A comprehensive
questionnaire aimed at collecting relevant information for epidemiological studies was
also required to be filled in by each participant. Some time the questionnaire was filled in
by research staff, based upon the information provided by the subject. A sample
questionnaire is given in appendix 1.
Subjects
One hundred female breast cancer patients were recruited at Shaukat Khanum
Memorial Cancer Hospital & Research Center, Lahore and fifty patients were recruited at
Mayo Hospital, Lahore, Pakistan, from January 2005- December 2008. The median age
of the patients was 40 years (range 18-65). From all the participants of this study, a blood
sample, normal breast tissue and tumor breast tissues were collected. Besides the above
sporadic breast cancer patients, three families, two from Lahore and one from Multan
were also included in the study. Fifty normal females, ranging from 18-65 years of age
were also included in this study for comparison purpose. These blood samples were
collected randomly from normal females belonging to different areas of Pakistan.
Sample preservation and transport
Blood samples (5-10 ml) were collected and transported to the laboratory in the
School of Biological Sciences in ice boxes at 4°C. The tissue samples (0.2-1g) were
collected in Eppendorf tubes (1.5ml)) and then immediately frozen in liquid nitrogen. The
frozen samples were transferred to the laboratory in dry ice boxes where they were
preserved at -70 °C until further processed.
Processing of stored tissue and blood samples were processed for isolation of
genomic DNA, PCR amplification of different regions of TP53 gene, Temporal
Temperature Gradient Gel Electrophoresis (TTGE), Restriction Fragment Length
37
Polymorphism (RFLP) and sequencing. Further analysis was done on the basis of
bioinformatics of IARC, R15 provided by International Agency for Research on Cancer.
Pedigrees of families included in the present study
Blood samples were collected from the families having incidence of breast cancer
in the family. Numbering of icons is according to the blood samples taken from the
patients and processed.
Family no. 1
Blood samples were taken from seven members of family no 1, belonged to
Lahore, which was extensively prone to breast cancer (Fig. 15).
Fig. 15. Pedigree of familial breast cancer patient of family 1 Square, male; Circle, Female. The solid icons represent the breast cancer patients. No. 1 represents 30 years old female with breast cancer, who married her 40 years old first cousin (#7).
Family no. 2
The blood samples of members of family 2, suffering from breast cancer (Fig.16)
and as belonging to Lahore, were collected for analysis.
Fig. 16. Pedigree of familial breast cancer patient of family 2. The pedigree of a family showing Breast ancer. Relationship of numbering is 1, daughter (40 years) and 2, mother (70 years).
38
Family no. 3 During data collection, I came across a family belonging to Multan having Li-
Fraumeni syndrome (LFS) like characteristics (Fig. 17). The spectrum of tumors, early
age of cancer onset and pathology reports were strongly suggestive of the Li-Fraumeni
syndrome.
Fig. 17. Li. Fraumeni Syndrome like characters in Family 3.: 1 is mother of five children, four
daughters and one son, of which two daughters died at the age of 4 years (e) with brain tumor and the other
at the age of 18 years (d) with soft tissue sarcoma metastasized as breast cancer. Blood was taken from two
daughters (2, 3) and a son (6). Blood samples were taken from three daughters (4, 5, 7) of (a) who died at
the age of 25 years with brain hemorrhage. Out of five daughters of (b) who died at the age of 40 years with
myocardial infection) two (8, 9) were available for sampling.
= normal male; = normal female; = died with (a) brain hemorrhage, (b) myocardial
infarction and = died with cancer (c): brain tumor, (d): soft tissue sarcoma metastasized to breast, (e):
brain tumor.
The following criteria were also used to further confirm the syndrome (Li and
Fraumeni, 1969, 1988). (i) A proband diagnosed with sarcoma when younger than 45
years, (ii) A first-degree relative with any cancer diagnosed when younger than 45 years,
and (iii) Another first- or second-degree relative of the same genetic lineage with any
cancer diagnosed when younger than 45 years or sarcoma diagnosed at any age.
6
39
DNA isolation
From blood samples (Grimberg et al., 1989)
One volume of buffer A (Red blood cell lysis buffer: 0.32 M sucrose, 10 mM Tris
HCl, 5 mM MgCl2, 0.75% Triton-X-100 pH adjusted at 7.6) was added to one volume of
blood and two volumes of cold, sterile, distilled, deionised water, vortexed gently and
incubated on ice for 2-3 minutes. The mixture was spun at 3500 rpm for 15 minutes at
4oC, the supernatant was discarded in 2.5% bleach solution and the pellet re-suspend in 2
ml of buffer A and 6 ml of water, centrifuged at 3500 rpm for 15 minutes at 4oC. 5 ml of
Buffer B ( 20 mM Tris-HCl, 4 mM Na2EDTA, 100 mM NaCl, pH adjusted to 7.4) and
500 µl of 10% SDS was added to pellet. Pellet was resuspended by vortexing vigorously
for 30-60 seconds. Then 50 µl of Proteinase K solution (20mg/ml) was added and then
incubated at 55oC for two hours in a water bath. The samples were cooled to room
temperature and then 4 ml of 5.3 M NaCl solution was added, vortexed gently for 15
seconds, spun at 4500 rpm for 15-20 minutes at 4oC. The supernatant was poured off into
a fresh tube, and an equal volume of cold isopropanol (stored at -20oC) was added. The
tubes were inverted 5-6 times gently to precipitate DNA. The DNA was removed with a
wide bore tip, transfered to a microfuge tube, and washed with 1 ml of 70% ethanol was
left to dry for 15-20 minutes at 37oC, suspended in 300-400 µl of Tris HCl, pH 8.5 and
left to re-dissolve overnight at room temperature. DNA was safely refrigerated.
From frozen tissue (Deb and Deb, 2003)
One gram tissue was placed in 10 ml lysis buffer (20mM Tris-HCl, pH 8.0, 5mM
ethylenediamine tetraaceticacid (EDTA), 400 mM NaCl, 1% sodium dodecyl sulfate and
proteinase K (20mg/ml) was added at 500 µg/ml. The mixture was incubated at 55oC
overnight with gentle constant mixing in a shaker. An equal volume of phenol-
chloroform-isoamyl alcohol (25:24:1) was added to the lysate, mixed gently and
centrifuged at room temperature for 5 min. at 1000x. The upper aqueous phase was
gently transferred to fresh tube to which then an equal volume of isopropanol was added.
The mixture was centrifuged at 13,000x for 15 min. The upper aqueous phase was
removed; 1ml of 70% ethanol was added to the pellet and centrifuged again. Then 70%
40
ethanol was removed and the pellet was dried in a lyophilizer. DNA was dissolved in TE,
pH 8.0 and stored at -20o C.
PCR amplification of specific region of TP53 gene
DNA isolated from blood and breast tissue was screened for TP53 mutations
using the following primers for polymerase chain reaction (Table III). Primer sequences
as reported by Sorlie et al. (2005) were used for mutation detection and those reported by
Langerød et al. (2002) were used for codon 72 polymorphism detection.
Table III. Primers for amplification of the TP53 gene
Table III. Primers for amplification of the TP53 gene
GC= cgcccgccgcgccccgcgcccgtcccgccgcccccgcccg
Amplification of the 4 different fragments representing exons 5-8, was done
according to optimized conditions given below. For 50 µl reaction mixture, following
ingredients were added in an eppendorf tube.
Ingredients Volume (µl)
Taq buffer (Fermentas)
MgCl2 (1.5mM)
dNTPs (2.5mM)
Taq DNA polymerase (5U/µl)
Genomic DNA (100ng)
Primer (F) 10 pmol
Primer (R) 10 pmol
Water
5
3
4
0.5
2
2.5
2.5
30.5
41
PCR amplification conditions for a portion of 5 and 6 exons were: 95 °C for 3
min, 94°C for 30 sec, 35 cycles each of 55 °C for 5 sec, 72 °C for 30 sec and final
extension at 72 °C 4 min. For 7 and 8 exons, the PCR conditions were 95 °C for 3 min,
94°C for 20 sec, 30 cycles each of 56 °C for 20 sec, 72 °C for 30 sec and final extension
at 72 °C for 5 min. PCR products were resolved on a 2% agarose gel and visualized with
ethidium bromide to ensure PCR amplification quality.
Mutation detection
Heteroduplex formation
For visualization of mobility difference between bands of normal and breast
cancer patients, samples in TTGE for mutation detection, heteroduplexes were formed.
PCR product (5 µl) of patient’s sample was mixed with 5 µl PCR product of normal
person’s sample and incubated in thermal cycler for 5 min. at 95 °C, 1 hour at 37 °C and
1 hour at 65 °C and then preserved at 4 °C.
Mutation detection by temporal gradient gel electrophoresis (TTGE)
In TGGE a constant denaturant gel along with a linear increase in the temperature
during electrophoresis is used for separation of PCR products. The optimal
electrophoresis conditions for separation of TP53 exons (5-8) mutants using TTGE were
determined from the theoretical melting profile calculated by the MacMelt computer
program, where the separation were at maximum, and taking into account that
temperature ramping would be performed during the electrophoretic run. The optimal
conditions determined by Alper et al. (2005) and Sorlie et al. (2005) were followed. The
stock solutions including 10% polyacrylamide/bisacrylamide, 1.75X TAE (2M Tris-
acetate, 50 mM EDTA, pH 8.0), 7M urea (210 g urea to 500 ml 1.75X TAE) and loading
buffer (0.1% bromophenol blue) was prepared. 400 µl of ammonium per sulphate (APS)
and 40 µl of TEMED (N.N.N.N-tetramethyl-ethylenediamine) were added to gel solution
just before pouring it into 16x16-cm glass plates with 1mm spacers. Two sets of plates
were used each time. 80 ml gel solution was loaded in two sets of plates (40 ml each) and
let it polymerized for about 60 min.The gel was prerun for about 15 min in the warm
buffer at 130V. PCR product (5 µl) was mixed with 5 µl of loading buffer and loaded into
42
the wells on the gel then electrophoresis was started at 130 V with the temperature range
58-70. The gels were stained in 1.75 X TAE containing 40 µl of ethidium bromaide for 5-
10 min and the bands were visualized on a UV transilluminator.
Sequencing of PCR amplified product
PCR product of the samples which showed different band mobility on TTGE gels
were sequenced for confirmation of mutations. PCR product was purified by DNA
extraction kit (Fermentas). The purified PCR product was quantified by loading the
product on 2% agarose gel. 90-120 ng of that product was loaded on the sequencing
column. The sequencing reactions were performed on an automated 377 ABI Prism DNA
sequencer using Big Dye Terminator Chemistry (Heiner et al., 1998). There are four
different dyes used to identify A, C, G and T extension reactions. Data was analyzed
using ABI sequencing analysis (v.3.41) and LASERGENE-SeqMan software.
Analysis of TP53 mutations by IARC bioinformatics tools
Following steps were involved in analysis of TP53 gene mutations by IARC
bioinformatics tools.
i) Confirmation of mutations by mutation validation tool (MUT-TP53, R15)
(Olivier et al., 2002).
ii) Reconfirmation of mutation by 2008_R2 release of the UMD_TP53
Mutation database (Hamroun et al., 2006).
iii) Analysis of world spectrum (sporadic and germline) of specific TP53
mutations which were detected in the present research
iv) Analysis of prevalence of these mutations
v) Analysis of effect of these mutations on function of protein (TP53)
vi) Analysis of effect of these mutations on structure of protein (TP53)
Detection and restriction analysis of codon 72 polymorphisms
Genomic DNA was amplified by the allele-specific polymerase chain reaction
(PCR), The PCR amplification produced a 199 bp fragment for the Pro allele and two
(113 bp + 86 bp) fragments for Arg as described by the Langerod et al. (2002). One
43
change was made in Langerod’s protocol that instead of using polyacrylamide gel
electrophoresis (PAGE), restricted fragments were visualized in 4% agarose gel which
was proved easier to handle, time saving and economic. The interpretation of bands was
done with the help of DNA ladder run along with the samples. Three types of band
patterns were observed after UV visualization of 4% agarose gel containing ethidium
bromide. Single band of 199 bp fragment size corresponded to homozygous pro
genotype, two bands of 86 bp and 113 bp fragment sizes corresponded to homozygous
Arg genotype, whereas three bands of 86 bp, 113 bp and 199 bp represented the
heterozygous arg/pro genotype. These results were in accordance with the band pattern
described by the Langerod et al. (2002).
Analysis of questionnaires for determining epidemiology of breast cancer and the
status of TP53 gene mutations in Pakistani population
The questionnaires collected from the breast cancer patients, included information
of their history, habits, epidemiological factors and clinic-pathological information which
was analyzed for determining the status of molecular epidemiology of TP53 gene.
Following steps were involved in this process:
i) The data from questionnaires (given to the patients) was transferred to
excel sheets of computer.
ii) Graphs were generated on the basis of collected data.
iii) Analysis of data and its relation to molecular epidemiology of TP53.
iv) Analysis of epidemiological factors detected in the present research in
global scenario.
44
RESULTS
Mutations in exon 5-8 of TP53 gene
The Temporal Temperature Gradient Electrophoresis (TTGE) was used for
detection of mutations in exons 5, 6, 7 and 8. All blood and tumor samples were
amplified for 190 bp band (126-160 codons) in exon 5 (Fig.18A), for 207 bp band (187-
224 codons) in exon 6 (Fig.18B), for 191 bp band (225-261 codons) in exon 7 (Fig.18C)
and for 240 bp band (262-307 codons) in exon 8 (Fig.18D) of SKH-86 and Nus-10.
A B C D
Fig. 18: Amplification of exons 5-8 of TP53 gene from two tumor samples SKH86 and NUS10. A, exon 5; B, exon 6; C, exon 7; D, exon 8. Lane M represents 50bp marker. Normal population
In present study 50 normal females, 25-60 years of age, with no breast cancer
history were selected as a control. Blood samples were proceeded for analysis of exons 5-
8 and their mutation pattern was observed by TTGE. Figure 19 shows TTGE pattern of
various exons of TP53 gene of normal subjects. There was no difference in band mobility
pattern which confirms the absence of mutation in normal samples. To confirm that there
was no mutation in normal samples, every sample was treated as follow:
i) Only PCR samples were loaded in the gel (non heteroduplexed)
ii) Samples were heteroduplexed with cancer patients sample (which was proved
negative for TP53 gene mutations in any of four exons) and then loaded on the gel.
45
A B C
D
Fig. 19. Detection of TP53 mutations in normal samples by Temporal Temperature Gradient Gel Electrophoresis (TTGE) showing no difference in band mobility pattern. A, exon 5; B, exon 6; C, Exon 7; D, exon 8 . M, 50 bp marker; 1(n), non heteroduplexed sample; 1(h), heteroduplexed sample 1; 2(n), non heteroduplexed sample 2; 2(h), heteroduplexed sample 2; 3(n), non heteroduplexed sample 3; 3 (h) heteroduplexed sample 3.
Sporadic breast cancer patients
In the present study, One hundred and fifty breast cancer patients were observed.
For comparative study, three types of samples e.g. blood, normal tissue and tumor tissue
were taken from each patient. For visualizing the difference of band mobility between
normal and mutated samples, every sample was heteroduplexed with a confirmed (by
sequencing) normal sample. In case of mutation detection two bands were observed due
to difference between patient and normal DNA pattern. Out of four exons (5-8),
mutations were detected in exons 7 and 8. The following mutations have been detected:
M 1(n) 1(h) 2(n) 2(h) 3(h) 3(n) 1(n) 1(h) 2(n) M 2(h) 3(n) 3(h) M 1(n) 1(h) 2(n) 2(h) 3(n) 3(h)
1(n) 1(h) 2(n) 2(h) 3(n) 3(h) M
46
1) TP53 mutation was detected in exon 7 of sporadic breast cancer patient,
SKH85 (Fig. 20). No mutation was detected in blood (B) and normal tissue (N) of this
patient. Only tumor tissue (T) showed the difference in mobility of band as compared to
normal.
Fig. 20. TP53 mutation detection by TTGE in exon 7 of sporadic breast cancer patient SKH85. B, Blood, no mutation (one band); N, Normal tissue, no mutation (one band) and T, Tumor tissue, mutation detected (two bands).
The mutated band was sequenced, which showed point mutation at codon 248
(highlighted in following figure, Fig.21).
Query 100 ATGGGCGGCA-GAACCAGAGGCCCA-CCTCACCATCATCACACTG-AA-AC-CCAG 150
|||||||||| ||||| |||||||| ||||||||||||||||||| || || ||||
Sbjct 978 ATGGGCGGCATGAACCGGAGGCCCATCCTCACCATCATCACACTGGAAGACTCCAG 1033
Fig 21. Sequence of mutated band showing point mutation at codon 248 in exon7 of TP53 gene.
According to MUT-TP53, a mutation was detected at codon 248 in which CGG has been
changed to CAG ( Arg to Glu = R to Q). Significance of above given mutation was
searched through data base IARC (2011) and found that it is an important misssense
mutation involving CpG site with genomic description 13380. Prevalence of this
mutation has been reported as a somatic mutation in 779 tumors and as a germline
mutation in 14 Li-Fraumeni families. L3 structural motif (exon 6-7) of TP53 was
involved which includes DNA binding site and protein becomes non functional.
Mutation
B N T
47
2) TP53 mutation was also detected in exon 7 of sporadic breast cancer patient
SKH86 (Fig.22). No mutation was detected in blood (B) and normal tissue (N) of this
patient. Only tumor tissue (T) showed the difference in mobility of band as compared
with normal.
Fig. 22. TP53 mutation detection by TTGE in exon 7 of sporadic breast cancer patient, SKH86. B, Blood, no mutation (one band); N, Normal tissue, no mutation (one band) and T, Tumor tissue, mutation detected (two bands).
The mutated band was sequenced, which showed point mutation at codon 238
(highlighted in following figure, Fig. 23).
ATCCACTACAACTACATGTATAACAGTTCCTGCATGGGCGGCA-GAACCGGAGGCCCA-CCTCACCATCATCACACTG-A
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||
ATCCACTACAACTACATGTGTAACAGTTCCTGCATGGGCGGCATGAACCGGAGGCCCATCCTCACCATCATCACACTGGA
7174857
Fig. 23. Sequence of mutated band showing point mutation at codon 238 in exon7 of TP53 gene.
According to MUT-TP53 (Soussi et al., 2006), a mutation was detected in sample
SKH86T, at codon 238 in which TGT has been changed to TAT (Cys to Tyr = C to Y).
Significance of above given mutation was searched through data base IARC (2011) and
found that it is an important deleterious misssense mutation, not involving CpG site with
genomic description 13350. Prevalence of this mutation has been reported as a somatic
mutation in 79 tumors and as a germline mutation in 1 Li-Fraumeni families. L3
structural motif of TP53 was involved which includes DNA binding (zinc binding) site
and protein become non functional.
Mutation
T B N
48
3) TP53 mutation was detected in exon 8 of sporadic breast cancer patient NUS-
10 (Fig. 24). No mutation was detected in blood (B) and normal tissue (N). Only tumor
tissue (T) showed the difference in mobility of band as compared to normal.
Fig. 24. TP53 mutation detection in exon 8 of sporadic breast cancer patient (NUS-10). M, 50 bp marker; B, Blood, no mutation (one band); N, Normal tissue, no mutation (one band) and T, Tumor tissue, mutation detected (two bands).
The mutated band was sequenced, which showed point mutation at codon 278,
(highlighted in following figure, Fig.25).
Query 32 GCTTTGAGGTGCGTGTTTGTGCCTGTTCTGGGAGAGACCGGCGCACAGAGGAAGAGAATC
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct 1057 GCTTTGAGGTGCGTGTTTGTGCCTGTCCTGGGAGAGACCGGCGCACAGAGGAAGAGAATC
Fig. 25. Sequence of mutated band showing point mutation at codon 278 in exon 8 of TP53gene.
According to MUT-TP53 (Soussi et al., 2006), a mutation was detected in sample
SKH86T at codon 278 in which CCT has been changed to TCT (Pro to Ser = P to
S).Significance of above given mutation was searched through data base IARC (2011)
and found that it is an important deleterious miss-sense mutation, not involving CpG site
with genomic description 13812. Prevalence of this mutation has been reported as a
somatic mutation in 74 tumors and as a germ line mutation in 2 Li-Fraumeni families. H2
structural motif of TP53 was involved which includes DNA binding (zinc binding) site
and protein becomes non functional.
M T N B M
Mutation
49
All the three type of mutations detected in this study were present in patients of
infiltrating ductal carcinoma. The three mutations presented in this study are missense
mutations due to change of following amino acids:
85T: codon 248 = G : A at CpG
86T: codon 238 = G : A
10T: codon 278 = C : T
TP53 gene mutations in familial breast cancer
The de novo germline mutations of TP53 gene are rare. About 50% of individuals
clinically diagnosed with LFS have a germline mutation in TP53. DNA sequence analysis
of the entire coding region and splice sites of TP53 can detect approximately 95% of
those mutations. Since LFS is an autosomal dominant cancer predisposition syndrome,
each child of an individual affected with LFS has a 50% (or 1 in 2) chance of inheriting
the disease-causing mutation (IARC 2011).
The rare TP53 gene mutations in familial breast cancer were checked in the
present study. During surveying the normal population for taking blood as control
sample, three families (F1: Familial breast cancer, F2: Familial breast cancer and F3:
Li.Fraumeni Syndrome (LFS) family) with breast cancer history were screened. For the
study, blood was taken from each member of family. DNA was extracted. 5-8 exons of
TP53 were amplified and checked for the mutations by TTGE.
For visualizing the difference of band mobility between normal and mutated
samples, every sample was heteroduplexed with a confirmed (by sequencing) normal
sample. No difference in mobility of bands was detected by TTGE (Fig. 26). Thus, the
present analysis may have suggested, whether the Li-Fraumeni syndrome includes
families with a genetic basis other than a TP53 germline mutation or with an inactivation
of this tumor suppressor gene through a mechanism other than a mutation in the coding
region of the TP53 gene.
50
(A) F1 F2 F3
(a) F1 F2 F3
(b)
F1 F2 F3
(c)
F1 F2 F3
(d)
(B)
Fig. 26. Detection of TP53 mutations in exon 5-8 of familial samples by Temporal Temperature Gradient Gel Electrophoresis (TTGE) showing no difference in band mobility pattern. (A) shows the pedigrees of families ; F1: Familial breast cancer, F2: Familial breast cancer and F3: Li.Fraumeni Syndrome (LFS). Icons in the pedigrees were numbered according to the sequence in which blood was taken and processed till TTGE and (B) shows the band pattern of familial breast cancer patients in exon 5-8 of TP53 gene. (a), exon 5; (b), exon 6; (c), Exon 7; (d), exon 8 . M,50 bp marker.
1 2 3 4 5 6 7 1 2 1 2 3 4 5 6 7 8 9 M
M 1 2 3 4 5 6 7 1 2 1 2 3 4 5 6 7 8 9
M 1 2 3 4 5 6 7 1 2 1 2 3 4 5 6 7 8 9
M 1 2 3 4 5 6 7 1 2 1 2 3 4 5 6 7 8 9
F1 F2 F3
51
Codon 72 polymorphism of TP53 gene
There are three polymorphic forms of codon 72 of TP53 gene, arg/pro, pro/pro
and arg/arg. The homozygosity of arg/arg is considered as prone to breast cancer. So for
understanding the pattern of codon 72 polymorphism in breast cancer patients of
Pakistan, DNA from blood of all normal, tumor and familial samples was also used for
analysis of polymorphism of codon 72 of TP53 gene. The technique Restriction Fragment
Length Polymorphism (RFLP) was used. A 199bp unrestricted fragment (Fig. 27) after
restriction with BstUI gave the following pattern for three different polymorphisms:
1. Presence of one band (199 bp) for homozygus proline (pro72/pro72)
(Fig. 27)
2. Presence of two bands (113 bp, 86 bp) for homozygus arginine
(arg72/arg72) (Fig. 27)
3. Presence of three bands (113 bp , 86 bp, 199 bp) for heterozygous
arginine-proline (Fig. 28B)
Normal subjects
Fig. 27. shows the RFLP pattern of codon 72 of TP53 gene in blood samples of
normal subjects. Homozygosity of arg/arg could be recognized as two bands of 113 bp +
86 bp (arg) and of pro/pro as 199 bp.
Fig. 27. RFLP gel (4%) showing TP53 codon 72 polymorphism in blood samples of normal subjects. Pattern of two alleles of 113 bp + 86 bp (arg) and 199 bp (pro), Lane 1, uncut fragment (199bp); lane 2, Homozygus arginine (arg/arg), (lane 3), Homozygus praline (pro/pro); M, 50 bp marker.
1 2 3 M
199 bp 113 bp 86 bp
52
In 50 normal females, frequency of homozygous arginine was 10%; for
homozygotic proline it was 40%, and for heterozygotic arg/pro it was 50 %. Fig. 27
shows the banding pattern of two normal subjects as a reference.
Sporadic breast cancer patients
One hundred and fifty breast cancer patients were observed for arg/pro genotype.
Frequency of homozygotic arginine at codon 72 was 12 %, for homozygotic proline it
was 34.6 %, and for heterozygotic arg/pro it was 53.3 %.Although blood (B) samples
were used for detection of polymorphism (Fig. 28) but only those samples which proved
positive for TP53 gene mutations (SKH-85, SKH-86 and NUS-10) were checked for
codon 72 polymorphisms in tumor tissue (T), normal tissue (N) and blood samples (B)
(Fig. 29, 30 ). SKH-85 showed homozygous (pro/pro), but SKH-86 and NUS-10 (T, N,
B) showed heterozygosity (arg/pro) by showing presence of all the three bands.
Fig. 28. RFLP gel (4%) showing TP53 codon 72 polymorphism in blood samples of sporadic breast cancer patients. A shows uncut fragment whereas B shows fragment restricted with BstUI of codon 72 in exon 4 of TP53 gene of breast tumor tissue of patient SKH 86 and NUS 10. M represents 50 bp marker.
Fig. 29. RFLP gel (4%) showing TP53 codon 72 polymorphism in blood, tumor and normal samples of sporadic breast cancer patients. SKH-85 and SKH-86. Lane 1, normal tissue 85; lane 2, blood 85; lane 3, tumor tissue 85; lane 4, normal tissue 86; lane 5, blood 86; lane 6, tumor tissue 86 and M, 50 bp marker.
199bp 113bp 86bp
85N 85B 85T 86N 86B 86T M
Heterozgous (Arg/Pro)
Homozygous (Pro/Pro)
199 bp 199 bp 113 bp 86 bp
SKH M NUS 86 10
M SKH NUS 86 10
Lanes 1 2 3 4 5 6 7
A B
53
Fig. 30. RFLP gel (4%) showing TP53 codon 72 polymorphism in blood, tumor and normal samples of sporadic breast cancer patient, Nus 10. M, 50 bp marker; lane 2, tumortissue 10; lane 3, blood 10; lane 4, normal tissue 10.
Table IV shows the of frequencies of TP53 genotypes in controls and breast cancer
patients. There is no significant difference between patients and controls regarding allele
frequencies.
Table IV. Frequencies (%) of TP53 genotypes in control and breast cancer patients
Genotypes Patients (%) Controls (%)
arg/arg 18 (12 %) 5 (10 %)
pro/pro 52 (34.6 %) 20 (40 %)
arg/pro 80 (53.3 %) 25 (50 %)
Total 150 50
Breast cancer families
Family 1 and 2
PCR for codon 72 polymorphism detection of familial breast cancer patients
(31A) gave unrestricted fragments (Fig.31B). Fig. 31C shows that electrophoresis in 4%
agarose gel gave an allele pattern for the heterozygus samples (arg/pro) which is different
to homozygous Arginine (arg/arg) and proline (pro/pro). Family1 shows all the three
genotypes of codon 72 polymorphism. The breast cancer patient, her two sisters and
mother are heterozygous arginine-proline (arg/pro), whereas brother is homozygous
arginine (arg/arg), one sister and husband were homozygous proline (pro/pro) (Fig.31C).
Family 2’s samples were amplified and the product was loaded on the gel (lanes 8-9)
(Fig. 31B). Fig. 31C shows the RFLP results. The family shows the genotype,
Heterozygus Arginine/Proline(Arg//Pro)
199 bp 113 bp + 86 bp
M 10T 10B 10N
Lanes 1 2 3 4
54
homozygous Proline (pro/pro) in both samples (lanes 8 and 9). Table V represents
comparison of frequencies of TP53 genotype among F2 and F3 family members. Family
1 has arg/pro genotype and both patients of family 2 have pro/pro genotype.
Family 1 Family 2
Family 1 Family 2
Fig. 31. RFLP gel showing TP53 codon 72 polymorphism in family 1 and 2. A, shows pedigree of families; B, unrestricted 199bp PCR product and C shows fragment restricted with BstUI of codon 72, exon 4 of TP53 gene of families. Family 1: 1, Patient, 2, sister, 3, sister, 4, mother, 5, brother, 6, sister, 7, patient’s husband. Family 2: 8, Mother, 9, daughter. M is 50 bp marker (lane 10). Table V. Frequencies of TP53 genotype among F1 and F2 family members.
Relative F1 F2
Patient arg/pro pro/pro
Mother arg/pro pro/pro
Husband pro/pro
Brother arg/arg
Sister pro/pro
Sister arg/pro
Sister arg/pro
1 2 3 4 5 6 7 1 2 M
199bp
199 bp 113 bp 86 bp
Homozygous Proline (Pro/Pro) Heterozygus arginine and proline (Arg/Pro) Homozygous arginine(Arg/arg)
1 2 3 4 5 6 7 1 2 M
A
B
C
55
Family no. 3 (Li.Fraumeni Syndrome family (LFS)
Fig. 32A shows the pedigree of LFS family, Fig. 32B shows the PCR
amplification before restriction with BstUI and Fig. 32C shows RFLP pattern of two
types of polymorphisms i.e. arg/pro and pro/pro .The family members, f1 (mother of
proband), f4 (f1’s niece), f5 (f1’s niece), f6 (f1’s son) and f7, f8 and f9 (f1’s niece) shows
heterozygus genotype; arginine and proline (arg/pro) and f2 (f1’s daughter), f3 (f1’s
daughter) shows homozygous genotype; proline (pro/pro).
Fig. 32. RFLP gel showing TP53 codon 72 polymorphism in family 3 (LFS). A, shows pedigree of LFS family , B, shows unrestricted 199bp PCR product and C shows fragment restricted with BstUI of codon 72 in exon 4 of TP53 gene. 1, mother; 2, daughter; 3, daughter; 4, niece; 5, niece; 6, son; 7, niece; 8, niece and 9, niece.
Table VI shows the clinical and genetic status of LFS family. It is obvious from
the table that TP53 mutation (5-8 exon) were absent in this family and the clustering of
heterozygous alleles arg/pro which may conforms the phenomenon of genetic
anticipation.
1 2 3 4 5 6 7 8 9 M
199bp
199 bp 113 bp+ 86 bp
Homozygous Proline (Pro/Pro) Heterozygus arginine and proline (Arg/Pro)
1 2 4 5 6 M 3 7 8 9
A
B
C
56
Table VI . Clinical and genetic status of LFS family
No. Sex Family members
(in relation to
F1)
Age(y) at blood samplin-g
Effect of any type of tumor
TP 53 mutation (5-8 exon)
Codon 72 polymorphism
f1 Female mother 56 Non effected
Negative
arg/pro
f2 Female F1’s daughter
21 Non effected
Negative arg/pro
f3 Female F1’s daughter
18 Non effected
Negative arg/pro
f4 Female F1’s niece 10 Non effected
Negative pro/pro
f5 Female F1’s niece 6 Non effected
Negative arg/pro
f6 Male F1’s son 27 Non effected
Negative arg/pro
f7 Female F1’s niece 3 Non effected
Negative arg/pro
f8 Female F1’s niece 16 Non effected
Negative pro/pro
f9 Female F1’s niece 20 Non effected
Negative arg/pro
Epidemiological considerations based upon the samples included in this study
For the determining the influence of epidemiological factors on breast cancer prevalence
and understanding the clinical value of somatic TP53 mutations, the clinical and
molecular data of one hundred and fifty breast cancer patients of Pakistan was assembled.
This data may be helpful in deciding the role of TP53 gene mutations in routine clinical
practice.
Patients were divided into two groups:
1. TP53 non- mutated patients
2. TP53 mutated patients
TP53 non- mutated patients
Provincial representation
Pakistan is divided into four provinces. Ninety two percent of the patients were from the
Punjab provinces, 7% were from Khyber Pakhtunkhua (NWFP) and only 1% was from
Balochistan. There was no patient from Sindh province (Fig. 33).
57
Fig. 33. Breast cancer patients from four provinces of Pakistan, that reported at Shaukat Khanum
Memorial Cancer Hospital for treatment and included in the present study.
Education status
Fig. 34 shows the personal history of breast cancer patients. A, shows that 51%
of breast cancer patients were uneducated (no formal education in school), 19% patients
had primary education (studied till class 2-5), 20% had secondary level (undergraduates)
and 10% were educated till university level (>/graduation).
Fig. 34. Education status of patients registered at SKMCH.
Income level and feeding habit
Fig. 35A shows that only 7% belonged to high income level (>20,000/month).
Fig. 35. (A) Income level and (B) feeding habit.
Punjab92%
N.W.F.P7%
Sindh0% Balochistan
1%
Education status
No education51%
Primary19%
Secondary20%
University level10%
Socio-economic status
High 7%
Middle33%
Low60%
Feeding habit
Vagitarian13%
Fat preference87%
A B
Feeding habit
Vagitarian13%
Fat preference87%
58
33% belonged to middle (>20,000/month) and 60% belonged to lower income
level (>20,000/month). Fig. 35B, shows that only 13% of patients prefer vegetables in
their diet and most of them preferred meet and products made up of animal fat.
Smoking status
Fig. 36 shows the smoking status of breast cancer patients. A, shows that
Fig.36. Smoking status of breast cancer patients. A, Active smoking and B, passive smoking.
3 % were smokers and 97% nonsmoker breast cancer patients participated in the
concerned study. In case of passive smoking (B) 36% patients close relatives (husband,
son, father) were smokers and 64% patients were not passive smokers.
Exposure to X-rays and type of food used for cooking food
IARC (2011) has reported that the X-rays and emissions from biomass (wood),
are also probable human carcinogens. So the information about residential area and the
way of cooking food by the patients was collected. Fig. 37 shows the relationship of
environmental emissions to incidence of breast cancer.
A B
Fig. 37. Assesment of role of exposure to X-ray and the fuel used for cooking on the incidence of
breast cancer patients reported at SKMCH. A, Fuel in use B, exposure.to X-rays.
Fuel in use of patients
Wood as fuel40%
Gas as fuel60%
Wood as fue
Gas as fuel
Cancerious exposure
X. Ray exposure7%
No imp. Exposure84%
Power statioexposure
3%
Sun light exposure6%
Sun
X. R
PowNo i
Relative's (husband, son, father) smoking
smoker36%
nonsmokers64%
Smoking status
nonsmokers97%
Smokers3%
A B
59
Fig. 37 shows the information on the type of fuel used for cooking food (A) and
exposure to X-rays and other carcinogens (B). Fig. 37A that 40% of the patients used
wood as fuel and 60% used gas. Fig. 37B shows that 6% have worked under intense
sunlight, 7% patients had exposure to X-rays and 3% had exposure to power station/
electric cables passing over their residences.
Age of visitation
Fig. 38 shows the age of patients. It was observed that 19 % of patients came to
see doctor at the age of 30 years, 36% of patients at the age of 40 years, 19 % of patients
at the age of 50 years, 10 % of patients at the age of 60 years and 16 % of patients at the
age of 70 years. So majority of patients (74%) visited the physicians in early age, i.e. 30-
50 years.
Fig. 38. Age of patients at visitation.
Menarche
Fig. 39 shows the age at which menarche started. It was 12 years for 11%
patients, 13 years for 42% of patients, 14 years for 28% of patients, was 15 years for 11%
patients, 16 years for 0% patients and 17 years for 1% patients and 18 years for 10% of
patients. It was concluded that early age of menarche was more prominent.
Fig. 39. Status of menarche.
(13 years)42%
(12 years)11%
(14 years)25%
(15 years)11%
(16 years)0%
(17 years)1%
(18 years)10%
<=30 years19%
<=50 years19%
<=60 years10%
<=70 years16%
<=40 years36%
60
Marital status
Fig. 40 shows that out of all the breast cancer patients only 5% were unmarried
and 95% were married. Out of total patients only 8% had used and 92% had not used any
type of contraceptive (B). Out of 150 patients (Fig.40 C) 7% had no regular menstruation
and 93% had regular menstrual cycle.
Fig. 40. Marital status, use of contraceptives and status of menstruation in the breast cancer
patients. A, marital status; B, use of
contraceptives; C, regularity of menstruation.
Number of children
Fig. 41. A shows that 5% breast cancer patients had 1 child, 29% had 2-3
children, 46% had 4- 6 children, 7% had 7-9 children, 5% had 10-12 children and 8%
were nulliparus.
Fig. 41. Number of children of breast cancer patients. A, number of children; B, ratio of child death
(before/after birth); C, breast feeding.
Use of contraceptives
not used92%
used 8%
contracept
not used
No. of childern
</ 3 Childern29%
</ 6 Childern46%
</9 Childern7%
</ 12 Childern5%
nulliparus8%
single5%
</ 3 Childern</ 6 Childern
</9 Childern</ 12 Childern
nulliparus
single
Ratio of childern death (before or after birth)
Childern died49%
Childern alive51%
Manstruation regularity
No regular 7%
regular93%
Breast feeding
Breast feeding (present)
81%
Breast feeding (absent)
19%
Marital status
Married 95%
unmarried 5%
Married unmarried
A B C
A B C
61
Children of 49% patients died before or after birth whereas those of 51% patients
children were all alive (Fig. 41 B). Fig. 41 C shows that 81% patients had breast fed their
children, whereas 19% did not.
Size of tumour
Fig. 42 shows the status of breast cancer. Fig. 42 A shows that 15% patients had breast
tumor size of 0.5-2 cm, 47% of the patients had 2.1- 3.5 cm, 19% had 3.6- 4.5 cm, 12%
had 4.6- 6 cm and 7% of patients had size of 6.1- 9 cm. Fig. 42 B shows the tumor grade:
only 2% patients had their tumors at grade 1, 47% had tumor grade 2 tumors and 51%
had grade 3 tumors. 62% breast cancer patients showed lymph node involvement whereas
38% patients did not shown lymph node involvement (Fig.42 C).
A B C
Fig. 42. Tumour size and tumour grade of breast cancer patients. A, Tumor size; B, Tumor grade; C,
Node involvement.
Hormonal level and nature of carcinoma
Estrogen and progesterone receptors (ER/PR) are the classical markers for
detecting prognosis of breast cancer. ER-/PR- tumors are considered more aggressive
because they do not depend on hormones for growth, so have worse prognosis. With
ER+/PR+ tumors medication has good effect to control the production of hormones, so
these tumors have good prognosis and the chances of survival of patient are high (Taneja
et al., 2010). The report of Immunohistochemistry (IHC) testing for estrogen and
progesterone receptors (ER/PR) was (obtained from patient’s personal history file) done
Tumor size (cm)
tumor size (0.5-2)15%
tumor size (2.1-3.547%
size (3.6-4.5)19%
tumor size (4.6-6)12%
tumor size (6.1-9)7%
Tumor grade
Tumor grade (1)2%
Tumor grade (2)47%
Tumor grade (3)51%
Node status
Node status(positive)
62%
Node status (negative)
38%NodNod
62
by Mayo and Shaukat Khanum hospital’s laboratories. Patients were categorized in four
classes.
ER+/ PR+ (positive expression of estrogen and progesterone
receptor)
ER+/ PR-(positive expression of estrogen and negative expression
of progesterone receptor)
ER-/ PR+ (negative expression of estrogen and positive
expression of progesterone receptor)
ER-/ PR-(negative expression of estrogen and progesterone
receptor)
Fig. 43A shows that 51% patients were ER+/ PR+, 37% were ER-/ PR-, 4%
patients were ER-/ PR+, 8% patients were of ER+/ PR- status. Fig. 43B shows that 86%
patients were suffering from in situ ductal carcinoma, 9% had invasive lobe carcinoma
and 5% patients had both types of breast cancer. Fig. 43C shows that 41% patients had
left breast involvement, 51% patients had right breast involvement, whereas only 1%
patients shows both sides involvement in breast cancer. The data about 7% patients was
not available.
A B C
Fig. 43. Estrogen and progesterone levels of breast cancer patients. A, Estrogen/ Progesterone (ER/PR)
status; B, type of breast carcinoma and C, laterality.
Lateralitydata not obtained
7%
both sides 1%
right breast51%
left breas41%
ER/PR
ER-/PR-37%
ER-/PR+4%
ER+/PR-8%
ER+/PR+51%
Type of Breast carcinoma
ID Ca86%
inv.lob.ca9%
both5%
63
Familial breast cancer
Fig. 44 shows that out of 150 patients 98% had sporadic breast cancer and only 2% had
familial background of breast carcinoma.
Fig. 44. Family history of breast cancer patients.
Breast cancer patients with TP53 mutated genes
Out of 150 breast cancer patients only 3 patients showed mutation in TP53 gene.
Table VII shows the comparison of breast cancer risk factors in patients having TP53
mutations.
Table VII. Comparison of characteristics of breast cancer and the risk factors in patients having TP53 mutations
FACTORS
P53 +IVE
(NUS-10)
TP53+IVE
(SKH-85)
TP53+IVE
(SKH-86)
TP53 mutation detected in the
present research
codon 278
C : T
Codon 248
G : A at
CpG
Codon 238
G : A
Structural dysfunction of TP53 gene
due to said mutation
Reported
IARC (2011)
Reported
IARC (2011)
Reported
IARC
(2011)
Type of codon 72 polymorphism
detected in the present research
arg/pro pro/pro arg/pro
Age >50 years
53 50
Sex female female female
Socio-economic status low low low
Profession house-wife house-wife house-wife
Education non secondary non
Urban and rural population rural rural rural
Family History
Familial2%
Sporadic98%
64
Religion islam islam islam
Knowledge about self examination no no no
Marital status married
married married
Any relative having breast cancer
(degree)
non non non
Age of menarche 13 12 14
Age of menopause
50 50 40
Tumor size >2 cm 2.5cm 7cm
Grade
3 3 3
Presence of tumor in right/left
breast
right right left
Node involvement yes yes yes
ER/PR status positive positive positive
Type of carcinoma IDC IDC IDC
Stage IV III III
Active smoking no no no
Passive smoking no husband husband
Use of contraceptives no no no
exposure to environmental risk
factor
no no no
No. of children 5 4 5
Childern died no no 1
Breast feeding yes yes yes
Ovary discordment no no no
Any other physical problem no no no
Usual diet included (meat
fonder/vegetarian)
mix fat fat
65
CONCLUSION
TP53 gene (5-8 exon) mutations were checked in Pakistani sporadic breast cancer
patients. Three deleterious mutations were detected in the sporadic breast cancer patients,
viz., codon 238 where TGT is mutated to TAT (cys to tyr), codon 248 where CGG is
mutated to CAG (arg to glu) and codon 278 where CCT is mutated to TCT (pro to ser).
These mutations were not detected in normal breast tissue and blood samples of these
patients. TP53 gene mutations were also checked in familial breast cancer patients
including LFS family. No mutation was detected in these families.
In the present study, genotype arg/pro and pro/pro, both polymorphisms were found more
significant in Pakistani breast cancer patients as compared to arg/arg with corresponding
ratio of arg/pro (53.3): pro/pro (34.6): arg/arg (12). Normal controls showed about the
same difference in ratio of arg/pro: pro/pro: arg/arg, (50:40:10). Exon 4 of TP53 gene
polymorphism was also checked in familial breast cancer patients and LFS family.
arg/pro and pro/pro genotypes were found dominant over arg/arg in these families.
Correlation of TP53 mutations with clinicopathological parameters (data collected
by questionnaire) was observed. Patients were divided into two groups; group 1 (TP53
non mutated) and group 2 (TP53 mutated). As both groups have not shown any
difference so no prominent correlation between TP53 mutations and clinicopathological
parameters was found. So it was concluded that TP53 mutations are present in breast
cancer patients of Pakistan but there was no significant correlation between TP53
mutation and tumor aggressiveness e.g. nodal status, size, ER/PR and histopathology etc.
However, TP53 is considered as a strong marker for the prediction of low survival rate
and increased chances of death in breast cancer (Aguiar et al. 2010). So for a better
understanding, further analysis of different types of TP53 mutations in other part of the
gene is required in order to investigate the prognostic potential of this marker in Pakistani
population.
66
DISCUSSION
TP53 gene mutations and polymorphisms in normal population of Pakistan
In the present study 50 normal females (18-65 years) with no breast cancer history
were selected as a control. No mutation in any of the samples for any of the exons 5-8
was detected. According to Mills (2005) in normal cells TP53 is expressed at extremely
low levels (~1000 molecules/cell) but it is strongly induced by cellular stress, DNA
damage, hypoxia or nucleotide deprivation and the concentration increasing by 5- to 100-
fold in most transformed and tumor cells. The TP53 gene mutations in normal population
without genetic lineage have been reported by Nakazawa et al. (1994) in normal skin
after UV exposure. TP53 mutations may however, be present in somatic cells of familial
cancer syndrome like Li fraumeni syndrome (Lovell et al., 2006). Overexpression of
serum TP53 mutation related with Helicobacter pylori infection which causes gastric
cancer was observed by Lopez-Saez et al. (2010) in population of Cadiz (Spain).
In addition to gene mutations, several reports have focused on 14 known
polymorphisms of TP53 gene. Polymorphism at codon 72 in exon 4 was studied both in
normal and breast cancer patients in the present work. Codon 72 polymorphism is
considered important because the presence of homologous arginine (arg/arg) increases
the chances of development of cancer (IARC, 2011).
In the present study pro/pro showed the enhanced frequency in normal population
compared to homologous arginine (arg/arg). The frequency of homozygotic arginine was
10%, for homozygotic proline it was 40%, and for heterozygotic arg/pro it was 50%.
Dumont et al. (2003) have suggested that the TP53 proline 72 variant is associated with
increased risk of cancer due to a decreased ability to induce apoptosis.
Khaliq et al. (2000) had studied the differences in allele frequencies of three
polymorphisms of TP53 gene including codon 72 polymorphism among different ethnic
groups of Pakistan. For comparing the results of present work with Khaliq et al. (2000)
study, allele frequencies were determined using genotypic frequencies for codon 72
polymorphism. It was observed that in present study the allele frequency of Pro allele in
normal persons was 0.65 whereas Khaliq et al. (2000) had reported 0.50 for Punjabi
population. So it may be concluded that as Khaliq et al. (2000) had also reported the
67
apparently higher frequency of Pro allele but this difference may be due to small sample
size of normal persons (50) and gender bias as only female subjects were included in the
present study. Pro allele frequency in normal population is reported to be 0.55 by
Ghasemi et al. (2010) from Iran. According to Mojtahedi et al. (2010) the frequency of
Pro allele varies from 0.17 – 0.63 in populations with different ethnic backgrounds.
TP53 mutations
Sporadic breast cancer patients of Pakistan
Breast cancer is the most common malignancy in Pakistani women, with an
incidence of 15-26% in the 30 to 49 year old age group (Rasool et al., 1987; Ahmad et
al.1991 and Usmani et al. 1996). Most of breast cancers are sporadic and arise from
somatic mutations (Chang et al. 1993; Greenblatt et al. 1994). Approximately 37% breast
malignancies are due to mutations in the TP53 tumor suppressor gene (Mcbride et al.,
1986; Hartmann et al., 1997).
In the present study blood, normal breast tissue and tumor breast tissues of same
patient of one hundred and fifty breast cancer patients were analyzed for mutations in 5-8
exons of TP53 gene. No mutation was detected in any of 5-8 exons of TP53 genes in the
blood samples and normal breast tissues. Point mutations were however detected in the
three tumor tissues.
The mutations detected in the present study were analyzed by MUT-TP53 (Soussi
et al. 2006). A mutation R248Q was found in codon 248 of exon 7 in the sample
SKH85T, collected from Shaukat Khanum Memorial Cancer Hospital and Research
Centre. The composition of codon in this mutation changed from CGG (Arginine) to
CAG (Glutamine). Another mutation C238Y was found in codon 238 of exon 7 in the
sample SKH86T which was also collected from Shaukat Khanum Memorial Cancer
Hospital and Research Centre. In this case the composition of the codon was changed
from TGT (Cystine) to TAT (Tyrosine). The third mutation P278S was found in codon
278 exon 8 in the sample Nus10T collected from Mayo Hospital, Lahore. Composition of
this codon changed from CCT (Proline) to TCT (Serine).
The above described mutations are truly acquired mutations, present only in
tumor tissue and absent in healthy tissue from the same patient. These alterations were
68
found in the highly conserved blocks of TP53 which are functionally important regions of
the protein. The analysis of the properties of these mutants revealed that due to these
mutations in gene, transactivational activity of TP53 may be affected (Ory et al., 1994).
Familial breast cancer patients
No TP53 mutation was detected in any of the families studied. Laloo et al. (2003,
2006) and Walsh et al. (2006) have also reported that it is very difficult to find TP53
germline mutation in families having no relation with Li. Fraumeni syndrome and
BRCA. The comparison of TP53 polymorphisms has also been done in the present study.
Family no. 1 has all the three categories of polymorphisms whereas family 2 is
homozygous for proline.
Li. Fraumeni Syndrome (LFS)
LFS was first reported by two physicians Li and Fraumeni in 1969 but the genetic
basis of LFS remained elusive for many years. Few years before the occurrence of
germline TP53 gene mutations in 6 families with LFS was reported (Birch et al, 1994).
The present study has not confirmed the relationship between LFS family and the TP53
gene (exon 5-8) mutations. It may be due to involvement of some other exons or gene.
Bell et al. (1999) reported that the breast cancer in LFS, which occurs usually at a very
early age (20–30 years), is not related to the TP53 gene. Instead another gene CHK2 gene
was involved.
The LFS family (family 3) in this study showed both pro/pro and arg/pro
polymorphisms. With the passage of time any of these polymorphisms may become more
prominent at an earlier age, due to the phenomenon of genetic anticipation (McInnis,
1996). Anticipation is a phenomenon, as a genetic disorder is passed on to the next
generation, the symptoms of disorder become more prominent at an earlier age. Bougeard
et al. (2006) reported that the distribution of the arg/arg, arg/pro, and pro/pro genotypes
was 41%, 46%, and 13%, respectively in familial breast cancer patients and it was
observed that the mean age of tumor onset in affected carriers of the arg allele was 21.8
years and in pro/pro patients 34.4 years.
69
TP53 polymorphism
Incidence of somatic TP53 polymorphism on the arg72 allele in breast carcinomas
explains that it gives breast epithelial cells a growth advantage, which may enhances the
risk of malignant growth and development of cancer. It may also be possible that the
arg72 changes the ability of mutant TP53 protein to bind and affects the other proteins
such as, TP73 (Dicome,1999).The codon 72 polymorphism has been reported as a
modifier which interacts with TP73-induced apoptosis (Marin, 2000).
It is reported that coexistence of the codon72 polymorphism with a mutation
could modify the TP53 protein structure, causing an altered transcription pattern
(Campomenosi, 2001). So the observation of codon 72 polymorphism along with
mutation status in one hundred and fifty patients was also included in the present study.
The patients who proved positive for TP53 gene mutations were also checked for codon
72 polymorphisms. SKH-85 shows pro/pro but SKH-86 and NUS-10 (tumor tissue,
normal tissue and blood) shows heterozygosity arg/pro. Overall, the status of codon 72
polymorphism in one hundred and fifty breast cancer patients showed that the frequency
was 12 % arg/arg, 34.6 % for pro/pro and 53.3 % for arg/pro.
Since there is found no difference between frequencies of genotypes of patients
and controls so it may be predicted that polymorphisms in codon 72 of TP53 gene was
not associated with breast cancer in Pakistani patients. Our results are in agreement with
similar studies on bladder cancer (Toruner, 2001) and breast cancer (Tommiska et al.,
2005) reported from other laboratories. These results also coincide with those of
Khadang et al. (2007) on breast cancer in Iran but are contrary to some other reports on
prevalence of this polymorphism in cervical cancer (Santos, 2005; Siddique, 2005;
Storey et al.1998, Tenti et al., 2000), lung (Wang et al., 1998; Pierce et al., 2000), colon
(Sayhan et al., 2001), bladder (Kuroda et al., 2003; Soulitzis et al., 2002), skin
(Dokianakis et al., 2002) and breast (Langerød et al. 2002).
The present study shows the dominance of proline genotype compared with
arginine . According to Dumont et al. (2003), the TP53 proline 72 variant is associated
with increased risk of cancer due to a decreased ability to induce apoptosis. Proline allele
as a risk factor for breast cancer is also shown by others (Sjalander et al., 1996 Weston et
al., 1997). Tommiska et al. (2005) suggested that codon 72 polymorphism, particularly
70
the pro/pro genotype, is an independent prognostic factor in patients with breast cancer
and provides evidence that patients harboring this genotype will have a reduced survival.
According to the Langerod et al. (2002), breast cancer patients with the pro/pro genotype
demonstrated less sensitivity to chemotherapy. The dominance of proline allele is also
observed by Khalique et al. (2000). In the present study, frequency of proline is higher
than arginine. A strong association between the arg/arg genotype and breast cancer was
reported in Turkish patients (Buyru et al. 2003). Similarly, Langerod et al. (2002)
reported a growth advantage of breast carcinoma cells with the arginine 72 allele in
Norwegian population. Papadakis et al. (2000) reported arg/arg genotype as a risk factor
for breast cancer in Greek population. In India, the arg/pro genotype in patients with lung
cancer was associated with early progression of the disease, compared with arg/arg
carriers (Jain et al., 2005). Matakidou et al. (2003), however, did not find any
relationship between TP53 codon 72 polymorphism and risk of lung cancer after meta
analysis. Zehbe et al. (1999) also reported a higher risk of cervical carcinoma in patients
harboring the TP53 arginine variant. Some investigators reported an increased frequency
of the arginine allele in breast cancer patients as compared to controls (Wang et al., 1998;
Papadakis et al., 2000; Suspitsin et al., 2003).
As the above discussion showed that both homozygotic polymorphisms arg/arg
and pro/pro along with TP53 gene mutation may cause worse prognosis so it may be
claimed that both the arginine and proline genotypes affect the TP53 gene mutation
pattern but selection of either polymorphism (arg/arg or pro/pro) may be forced by
differences in geographical variation (Tommiska et al., 2005).
Molecular significance of TP53 gene mutations detected in the present research
Three missense mutations detected in the present study (codon 238 = G → A,
codon 248 = G →A at CpG and codon 278 = C→T) in DNA binding region of TP53
and could change the structure of protein and, therefore, affect its function (IARC, 2011).
Fig. 45 shows three-dimentional structures of wild type and mutant forms of human TP53
protein (.gene bank accession no. NM_000546; MIM#191170). Fig. 45 A, C and E
represents the position of codons 238, 248 and 278 in wild-type human TP53 protein. The
red color ribbon (Fig.45 B, D and F) represents the region in the mutant protein where
71
negibouring amino acids residues of mutant amino acids interact abnormally to bring a
change in the protein structure. These structures were predicted by 3D Viewer software
given on IARC website (http://www-p53.iarc.fr/structureanalysis.html). The input
sequences were the gene bank reference sequences for wild-type protein and deduced
protein sequences from mutant gene sequences observed in the present study.
Fig.45. 3 dimentional structures of TP53 gene mutations in breast A) Arrow shows the position of codon 238 on the TP53 structure B) Arrow shows the change in the TP53 structure due to insertion of mutant codon 238 C) Arrow shows the position of codon 248 on the TP53 structure D) Arrow shows the change in the TP53 structure due to insertion of mutant codon 248 E) Arrow shows the position of codon 278 on the TP53 structure F) Arrow shows the change in the TP53 structure due to insertion of mutant codon 278
72
Basicaly two types of mutations were detected in three tumor samples in the present study:
1. G>A in sampes 85T from SKMCH&RC and G>A in sample 86T from
SKHMC&RC
2. C>T in sample 10T from Mayo Hospital
According to Yu (2000), Hoeijmakers (2001) and Eachkoti et al. (2007) the G:C>
A:T transition mutation (G to A or C to T base change) can be the result of silenced O6-
methyl guanine transferase (O6MGMT) allele, bearers of which cannot remove
carcinogen induced O6-methyl guanine adducts and thus seems to be predisposed to
mutations in key genes like TP53. To establish a correlation between the two needs study
of methylation MGMT allele in TP53 mutation bearers.
It is reported by Snyderwine (2007) that the 2-amino-1-methyl-6-phenylimidazo
pyridine (PhIP), a potent carcinogen (a heterocyclic amine) contained in cooked meat and
fish is a major inducer of mammary carcinogenesis because it forms DNA adducts in
human mammary epithelial cells which causes the induction of mutations. This fact is
also proved by rodent model ( Sinha et al., 2000 ).
Significance of TP53 gene mutations and breast cancer in Pakistan
As the present investigation is the comprehensive report on TP53 gene mutations
spectrum in breast cancer patients of Pakistan, the following analysis is based on the
experimental work and the data collected from questionnaires for determining the breast
cancer epidemiology and status of TP53 gene mutations in Pakistani population, in
comparison with similar type of studies done in other laboratories of world.
An early event in breast tumorigenesis
In the present study the clinicopathological data collected from the patients for
identifying the type of breast tumor genesis after a somatic TP53 mutation shows that
infiltrating ductal carcinoma was the pathological event found in 86% of breast cancer
patients. The three sporadic breast cancer patients having TP53 gene mutations were also
characterized by infiltrating ductal carcinoma. Pezeshki et al. (2001) who studied TP53
gene mutations in infiltrating ductal carcinoma, have shown that 17 out of 37 (46%)
infiltrating ductal carcinoma patients showed TP53 gene mutations. Ho et al. (2000) and
73
Done et al. (2001a,b) have shown that TP53 mutations occur in ductal carcinoma in situ
(DCIS) before the development of invasive breast cancer, and that the frequency
increases from around zero in low-grade DCIS to 30–40% in high-grade DCIS. These
results point to an important role of TP53 alterations early in the carcinogenic process of
the breast.
Frequency of mutations and its clinical value
It has been observed from the collected data in the present study that the
frequency of large tumors is higher (47%) than small tumors. Node negative (38%)
patients were found considerably less than the node positive patients (62%). Borresen-
Dale (2003) reported variable frequency of TP53 gene mutations in different populations.
Borresen-Dale (2003) and Oliever et al. (2006) found same common clinical factors in
breast cancer patients i.e. the incidence of positive nodes and larger tumor size with TP53
gene mutations. Present study is also in agreement with the above given facts, as in all
the three TP53 positive breast cancer patients which were checked for mutations in 5-8
exons and their clinical reports verified the presence of positive node status and larger
tumor size.
Relationship of BRCA1 and TP53 gene mutations
The sample Nus-10 which shows TP53 gene mutation in the present study, was
used as a specimen in another study, contribution of BRCA1 germ line mutation in
patients with sporadic breast cancer, (Malik et al., 2008). SSCP analysis and sequencing
confirms the mutation in exon 13, leading to splice site truncation which has not been
reported in Breast Information Core database. Olivier et al. (2002) have reported that
BRCA1 function is gateway to the mutation in TP53 gene. Liede et al. (2002) had studied
Pakistani population for sporadic BRCA1/2 and found 42 out of 341 patients with
BRCA1 mutations. Rashid et al. (2006) have studied the mutation level of BRCA1/2 in
Pakistani breast cancer families, but no relationship of TP53 has yet been studied with
BRCA1 and BRCA2.
74
Relationship of codon 72 polymorphism to TP53 gene mutations
The present study shows 12% frequency of homozygotic arginine, 34.6% for
homozygotic proline and 53.3% for heterozygotic arg/pro at codon 72. As very low
frequency of arg/arg polymorphism has been observed in breast cancer patients so no
direct relation of homozygotic arginine with breast cancer could be suggested. Our results
are in agreement with those from other laboratories. Khadang et al. (2007) did not show
any such relationship in Iranian patients. Whereas Langeod et al. (2002) established an
association between breast cancer and homozygous arginine.
Hotspots mutations of TP53 gene
The spectrum of TP53 gene mutations shows that this tumor suppressor gene
contains multiple hotspots, highly mutable nucleotide which reflects effects of different
endogenous and exogenous factors shaping the mutation process in specific tissues
(Glazko et al., 2006). The hot spot mutation has been detected in codon 248 of SKH85T.
According to the IARC (2011), codon 248 mutation is highly significant in breast cancer.
Khaliq et al. (2000) also reported this mutation from Islamabad, Pakistan. Shojaie and
Tirgari (2008) reported TP53 gene mutations in codon 248 of exon 7 as a risk factor in
Iranian women with breast cancer. Souici et al. (2000) worked on codon 248 and
confirmed it as a risk factor related to environmental carcinogens.
Importance of the CpG site for TP53 mutations
G-A transition mutation has been detected in this study in codon 248 of SKH85T
which is important due to presence of the CpG site, since 35% of germ line mutations in
human diseases occur at CpG dinucleotides, presumably as a result of 5-methylcytosine-
>T transitions (Fearon and Jones, 1992), The establishment and maintenance of DNA
methylation patterns in the mammalian genome are essential for normal development and
the post-synthetic modification of cytosine to form 5-methylcytosine at CpG sites is
catalyzed by a DNA (cytosine-5) methyltransferase. This enzyme catalyzes the
methylation of both unmethylated DNA and hemimethylated DNA generated,
postreplicatively. Surprisingly, 5-methylcytosine also contributes to the formation of an
extraordinarily high percentage of mutations in the tumor suppressor genes in somatic
75
cells. For example, more than 50% of somatic mutations in the TP53 gene occur at CpG
dinucleotides. Magewu and Jones (1994) showed that mutations at codon 248 in exon 7
with C-T and G-A transitions account for at least 10% of the total mutations.
TP53 as an epidemiological tool to test mutations in breast cancer
Borresen-Dale (2003) has shown that the frequency of TP53 gene mutations
varies in different populations due to different risk factors. It is observed in present study
that the frequency of TP53 gene mutations (exon 5-8) is low as compared with these
reported in the west. So it may be predicted that environmental factors and dietary habits
of particular population affects the frequency of TP53 gene variations. Hill and Sommer
(2002) have described the pattern of TP53 mutations which differs among 15
geographically and ethnically diverse populations. Diverse TP53 mutation patterns in
breast cancer are consistent with a significant contribution by a diversity of exogenous
mutagens. According to Hill and Sommer (2002) diet is an important factor which may
affect different frequency of TP53 gene mutations in differnent populations. They proved
the hypothesis that breast tissue may be uniquely sensitive to lipophilic mutagens because
of its different architecture i.e. tiny islands of cancer-prone mammary epithelial cells,
surrounded by a sea of adipocytes. Mammary epithelial cells may be differentially
susceptible to released lipophilic mutagens preferentially concentrated in adjacent
adipocytes and originating in the diet. So it may be concluded that TP53 gene can be used
as a "mutagen test," in breast cancer. The relative frequencies of the different types of
mutation can be used as an epidemiological tool to explore the contribution of exogenous
mutagens vs. endogenous processes in different populations.
Prognostic significance
In the present study, the three mutations detected are alterations of codon 238, 248, and
278. These codons belonged to most important area i.e. DNA binding region of TP53 gene (5-8
exons). According to Borresen et al. (1997) patients with mutations effecting or disrupting
the zinc binding domains L2 and L3 (codons 163–195 and 236–251) have worse
prognosis as compared to the patients with mutations elsewhere. Berns et al. (2000)
found that mutations affecting amino acids directly involved in DNA binding, many of
76
these residing in the zinc binding domain, were related with the poorest prognosis. These
findings were confirmed in a study by Alsner et al. (2000) where patients with missense
mutations affecting DNA binding or zinc binding displayed a very aggressive phenotype
with a short survival. and the prognosis for mutations in the conserved regions was worse
than for mutations in the non conserved regions.
Predictor of the response
The reported studies verify that the mutations detected in DNA binding region (as
in present study) are important predictor of therapy response. Aas et al. (1996) has
observed the affect of doxorubicin (a DNA damaging drug) in 63 breast cancers patients
and found that the patients having mutations in the zinc binding domains had resistance
to the drug. The same research group has also found the same results in an experiment on
90 patients (Geisler et al., 2001). Berns et al. (2000) studied the response of TP53
mutations to tamoxifen (DNA damaging drug). A total of 243 patients were included in
the study. Patients having TP53 mutations in amino acids of DNA binding domain
showed the least response to tamoxifen and chemotherapy. In another study, carried out
by Kandioler-Eckersberger et al. (2000), it was observed that patients having TP53 gene
mutatons and were treated with FEC (fluorouracil, epirubicin, cyclophosphamide)
showed no response. So it may concluded that TP53 mutations have significant clinical
implication and the respected knowledge could be use as an important prediction for
observing the response of cancer treatment.
Relationship of TP53 gene mutations to classical and molecular epidemiological
parameters of breast cancer in Pakistan
That cancer arises from somatic mutations is considered to be derived from
mutagen exposure and endogenous processes. Classical epidemiological studies have
tried to seek associations between cancers in high risk populations and exposures to
mutagens but elusive in the case of breast cancer. So it is important to be equivocal (both
by classical and molecular epidemiology) for studying the pattern of mutations for the
gene like TP53 in which there is at least a fourfold variation in incidence between racially
and geographically diverse populations.
77
Geographic variations
Although the cancer of the breast is one of the leading cancers in Pakistan but the
frequency of TP53 gene mutations observed in present study is low (2%). By comparing
the published reports from Pakistan and all over the world, this astonishing fact was
observed that frequency of TP53 gene mutations is different in different geographical
areas, even in the same country.
The breast cancer patients who took part in present research were considered as
representatives of all over the country because SKMCH&RC and Mayo Hospitals are
tertiary care centers and have referrals from all over the country, yet most of the patients
(92%), were from warm topographic neighbor areas of Lahore, Punjab, Pakistan and have
shown low frequency of TP53 gene mutations. In contrast, Khaliq et al. (2000) worked
on forty-one patients of Islamabad and its related areas which are cold and snowy and
reported 24.4 % of TP53 gene mutations.
The same fact is also evident from the reports from India. Hedau et al. (2004),
found 3% TP53 gene mutations in breast cancer patients of Dehli, India (summer are
long and warm and is 262.79 miles away from Lahore, Pakistan). In contrast, Eachkoti et
al. (2007) reported 44% of TP53 mutations in sporadic breast cancer patients of Kashmir
(coldest areas of India). The distance between Kashmir (occupied by India) and
Islamabad and its related northern areas (Pakistan) is approximately 50 Km (somewhere
it is less than 50 km). Both areas have resemblance in atmosphere and anthropology.
Surprisingly, similar type of trend is observed in other parts of the world. For
example, study in different areas of Japan shows different frequencies of TP53 gene
mutations. Sapporo (Japan) shows 71% (Blaszyk et al. 1996), Aomori (Japan) shows
56% (Hartmann et al. 1996) and Tokyo (Japan) shows 25% of TP53 gene mutations in
breast cancer patients (Tsuda et al. 1993). According to Wikipedia, Sapporo is the coldest
place of Japan, it snows a lot in winter. Aomori is also a famous city of Japan for snow
fall whereas Tokyo has hot humid summer and mild winter.
The frequency of TP53 gene mutations reported from different areas of United
States of America is also variable. According to Oliver et al. (2002) the frequency of
TP53 gene mutations in breast cancer patients of USA is 45%, in Detroit black is 34%
78
(Blaszyk et al. 1994) and in new Orleans black/white is 15% (Shiao et al. 1995). From
western countries it is confirmed by Ambrosone et al. (1996) and Denissenko et al.
(1996) that the pattern of TP53 mutations in breast tumors varies between black and
white women and also between Japanese and western women which suggests that these
groups differ in their environmental exposure to carcinogens or in their susceptibility to
those exposures. According to Shimizu et al. (1991), since Japanese women born and
lived in America has same rate of breast cancer as of American women so it is the
significant effect of environment on the rate TP53 gene mutation of breast cancer and not
the genetic variation.
Urban, rural population and religion
Most of the subjects in present study originated from rural area or suburban areas
who migrated to urban areas. Rana et al. (1997) and Bhurgri et al. (2007) have also
reported similar type of habitat of cancer patients in Pakistan. Feuer et al. (1993),
however, did not find any significant difference in urban and rural population.
Out of 150 breast cancer patients (present study) only one patient was Christian
and was a nun, all the remaining patients were muslims. So distribution on the basis of
religion was not possible yet. Jussawalla and Jain (1977) from India had studied the
frequency of breast cancer among different religious groups. The highest incidence, 1.5–
2.1 times, was observed in Parsi population while the Hindu, Muslim or Christian
populations have low incidence of breast cancer. The three patients detected positive for
TP53 gene mutations in present study were Muslim and belonged to rural areas of
Punjab. Although TP53 relation to ethnic population has been searched out (Khaliq et al.,
2000) but no direct relation to any religion was observed. According to Eachkoti et al.
(2007), nine out of 15 patients having TP53 mutations belonged to rural areas in occupied
Kashmir, India.
Socio-economic and education status
Socio-economic status is an important factor for breast cancer. In present study,
most of the patients belonged to low and lower middle class and low educational status.
From India, Headau et al. (2004) made similar type of observations. It is in contrast with
the findings of Feuer et al. (1993), according to whom women of high socio-economic
79
status are at greater risk of breast cancer than women of low socio-economic status with
possible reasons including differences in reproductive factors, lifestyle factors, and
greater numbers of higher educated women attending mammography screening.
In the present study the three sporadic breast cancer patients detected positive for
TP53 gene mutations belonged to low socio-economic status. Although no significant
study is available for determining the relation of TP53 gene mutations in breast cancer to
socio-economic status of patients yet the socio-economic status is related to life style,
eating habits and exposure to carcinogens, which may influence the ratio of TP53
mutations in a population. Baker et al. (2010) had associated the TP53 gene mutations in
breast cancer patients with low socio- economic background.
Cooking, eating habits and radiation exposure
IARC (2011) has reported that the household coal combustion emissions are
carcinogenic to humans and that emissions from biomass and wood are also probable
human carcinogens. In the present study, wood was in use of 40% people so this factor
may prove a possible risk factor of breast cancer in Pakistani population.
Present study shows that there is high intake of red meat (87%) in breast cancer
patients including patients found positive for TP53 gene mutations. The findings of
Khalique et al. (2000) coincide with the present research. The high intake of fats,
organochlorines and polychlorinated biphenyls which are present in many Pakistani food
stuffs can be implicated to this fact. According to Prera (1982) nutrition plays a causative
role in more then 30% of cancers by the type of food eaten in certain area, amine
generated during the cooking, by certain type of addiction and the chemicals present in
food. It has also been found that intake of red meat increases the glycemic level which
effects the TP53 gene pathway (Slattery et al., 2002). Zheng, (1998) reported that
although meat intake is directly related to the release of heterocyclic amines which cause
breast cancer but the formation of cancer is more dependent on the method of cooking
food. Yet more grilled, broiled and cooked food causes more release of heterocyclic
amines, so the chances of breast cancer increase.
According to Daniel et al. (1989) the frequent exposure to X-rays and other
radiations may increase the risk of breast cancer. In the present study, 7% patients passed
80
through intense x-rays exposure and 3% had power station exposure due to their
residence near power stations which may prove a risk factor.
Addiction and use of contraceptives
Out of one hundred and fifty patients, 97% were active smokers and just 3% were
passive smokers (by active smoking of husband/ son/ father) was 36% and no patient was
addicted for any drug or alcohol.Conway et al. (2002) observed that cigarette smoking
modify the prevalence and spectrum of TP53 gene mutations in breast cancer patients.
Due to genotoxic effect of smoking there is difference in mutational spectra between
smokers and nonsmokers.
According to Kropp and Claude (2002) passive smokers have same risk of breast
cancer as of active smokers. Pursianen et al. (2000) have observed that the spousal ETS
(environmental tobacco smokers) has two fold more risk of TP53 gene mutations as
compared to active smokers and G>A is prominent type of TP53 gene mutation in
passive smokers. It is interesting to know that in present study, out of three TP53 gene
mutation positive breast cancer patients two (SKH 85 and SKH 86) were passive smokers
(spousal ETS) and both had G>A mutation.
Most of the breast cancer patients who have taken part in the present study (92%)
were not using any type of contraceptive and all the three TP53 mutations positive
patients were also non users. Jardines et al. (2010) postulated that the risk of breast
cancer is related with the early formulations of oral contraceptives and its duration but the
new low dose contraceptives have no relation with breast cancer. No direct relationship
of contraceptives and TP53 gene mutations in breast cancer has been proved.
Early age breast cancer
The major burden of breast cancer in Pakistan is on early age breast cancer (30-50
years). India, which is close neighbor of Pakistan, coincides with present research and
deviates from west (Headau et al. 2004). In contrast to present study , Parkin and
Iscovich (1997) studied that the incidence of breast cancer is relatively very high in the
females of late age in the west. The median age of patients in present study was 40 years.
Rangan (2008) reported that, only 1% women of forty years age having breast cancer
harbor TP53 gene mutations. So it may be concluded that TP53 gene mutation is not the
81
reason of early age breast cancer in Pakistan. From India, Makwane and Saxena (2009)
also confirmed the present results by their findings. Moreover, the three patients who
proved positive for TP53 in the present research were above 50 years of age, confirmed
that TP53 gene mutations are more prominent in late adolescence.
Menstruation status
According to the “estrogen window hypothesis” of the etiology of breast cancer it
is suggested that unopposed estrogen stimulation is the most favorable state for tumor
production and that normal progesterone secretion reduces susceptibility. According to
Henderson et al. (1985) breast cancer risk is directly related to the cumulative number of
regular ovulatory cycles. MacMahon et al. (1982) suggested that late age at menarche (13
years) and early menopause (40-50 years) are the risk factor for breast cancer.
Now if we compare the above given studies with present study then it becomes obvious
that hormonal and reproductive factors are playing an important part in enhancing breast
cancer ratio in Pakistan. In Pakistani breast cancer patients the age at menarche is 13
years (42%), 51% patients were at menopause level and 93% patients had regular
menstruation during the said period. Rana et al. (1997), Bhurgri et al. (2007) and Headau
et al, (2004) are in agreement with present study while according to Parkin et al. (1992)
breast cancer is a post menopausal disease in the west.
This study also shows that all the three breast cancer patients were
postmenopausal. The postmenopausal status was significantly associated with increased
risk of TP53 gene mutations (Overgaard, 2000). The relation of TP53 to hormonal
control is also proved by Jerry et al. (2002) who proposed a model of developmental
vulnerability to breast cancer. In this model, the mammary epithelium is related to TP53
activity during mammary gland development. The results focus attention on TP53 as a
molecular target for therapies to reduce the risk of breast cancer.
Marital status, parity and breast feeding
No significant relationship has been estimated between marital status, parity,
breast feeding and breast cancer risk in the present study. 95% of patients were married.
Just 8% were nulliparus. 81% of patients breast fed their children. Reports published
82
from Pakistan by Rana et al. (1997), Bhurgri et al. (2007) and Headau et al. (2004) from
India are in agreement with above given facts. Yet Colditz et al. (1995) and Stanford et
al.(1995) are in contrast to our results who studied that early age marriage and pregnancy,
breast feeding and parity decreases the breast cancer risk in women of western countries.
Cuzick (2008) however studied that breast feeding is protective but breast cancer risk is
increased (4.3%) per cumulative year of breast feeding.
An important fact observed in the present study that 49% of patients were those
mothers, who have live births along with children aborted or died after few months of
birth. Lambe et al. (2004) worked in Sweden and gave same results concluded that child
abortion and child death after birth may be an important risk factor for breast cancer.
All the three TP53 mutation positive patients in this study were married, had
parity and fed breast milk to their child. One of them (SKH-86) had an abortion was
observed also by Simao et al. (2002) also did not observed any relationship of TP53 gene
mutations and these classical risk factors.
Family history
According to the study of Colditz et al. (1993) the risk of breast cancer is doubled
among women with a first-degree relative diagnosed with breast cancer. In the present
study, however only three patients having familial history were observed. The findings of
Rana et al. (1997) and Bhurgri et al. (2007) are in agreement with the present study.
No TP53 gene mutation was observed in three families during the present study. Headau
et al. (2004) from India is in agreement with our study. Prosser et al. (1991) are of the
opinion that a mutation on another TP53 gene of same locus (17p) may be involved in
familial breast cancer.
The clinical value of TP53 gene mutations
Time of diagnosis used for determining the chance of reoccurrence of disease,
required treatment and patient survival (Cuzick, 2008). TP53 mutations are considered as
important prognostic marker, which influence the prognosis of breast cancer (Olivier et
al. 2006). Olumi et al. (1990) studied that the patients having TP53 mutations of those
amino acids, which are directly involved in DNA or zinc binding region displayed a very
83
aggressive clinical phenotype. Olivier et al. (2006) had also done a mega study for
observing the clinical value of somatic TP53 gene mutations and concluded that TP53
gene mutations have potential uses in clinical practice. From the clinical reports of the
patients, information about following clinical factors was collected which gives us a
scenario of clinical risk factors and their effect in Pakistani breast cancer patients
especially in background of TP53 gene mutations.
Tumor size Most of the patients reported to the hospital with large tumor size even up to 9cm and
only 15% patients came to the hospitals with 0.5-2 cm tumor size. This data coincides
with findings of Usmani et al. (1996) and Siddiqui et al. (2000) who worked on
morphological features of breast carcinoma in Pakistan and found that mostly patients
were presented with tumor larger up to 9cm. In the present study, patients having TP53
gene mutations also presented with large tumor size. The study of Olivier et al. (2006)
and Overgaard et al. (2000) also coincides with the present study.
Tumor grade According to Rosen (2001) the rate of death due to grade III with 90% occurrence is eight
years. In present study, 51% of patients presented themselves to the doctors in grade III .
Usmani et al. (1996) and Siddiqui et al. (2000) postulated that presentation grade III
gives the reasons for late presentation i.e. unavailability of physicians, no female
physicians, being shy to discuss or show the breast lesions to physicians and lump being
painless. Two of three TP53 mutation positive patients (SKH-85 and SKH-86) presented
themselves in grade III, while the TP53 mutation positive patient NUS-10 presented in
grade IV. According to Baker et al (2010) there is significant association between grade
III and occurrence of TP53 mutations. Olumi et al. (1990) has postulated the reason that
due to loss of heterozygosity (LOH) of chromosome 17p (the TP53 gene is on
chromosome 17p) occurred only in grade III tumors.
84
Node involvement Sixty two percent of breast cancer patients presently studied showed the involvement of
axillary lymph nodes. Patients with TP53 mutations also showed involvement of lymph
nodes. Usmani et al. (1996), Siddiqui et al. (2000) and Alsner et al. (2000) are in
agreement with the present work.
Laterality Although there is no significant difference in involvement of right and left breast,
however right breast showed higher percentage (51%) of involvement. Although Rosen.
(2001) is not in favour of link between laterality and breast cancer survival, however
Weiss et al. (1996) studied laterality in USA and found that left breast involvement is
significant in breast cancer patients of any race or of any stage of cancer. No significant
association was observed between laterality and TP53 gene mutations.
Estrogen/ Progesterone (ER/PR) status ER+/PR+ status of hormones (Estrogen and Progesteron) was observed both in
TP53 positive and negative breast cancer patients who participated in present study. The
studies of Usmani et al. (1996), Siddiqui et al. (2000) from Pakistan also confirmed the
present results. No significant correlation between ER/PR status and TP53 mutations was
observed by Pezeshki et al. (2001) in Iranian patients. While the association of ER/PR-
negative tumors with TP53 gene mutations with poor prognosis is reported by Taneja et
al. (2010) from West.
Type of Carcinoma More then 86% patients showed infiltrating ductal carcinoma (IDC) and all the
TP53 positive patients had IDC. The results of Usmani et al. (1996), Siddiqui et al.
(2000) and Alsner et al. (2000) coincides with the results of study in this regard.
85
CONCLUSIONS
1. It is concluded that the frequency of TP53 gene mutations in DNA coding
region (5-8 exon) is low in Pakistani breast cancer patients. However
present study is in favor of the fact that the frequency of TP53 gene
mutations is different in different geographical areas, even in the same
country.
2. Genotype pro/pro and arg/pro (codon72 polymorphism) is more prevalent
as compared to arg/arg in the female breast cancer patients and normal
population of Pakistan.
3. No significant correlation between TP53 mutation and tumor
aggressiveness (nodal status, size, ER/PR and histopathology etc.) was
observed.
86
REFERENCES
Aas, T., Borresen, A.L., Geisler, S., Smith-Sorensen, B., Johnsen, H., Varhaug, J. E.,
Akslen, L. A. and Lonning, P. E., 1996. Specific P53 mutations are
associated with de novo resistance to doxorubicin in breast cancer patients.
Nat. Med., 2:811–814.
Achatz, W. I. M. and Hainaut, P., 2005. TP53 Gene and Li-Fraumeni Syndrome. Appl.
Cancer Res., 25 (2): 51-57.
Aguiar, C., Cordeiro-Silva, F., Carvalho, A. A. and Louro, I . D., 2010. Comparison of
DGGE and immunohistochemistry in the detection of TP53 variants in a
Brazilian sample of sporadic breast tumors. Mol. Biol Rep. DOI
10.1007/s11033-010-0440-4.
Ahmad, M., Khan, A. H. and Mansoor, A., 1991. The pattern of malignant tumors in
northern Pakistan. J. Pak. med. Assoc., 11: 270-273.
Ahmad, Z., Khurshid, A., Qureshi, A., Idress, R., Asghar, N. and Kayani, N.,2009.,
Breast carcinoma grading, estimation of tumor size, axillary lymph node
status, staging, and nottingham prognostic index scoring on mastectomy
specimens. Indian J. Pathol. Microbiol.. 52(4): 477-481.
Ahuja, H. G., Testa, M. P. and Cline, M. J., 1990. Variation in the protein coding region
of the human p53 gene. Oncogene, 5: 1409-1410.
Ali, S. M. A., 2009. Human papiloma virus (HPV) association and p53 mutation in oral
cavity (squamous cell carcinoma) cancers of Pakistani patients: it’s
correlation with histologic variables and disease out come. Ph.D thesis.
Baqai Medical University. Karachi.
Allred, D. C., Clark, G. M., Elledge, R., Fuqua, S. A. W., Brown, R. W., Chamness, G.
C., Osborne, C. K. and Mcguire, W. L., 1993. Association of p53 protein
expression with tumor cell proliferation rate and clinical outcome in node-
negtative breast cancer. J. natl. Cancer Inst., 85: 200-206.
Alper, M. Z., Lulecl, G. and Wong, C. J. L., 2005. Mutation analysis by the use of
temporal temperature gradient gel electrophoresis. Turk. J. med. Sci., 35:
279-282.
87
Alsner, J., Yilmaz, M., Guldberg, P., Hansen, L. L. and Overjaard, J., 2000.
Heterogeneity in the clinical phenotype of TP53 mutations in breast cancer
patients. Breast can. Res. 2(suppl.1) P4.04.
Ambrosone, C. B., Freudenheim, J. L., Graham, S., Marshal, J. R., Vena, J. E. and
Brasure, J. R., 1996. Cigarette smoking, N-acetyltransferase 2 genetic
polymorphisms, and breast cancer risk. J. Am. med. Assoc., 276:1494–501.
American Cancer Society, 1999. Cancer facts and figures. American Cancer Society.
Atlanta, GA.
Anderson, D. E., 1974. Genetic study of breast cancer; identification of a high risk group.
Cancer, 34: 1090–1097.
Andresen, I. T., Holm, R., Nesland, J. M., Heimdal, K.R., Ottestad, L. and Borresen,
A.L., 1993. Prognostic significance of TP53 alterations in breast
carcinoma. Br. J. Cancer, 68: 540-548.
Aoubala, M., Murray-Zmijewski, F., Khoury, M., Perrier, S., Fernandes, K., Prats, A.
C., Lane, D. and Bourdon, J. C. 2010. D133P53, directly transactivated by
p53, prevents p53-mediated apoptosis without inhibiting p53-mediated
cell cycle arrest. Breast Cancer Res., 12 (Suppl 1): P8.
Ara, S., Lee, P. S., Hansen, M. F. and Saya, H.,1990. Codon 72 polymorphism of the
TP53 gene. Nucl. Acids Res., 18: 4961.
Athlin, L., Beckman, G. and Beckman, L., 1996. p53 polymorphisms and haplotypes in
breast cancer. Carcinogenesis, 17: 1313–1316.
Aziz, S., Pervez, S., Khan, S., Siddiqui, T., Kayani, N., Israr, M. and Rahbar, M., 2003.
Case control study of novel prognostic markers and disease outcome in
pregnancy /lactation-associated breast carcinoma. Pathol. Res. Pract.,
199(1): 15-21.
Badar, F., Moid, I., Waheed, F., Zaidi, A., Naqvi, B. and Yunus, S., 2005. Variables
associated with recurrence in breast cancer patients-the Shaukat Khanum
Memorial experience.Asian Pac.J. Cancer Prev., 6(1): 54-57.
Baker, L. Quinlan, P.R., Patten, N., Ashfield, A., Birse-Stewart-Bell, L. J., McCowan, C.,
Bourdon, J.C., Purdie, C. A., Jordan, L.B., Dewar, J. A., Wu, L. and
Thompson, A. M., 2010. p53 mutation, deprivation and poor prognosis in
88
primary breast cancerp53m, deprivation and poor prognosis in breast
cancer. Br. J. Cancer, 102: 719-726.
Baker, S. J., Fearon, E. R., Nigro, J., Hamilton, S., Preisinger, A. C., Jessup, J. M., van-
Tuinen, P., Ledbetter, D. H., Barker, D. F., Nakamura, Y., Whyte, R. and
Vogelstein, B., 1989. Chromosome 17 Deletions and p53 gene mutations
in colorectal carcinomas. Science, 244:217-221.
Barnes, D. M., Dublin, E. A., Fisher, C. J., Levison, D.A. and Millis, R.R., 1993.
Immunohistochemical detection of p53 protein in mammary carcinoma: an
important new independent indicator of prognosis? Hum. Pathol., 24: 469-
476.
Beckman, G., Birgander, R., Sjalander, A., Saha, N., Holmberg, P. A., Kivela, A. and
Beckman, L., 1994. Is p53 polymorphism maintained by natural selection?
Hum. Hered., 44: 266-270.
Bell, D. W., Varley, J. M., Szydlo, T. E., Kang, D. H., Wahrer, D. C., Shannon, K. E.,
Eeles, R., Evans, D. G., Houlston, R., Murday, V., Narod, S., Peretz, T.,
Peto, J., Phelan, C., Zhang, H. X., Lubratovich, M., Verselis, S. J.,
Isselbacher, K. J., Fraumeni, J. F., Birch, J. M., Li, F. P., Garber, J. E. and
Harber, D. A., 1999. Heterozygous germ line CHK2 mutations in Li-
Fraumeni syndrome. Science, 24: 2528 – 2531.
Benard, J., Douc-Rasy, S. and Ahomadegbe, J. C., 2003. The TP53 family members and
human cancers. Hum. Mutat., 21:182– 191.
Bennett, C. I., Gattas, M. and Teh, B. T., 2000. The management of familial breast
cancer. The Breast, 9: 247-263.
Berns, E.M., Foekens, J.A., Vossen, R., Look, M.P., Devilee, P., Henzen- Logmans, S.
C., van-Staveren, I. L., van-Putten, W. L., Inganas, M., Meijer-van-
Gelder, M. E., Cornelisse, C., Claassen, C. J., Portengen, H., Bakker, B.
and Klijn, J. G., 2000. Complete sequencing of TP53 predicts poor
response to systemic therapy of advanced breast cancer. Cancer Res., 60:
2155–2162.
Beroud, C. and Soussi, T., 2003. The UMD-p53 database: new mutations and analysis
tools. Hum. Mutat., 21:176- 181.
89
Bertwistle, D., and Ashworth, A., 1998. Functions of the BRCA1 and BRCA2 genes.
Curr. Opin. Genet. Dev., 8: 14–20.
Bhurgri, Y., Bhurgri, A., Hassan, S. H., Zadi, S. H. M., Rahim, A., Shankarnarayan, R.
and Parkin, D. M., 2000. Cancer incidence in Karachi Pakistan, first
results from Karachi Cancer registry. Int. J. Cancer, 85: 325-329.
Bhurgri, Y., Bhurgri, A., Nishter, S. Ahmed, A., Usman, A., Pervez, S., Ahmed, R.,
Kayani, N., Riaz, A., Bhurgri, H., Bashir, I. and Hassan, S. H., 2006.
Pakistan - Country Profile of Cancer and Cancer Control 1995-2004. J.
Pak. Med. Assoc., 56 (3): 124-130.
Bhurgri, Y., Kayani, N., Faridi, N., Pervez, S., Usman, A., Bhurgri, H., Malik, J., Bashir,
I., Bhurgri, A., Hasan, S. H. and Zaidi, S.H., 2007. Patho-epidemiology of
breast cancer in Karachi '1995-1997. Asian Pac. J. Cancer Prev., 8(2):
215-220.
Biorad, 2004. The DCode universal mutation detection system, catalog number 170-
9080, TTGE. P.35.
Birch, J. M., Alston, R. D., McNally, R. J., Evans, D. G., Kelsey, A. M., Harris, M.,
Eden, O. B. and Varley, J. M., 2001. Relative frequency and morphology
of cancers in carriers of germline TP53 mutations. Oncogene, 20: 4621-
4628.
Birch, J. M., Hartley, A. L., Tricker, K. J., Prosser, J., Condie, A., Kelsey, A. M., Harris,
M., Jones, P. H., Binchy, A. and Crowther, D.,1994. Prevalence and
diversity of constitutional mutations in the p53 gene among 21 Li-
Fraumeni families. Cancer Res., 54: 1298-1304.
Blackwood, M. A. and Weber, B.L. 1998. BRCA1 and BRCA2: From molecular genetics
to clinical medicine. J. clin. Oncol., 16: 1969-1977.
Blaszyk, H., Hartmann, A., Tamura, Y., Saitoh, S., Cunningham, J. M., McGovern, R.
M., Schroeder, J. J., Schaid, D. J., Li, K., Monden, Y., Morimoto, T.,
Komaki, K., Sasa, M., Hirata, K., Okazaki, M., Kovach, J. S. and Sommer,
S. S., 1996. Molecular epidemiology of breast cancers in northern and
southern Japan: the frequency, elustering and patterns of p53 gene
90
mutations differ among these two low risk population, Oncogene, 3:2159-
2166.
Blaszyk, H., Vaughn, C.B., Hartmann, A., McGovern, R. M., Schroeder, J. J. and
Cunningham, J., 1994. Novel pattern of p53 gene mutations in an
American black cohort with high mortality from breast cancer. Lancet,
343: 1195-1197.
Boodram, L., 2004. Extraction of genomic DNA from whole blood. Department of Life
Sciences, The University of the West Indies: http://www.protocol-
online.org/
Børresen-Dale, A. L., 2003. TP53 and breast cancer . Hum. Mutat., 21: 292-300.
Børresen-Dale, A. L., Lystad, S. and Langerød, A., 1997. Temporal temperature gradient
gel electrophoresis on the DCode system. Biol. Rad. Bull., 2133: 12–13.
Bougeard, G., Desurmont, B. S., Tournier, I., Vasseur, S., Martin, C., Brugieres, L.,
Chompret, A., Paillerets, B. B., Lyonnet, L. D., Pellie, C. B. and
Frebourg, T., 2006. Impact of the MDM2 SNP309 and p53 Arg72Pro
polymorphism on age of tumour onset in Li-Fraumeni syndrome. J. med.
Genet., 43: 531–533.
Bourdon, J. C., Fernandes, K.,Murray-Zmijewski, F., Liu, G., Diot, A., Xirodimas, D. P.,
Saville, M. K.and Lane, D. P. 2005. p53 isoformscan regulate p53
transcriptional activity. Genes Dev., 19: 2122–2137.
Buckbinder, L., Talbott, R., Valesco-Miguel, S., Takenaka, I., Faha, B., Seizinger, B. R.,
and Kley, N., 1995. Induction of the growth IGF-binding protein 3 by p53.
Nature, 377: 646–649.
Bukhari, M. H., Niazi, S., Anwar, M., Chaudhry, N. A., 2008. Naeem S. Prognostic
significance of new immunohistochemistry scoring of p53 protein
expression in cutaneous squamous cell carcinoma of mice. Ann. Acad. Sci.
1138: 1-9.
Bukhari, M. H, Niazi, S. and Chaudhry, N. A., 2009. Relationship of
immunohistochemistry scores of altered p53 protein expression in relation
to patient's habits and histological grades and stages of squamous cell
carcinoma. J. Cutan. Pathol., 36(3): 342-349.
91
Buller, R. E., Skilling, J. S., Kaliszewski, S., Niemann, T. and Anderson, B., 1995.
Absence of significant germ line p53 mutations in ovarian cancer patients.
Gynecol. Oncol., 58 (3): 368-374.
Buyru, N., Tigli, H. and Dalay, N., 2003. p53 codon 72 polymorphism in breast cancer.
Oncol. Rep., 10:711- 714.
Calbiochem. 2009. www. Calbiochem.com/ p53.
Callahan, R., 1992. p53 mutations, another breast cancer prognostic factor. J. natl.
Cancer Inst., 84: 826-827.
Campomenosi, P., Monti, P., Aprile, A., Abbondandolo, A., Frebourg, T.,Gold, B.,
Crook, T., Inga, A., Resnick, M. A., Iggo, R. and Fronza, G., 2001. p53
mutants can often transactivate promoters containing a p21 but not Bax or
PIG3 responsive elements. Oncogene, 20: 3573–3579.
Caron-de- Fromentel, C. and Soussi, T., 1992. The p53 tumor suppressor gene: a model
for investigating human mutagenesis. Genes Chrom. Cancer, 4:1-15.
Cattoretti, G., Rilke, F., Andrealo, S., D’ Amato, L. and Delia, D., 1988. p53 expression
in breast cancer. Int. J. Cancer, 41: 178-183.
Chang, F., Syrjanen, S. and Kurvinen, K., 1993. The tumor suppressor gene a common
cellular target in human carcinogenesis. Am. J. Gastroenterol, 88: 174-
186.
Chen, P. L., Chen, Y. M., Bookstein, R. and Lee, W. H., 1990. Genetic mechanisms of
tumor suppression by the human p53 gene. Science, 250: 1576-1580.
Chen, J., Ng, S. M., Chang, C., Zhang, Z., Bourdon, J. C., Lane, D. P. and Peng, J. 2009.
p53 isoform D113p53 is a p53 target gene that antagonizes p53 apoptotic
activity via BclxL activation in zebrafish. Genes Dev., 23: 278–290.
Cho, Y. J., Gorina, S., Jeffrey, P. D. and Pavletich, N. P., 1994. Crystal structure of a
p53 tumor suppressor DNA complex: understanding tumorigenic
mutations. Science, 265: 346-355.
CIA The World Fact book 2005. Pakistan. http://www.odei.gov.
cia/publications/factbook/geos/pk.html.
92
Colditz, G .A., Willett, W. C. and Hunter, D. J., 1993., Family history, age, and risk of
breast cancer. Prospective data from the Nurses Health Study. J. Am. med.
Assoc., 270 (3): 338-343.
Colditz, G. A., Hankinson, S. E. and Hunter, D. J., 1995. The use of estrogens and
progestins and the risk of breast cancer in postmenopausal women. N.
Engl. J. Med., 332:1589-1593.
Collaborative Group on Hormonal Factors in Breast Cancer. 1996. Breast cancer and
hormonal contraceptives: collaborative reanalysis of individual data on
p53. 297 women with breast cancer and 239 women without breast cancer
from 54 epidemiological studies. Lancet, 347:1713-1727.
Connor, F., Bertwistle, D., Mee, P. J., Ross, G. M., Swift, S., Grigorieva, E., Tybulewicz,
V. L. and Ashworth, A., 1997. Tumorigenesis and a DNA repair defect in
mice with a truncating BRCA2 mutation. Nature Genet., 17: 423–430.
Conway, K., Sharon, N., Edmiston, Cui, L., Drouin, S. S., Pang, J., He, M., Tse, C.,
Geradts, J., Dressler, L.,Liu, E. T., Millikan, R. and Newman, B., 2002.
Prevalence and spectrum of p53 mutations associated with smoking in
breast cancer. Cancer Res., 62:1987- 1995.
Crawford, L. V., Pim, D. C., Gurney, E. G., Goodfellow, P. and Taylor-Papadimitriou, J.,
1981. Detection of a common feature in several human tumor cell lines-a
53,000 dalton protein. Proc. natl. Acad. Sci., 78:41-45.
Crawford, L., 1983. The 53,000-dalton cellular protein and its role in transformation. Int.
Rev. exp. Pathol., 25: 1-50.
Crook, T., Brooks, L. A., Crossland, S., Osin, P., Barker, K. T., Waller, J., Philp, E.,
Smith, P. D., Yulug, I., Peto, J., Parker, G., Allday, M. J., Crompton, M.
R. and Gusterson, B. A., 1998. p53 mutation with frequent novel codons
but not a mutator phenotype in BRCA1- and BRCA2-associated breast
tumors. Oncogene, 17: 1681– 1689.
Crook, T., Crossland, S., Crompton, M. R., Osin, P. and Gusterson, B. A., 1997. p53
mutations in BRCA1 associated familial breast cancer. Lancet, 350: 638–
639.
93
Cooper, G. M., (2000). The cell: a molecular approach "Chapter 14: The Eukaryotic Cell Cycle.
Washington, D.C: ASM Press. http://www.ncbi.nlm.nih.gov/books/NBK9876/.
Cuzick, J., 2008. Assessing risk for breast cancer. Breast Caner. Res., 10 (suppl. 4):S13.
Daniel, A. H., John, E. L., Michele, M. M., Wendy, V., Benjamin, S. H., Harris and John,
D. B., 1989. Breast cancer in women with scoliosis exposed to multiple
diagnostic X rays. J. natl. cancer Inst., 81 (17): 1307-1312.
Deb, S., and Palit, S., 2003. P53 protocols, Mutations analysis of p53 in human tumors. .
In: Methods in molecular biology 234: 220-223. Totawa, New Jersey,
07512, USA.
Debra, G. B. and Leonard, A. B. 2007. Molecular pathology in clinical practice.
Chap.22: 251. Springer, Spring Street, New York, 10013. USA.
Delacalle-Martin, O., Fabregat, V., Romero, M., Soler, J., Vives, J. and Yague, J., 1990.,
Accll polymorphism of the p53 gene. Nucl. Acids Res, 18: 4963.
Denissenko, M. P., 1996. Preferential formation of benzo(a) pyrene adducts at the lung
cancer mutational hot spot in p53. Science, 274: 430-432.
Dicomo, C. J., Gaiddon, C. and Prives, C., 1999. p73 function is inhibited by tumor-
derived p53 mutants in mammalian cells. Mol. Cell. Biol., 19: 438–1449.
Diller, L., Kassel, J., Nelson, C. E., Gryka, M. A., Litwak, G., Gebhardt, M., Bressac, B.,
Ozturk, M., Baker, S. J., Vogelstein, B. and Friend, S. H., 1990. p53
functions as a cell cycle control protein in osteosarcomas. Mol. Cell Biol.,
10: 5772-5781.
Dokianakis, D. N., Koumantaki, E., Billiri, K. and Spandidos. D. A., 2002. p53 codon 72
polymorphism as a risk factor in the development of HPV-associated non-
melanoma skin cancers in immunocompetent hosts. Int, J. mol. Med., 5:
405-409.
Dominguez, G., Silva, J. M., Silva, J., Garcia, J. M., Sanchez, A., Navarro, A., Gallego,
I., Provencio, M., Espana, P. and Bonilla, F. 2001. Wild type p73
overexpression and high-grade malignancy in breast cancer. Breast
Cancer Res. Treat., 66:183-190.
94
Done a, S. J., Arneson, C. R., Ozcelik, H., Redston, M. and Andrulis, I. L., 2001. P53
protein accumulation in non-invasive lesions surrounding p53 mutation
positive invasive breast cancers. Breast Cancer Res. Treat., 65:111–118.
Done b, S. J., Eskandarian, S., Bull, S., Redston, M. and Andrulis, I. L., 2001. p53
missense mutations in microdissected high-grade ductal carcinoma in situ
of the breast. J. natl. Cancer Inst., 93: 700–704.
Dumaz, N., Stry, A., Soussi, T., Dayagrosjean, L. and Sarasin, A., 1994. Can we predict
solar ultraviolet radiation as the causal evnt in human tumors by analyzing
the mutation spectra of the p53 gene? Mutat. Res., 307: 375-386.
Dumont, P., Leu, J. I., Della, Pietra. A. C., George, D. L. and Murphy, M., 2003. The
codon 2 polymorphic variants of p53 have markedly different apoptotic
potential. Nature Genet., 33:357-365.
Dworniczak, D. B., Wolff, J., Poremba, C., Schafer, L. K., Ritter, J., Gullotta, F., Jirgens,
H. and Becker, W., 1996. A new germline TP53 gene mutation in Li-
Fraumeni syndrome family. Cancer, 32A (8): 1359-1365.
Eachkoti, R., Hussain, I., Afroze, D., Aziz, A. S., Jan, M., Shah, A. Z., Das, C. B. and
Siddiqi, A. M., 2007. BRCA1 and TP53 mutation spectrum of breast
carcinoma in an ethnic population of Kashmir, an emerging high-risk area.
Cancer Lett., 248: 308–320.
El-Bayoumy, K. 1992. Environmental carcinogens that may be involved in human breast
cancer etiology. Chem. Res. Toxicol., 5: 585–590.
El-Deiry, W.S., Tokino, T., Velculescu, V. E., Levy, D. B., Parsons, R., Trent, J.M., Lin,
D., Mercer, W. E., Kinzler, K.W. and Vogelstein, B., 1993. WAF1, a
potential mediator of p53 tumor suppression. Cell, 75: 817–825.
Evans, D. G., Birch, J. M., Thorneycroft, M. and McGown, G. J. M., 2002. Low rate of
TP53 germline mutations in breast cancer/sarcoma families not fulfilling
classical criteria for Li-Fraumeni syndrome. J. med. Genet., 39: 941-944.
Faheem, M., Khurram, M., Jafri, I. A., Mehmood, H., Hasan, Z., Iqbal, G. S., Maqsood,
F. and Jafri, S. R. A. 2007. Risk factors for breast cancer in patients
treated at NORI Hospital, Islamabad. J. Pak. Med. Assoc., 57: 242-245.
95
Fearon, E. R. and Jones A. P., 1992. Progressing towards a molecular description of
colorectal cancer development. Fed. Am. Soc. exp. Biol., 6: 2783-2790.
Feinstein, E., Gale, R. P., Reed, J. and Canaani, E., 1992. Expression of the normal p53
gene induces differentiation of k562 cells. Oncogene, 7: 1852-1857.
Feki, A. and Irminer-Finger, I., 2004. Mutational spectrum of TP53 mutations in primary
breast and ovarian tumors. Critic. Rev. Oncol. Hematol., 52: 103-116.
Felix, C. A., Brown, D. L., Mitsudomi, T., Ikagaki, N., Wong, A., Wasserman, R.,
Womer, R.B. and Biegel, J. A., 1994. Polymorphism at codon 36 of the
p53 gene. Oncogene, 9: 327-328.
Felley-Bosco, E., Weston, A., Cawley, H. M., Bennett, W. P. and Harris, C. C., 1993.
Functional studies of a germ-line polymorphism at codon-47 within the
p53 gene. Am. J. Hum. Genet., 53: 752-759.
Ferguson, A.T., Evron, E., Umbricht, C. B., Pandita, T. K., Chan, T. A., Hermeking, H.,
Marks, J. R., Lambers, A. R., Futreal, P. A., Stampfer, M. R., Sukumar, S.
2000. High frequency of hypermethylation at the 14-3- 3σ locus leads to
gene silencing in breast cancer. Proc. Natl Acad. Sci. USA., 97: 6049-
6054.
Ferlay, J., Bray, F., Pisane, P. and Parkin, D. M., 2000. Cancer incidence,mortality and
prevalence worldwide. Globocan (CDROM).IARC Press.
Feuer, E. J., Wun, L. M. and Boring, C. C., 1993. The life time risk of developing breast
cancer. J. natl. Cancer Inst., 85: 892-897.
Fischer, S. and Lerman, L. 1983. DNA fragments differing by single base-pair
substitutions are separated in denaturing gradient gels: correspondence
with melting theory. Proc. natl. Acad. Sci., 80: 1579–1583.
Frebourg, T., Barbier, N., Yan, Y. X., Garber, J. E., Dreyfus, M., Fraumeni, J., Li, F. P.
and Friend, S. H., 1995. Germ-line p53 mutations in 15 families with Li-
Fraumeni syndrome. Am. J. Hum. Genet., 56: 608-615.
Friedlander, P., Haupt, Y., Prives, C. and Oren, M. 1996. A mutant p53 that discriminates
between p53-responsive genes cannot induce apoptosis. Mol. Cell Biol.,
16: 4961–4971.
96
Friedman, L. S., Thistlethwaite, F. C., Patel, K. J., Yu, V. P., Lee, H., Venkitaraman, A.
R., Abel, K. J., Carlton, M. B., Hunter, S. M., Colledge, W. H., Evans, M.
J. and Ponder, B. A., 1998. Thymic lymphomas in mice with a truncating
mutation in BRCA2. Cancer Res., 58: 1338–1343.
Fujiwara, T., Grimm, E. A., Mukhopadhyay, T., Zhang, W. W., Owenschaub, L. B. and
Roth, J. A., 1994. Induction of chemosensitivity in human lung cancer
cells in vivo by adenovirus-mediated transfer of the wild-type p53 gene.
Cancer Res., 54: 2287- 2291.
Garber, J. E., Burke, E. M., Lavally, B. L., Billett, A. L., Sallan, S. E., Scott, R. M.,
Kupsky, W. and Li, F. P., 1990. Choroid plexus tumors in the breast
cancer-sarcoma syndrome. Cancer (Phila.), 66: 2658-2660.
Garber, J. E., Goldstein, A. M., Kantor, A. F., Dreyfus, M. G. and Fraumeni, J. F. J.,
1991. Follow-up study of twenty-four families with Li-Fraumeni
syndrome. Cancer Res., 51: 6094-6096.
Gasco, M., Yulug, G. I. and Crook, T., 2003. TP53 Mutations in familial breast cancer:
functional aspects. Human mutat., 21: 301-306.
Geisler, S., Lonning, P. E., Aas, T., Johnsen, H., Fluge, O., Haugen, D. F., Lillehaug, J.
R., Akslen, L. A., and Borresen-Dale A. L., 2001. Influence of TP53 gene
alterations and c-erbB-2 expression on the response to treatment with
doxorubicin in locally advanced breast cancer. Cancer Res., 61: 2505–
2512.
Gentile, M., Ahnstrom, M., Schon, F. and Wingren, S. 2001. Candidate tumour
suppressor genes at 11q23-q24 in breast cancer: evidence of alterations in
PIG8, a gene involved in p53-induced apoptosis. Oncogene, 20: 7753-
7760.
Ghasemi, N., Karimi-Zarchi, M., Mortazavi-Zadeh, M., R., and Atash-Afza, A. 2010.
Evaluation of the frequency of TP53 gene codon 72 polymorphisms in
Iranian patients with endometrial cancer. Cancer Genet.Cytogenet.
196(2):167-170.
Gilani, G.M. and Kamal, S., (2004). Risk factors for breast cancer in Pakistani women
aged less than 45 years. Ann. Hum. Bio. 31, (4): 398-407.
97
Ginsburg, M. O. Bukhari, R. M., Aziz, Z.,Young, R., Lynch, H., Ghadirian, P., Robidoux,
A., Londono, J., Vasquez, G., Gomes, M., Costa, M. M., Dimitrakakis, C.,
Gutierrez, G., Pilarski, R., Royer, R. and Narod, A. S., 2009. The
prevalence of germ-line TP53 mutations in women diagnosed with breast
cancer before age 30. J. Hum. Genet., 52: 694–697.
Glazko, V. G., Babenko, N. V., Koonin, V. E., and Rogozin, B. I., 2006. Mutational
hotspots in the TP53 gene and, possibly, other tumor suppressors evolve
by positive selection. Biol. Direct, 1 (1): 4.
Grey, H., 1918. Anatomy of the human body. www.Bartleby.com.
Greenblat, M. S., Bennett, W. P., Hollstein, M. and Harris, C. C., 1994. Mutations in the
p53 tumor suppressor gene: clues to cancer etiology and molecular
pathogenesis. Cancer Res., 54: 4855-4878.
Greenblatt, M. S., Chappuis, P. O., Bond, J. P., Hamel, N. and Foulkes, W. D., 2001.
TP53 mutations in breast cancer associated with BRCA1 or BRCA2 germ-
line mutations: distinctive spectrum and structural distribution. Cancer
Res., 61: 4092–4097.
Grimberg, J., Nawoschik, S., Belluscio, L., McKee, R., Turck, A., and Eisenberg, A.,
1989. A simple and efficient non-organic procedure for the isolation of
genomic DNA from blood. Nucl. Acids Res.,17: 8390.
Hahn, M., Serth, J., Fislage, R., Wolfes, H., Allhoff, E., Jonas, V. and Pingoud, A., 1993.
Polymerase chain reaction detection of a highly polymorphic VNTR
segment in intron 1 of the human p53 gene. Clin. Chem., 39: 549–550.
Hainaut, P. and Hollstein, M., 2000. p53 and human cancer: the first ten thousand
mutations. Adv. Cancer Res., 77: 81-137.
Hall, I. J., Moorman, P. G., Millikan and R. C., Newman, B., 2005. Comparative analysis
of breast cancer risk factors among African-American women and White
women. Am J Epidemiol., 161: 40-51.
Hamroun, D., Kato, S., Ishioka, C., Claustres, M., Beroud, C. and Soussi, T. 2006. The
UMD TP53 database and website: update and revisions. Hum. Mutat.,
27(1):14-20.
98
Hartley, A. L., Birch, J. M., Tricker, K., Wallace, S. A., Kelsey, A. M., Harris, M. and
Jones, P. H., 1993. Tumor in the Li-Fraumeni cancer family syndrome.
Cancer Genet. Cytogenet., 67: 133-135.
Hartmann, A., Blaszyk, H., Kovach, J. S. and Sommar, S. S., 1997. The molecular
epidemiology of P53 gene mutations in human breast cancer. Trends
Genet., 13: 27-33.
Hartmann, A., Blaszyk, H., Saitoh, S., Tsushima, K., Tamura, Y., Cunningham, J. M.,
McGovern, R. M., Schroeder, J. J., Sommer, S. S., and Kovach, J. S.,
1996. High frequency of p53 gene mutations in primary breast cancers in
Japanese women, a low-incidence population, Br. J. Cancer, 73: 896–901.
Hedau, S., Jain, N., Husain, A. S., Mandal. K. A., Ray, G., Shahid, M., Kant, R., Gupta,
V., Shukla, K. N. Deo, V. S. and Das, C. B., 2004. Novel germline
mutations in breast cancer susceptibility genes BRCA1, BRCA2 and p53
gene in breast cancer patients from India. Breast Cancer Res. Treat., 88:
177–186.
Hemminki, K. and Granström, C., 2002. Morphological types of breast cancer in family
members and multiple primary tumors: is morphology genetically
determined? Online http:// breast-cancer research.com/content/4/4/R7.
Henderson, B. E., Ross R. L. and Ludd, H., 1985. Do regular ovulatory cycles increase
breast cancer risk? Cancer, 56:1206-1208.
Hill, K. A. and Sommer, S. S., 2002. p53 as a mutagen test in breast cancer. Environ.
Mol. Mutagen, 39: 216–227.
Hirata, K., Okazaki, M., Kovach, J. S. and Sommer, S. S., 1996. Molecular epidemiology
of breast cancers in northern and southern Japan: the frequency, clustering,
and patterns of p53 gene mutations differ among these two low-risk
populations, Oncogene, 3: 159–2166.
Hisada, M., Garber, J. E. and Fung, C. Y., 1998. Multiple primary cancers in families
with Li- Fraumeni syndrome. J. Natl. Cancer Inst., 90(8): 606- 611.
Ho, G. H., Calvano, J. E., Bisogna, M., Borgen, P. I., Rosen, P. P., Tan, L. K. and
VanZee, K. J., 2000. In microdissected ductal carcinoma in situ, HER-
99
2/neu amplification, but not p53 mutation, is associated with high nuclear
grade and comedo histology. Cancer, 89: 2153– 2160.
Hofseth, L. J. Hussain, S. P. and Harris, C. C., 2004. p53: 25 years after its discovery.
Trends pharmacological Sci., 25 (4). 171-181.
Hoeijmakers, J. H. J., 2001. Genome maintenance mechanisms for preventing cancer,
Nature, 411: 366–374.
Hollstein, M., Rice, K., Greenblatt, M. S., Soussi, T., Fuchs, R., Sorlie, T., Hovig, E.,
Smith-Sorensen, B., Montesano, R., and Harris, C. C., 1994. Database of
p53 gene somatic mutations in human tumors. Nucl. Ac. Res., 22: 3551–
3555.
Hulka, B. S., 1991. ASPO Distinguished Achievement Award Lecture. epidemiological
studies using biological markers: issues for epidemiologists. Cancer
Epidemiol. Biomarkers Prev., 1: 13–1 9.
IARC (International Agency of Research on Cancer TP53 Mutation Database, 2011:
http://p53.free.fr/Database/p53_mutation_dist.pdf.
Deb, S., and Palit, S., 2003. In: Methods in molecular biology, Chap 15. P53 protocols,
Mutations analysis of p53 in human tumors. 234:220-223. Totawa, New
Jersey, 07512. USA.
Jain, N., Singh, V., Hedau, S., Kumar, S., Daga, M. K., Dewan, R., Murthy, N. S, Husain,
S. A. and Das, B. C., 2005. Infection of human papillomavirus type18 and
p53 codon 72 polymorphism in lung cancer patients from India. Chest,
128: 3999- 4007.
Jamal, S., Mushtaq, H., Mubarik, A. and Malik, T. M., 2009. Estrogen receptor,
progesterone receptor, HER2/neu, P53 and Ki-67 status of male breast
carcinomas in Pakistan. Asian Pac. J. Cancer Prev., 10(6): 1067-1070.
Jardines, L., Goyal, S., Fisher, P., Weitzel, J. and Royce, M., 2010. Risk factors,
screening, genetic testing, and prevention. In: Cancer management: a
multidisciplinary approach. volume 12, CMP Medica, New York, USA.
Jerry, J. D., Minter, M. L., Becker, A. K. and Blackburn, C. A., 2002. Hormonal control
of p53 and chemoprevention. Breast Cancer Res., 4: 91-94.
100
Jin, X., Wu, X., Roth, J. A., Amos, C. I., King, T. M., Branch, C., Honn, S. E. and Spitz,
M. R. 1995. Higher lung cancer risk for younger African-Americans with
the Pro/Pro p53 genotype. Carcinogenesis.; 16(9): 2205- 2208.
Jussawalla, D. J. and Jain, D. K., 1977. Breast cancer and religion in greater Bombay
women: an epidemiological study of 2130 women over a 9-year period.
Br. J. Cancer, 36: 634–638.
Kakarala, M., Rozek, L., Cote, M., Liyanage, S. and Brenner, D. E. 2010. Breast cancer
histology and receptor status characterization in Asian Indian and
Pakistani women in the U.S. - a SEER analysis. BMC Cancer, 10: 191.
Kandioler-Eckersberger, D., Ludwig, C., Rudas, M., Kappel, S., Janschek, E., Wenzel,
C., Schlagbauer-Wadl, H., Mittlbock, M., Gnant, M., Steger, G. and
Jakesz. R., 2000. TP53 mutation and p53 overexpression for prediction of
response to neoadjuvant treatment in breast cancer patients. Clin. Cancer
Res., 6: 50–56.
Kastan, M. B. and Kuerbitz, S. J., 1993. Control of G1 arrest after DNA damage.
Environ. Hlth Perspect., 5: 55–58.
Khadang, B., Fattahia, J. M., Taleib, A., Dehaghanic, S. A. and Ghaderi, A., 2007.
Polymorphism of TP53 codon 72 showed no association with breast
cancer in Iranian women. Cancer Genet. Cytogenet., 173: 38- 42.
Khoury, P. M. and Bourdon, J., 2010. The isoforms of p53 protein. Cold Spring Harb.
Perspect. Biol. 2(3): a000927.
Khaliq, S., Hameed, A., Khaliq, T., Ayub, Q., Qamar, R., Mohyuddin, A., Mazhar, K.
and Qasim-Mehdi S., 2000. P53 mutations, polymorphisms, and
haplotypes in Pakistani ethnic groups and breast cancer patients. Genet.
Test., 4(1): 23- 29.
Khaliq, T., Afghan, S., Naqi, A., Haider, M. and Islam, A. 2001. P53 mutations in
carcinoma breast - a clinicopathological study. J. Pak. med. Assoc., 51(6):
210-213.
Knudsen, A. G., 1971. Mutation and Cancer: statistical study of retinoblastoma. Proc.
natl. Acad. Sci. USA., 68: 820– 823.
101
Kropp, S. and Claude, J. 2002. Active and Passive Smoking and Risk of Breast Cancer by
age 50 year among German women.Am. J. Epdemiol. 156(7): 616-626.
Krypuy, M., Ahmed, A. A., Etemadmoghadam, D., Hyland, J. S., Australian Ovarian
Cancer Study Group, DeFazio, A., Fox, B. S., Brenton, D. J., Bowtell, D.
D. and Dobrovic, A., 2007. High resolution melting for mutation scanning
of TP53 exons 5–8. BMC Cancer, 7: 168.
Kumar, V., Cotran, R. and Robbins, S. 1997. The breast. Etiology and pathogenisis. In:
Pathologic basis of diseases. 8th ed., Chapter 23, pp.450-455.
Kuroda, Y., Tsukino, H., Nakao, H., Imai, H., Katoh, T., 2003. p53 codon 72
polymorphism and urothelial cancer risk. Cancer Lett., 189: 77- 83.
Lalloo, F., Varley, J. and Ellis. D., 2003. Prediction of pathogenic mutations in patients
with early-onset breast cancer by family history. Lancet, 361: 1101– 1102.
Lalloo, F., Varley, J. and Moran, A., 2006. BRCA1, BRCA2 and TP53 mutations in very
early-onset breast cancer with associated risks to relatives, Eur. J. Cancer,
42: 1143– 1150.
Lambe, M., Cerrato, R., Askling, J. and Hsieh C. C., 2004. Maternal breast cancer risk
after the death of a child. Int. J. cancer,110:763–766.
Lane, D., Shields, M. T., Ullrich, S. J., Appella, E. and Mercer, W. E., 1992. Growh
arrest induced by wild-type p53 protein blocks cells prior to or near the
restriction point in late G1 phase. Proc. natl. Acad. Sci. USA., 89: 9210-
9214.
Langerød, A., Bukholm, K. R. I., Bregård, A., Lønning, E. A., Andersen, I. T., Rognum,
O. T., Meling, I. G., Lothe, A. R., and Børresen-Dale, L. S., 2002. The
TP53 codon 72 polymorphism may affect the function of TP53 mutations
in breast carcinomas but not in colorectal carcinomas. Cancer Epidemiol.
Biomark. Prevent., 11: 1684-1688.
Lavigueur, A., Maltby, V., Mock, D., Rossant, J., Pawson, T. and Bernstein, A., 1989.
High incidence of lung, bone, and lymphoid tumors in transgenic mice
overexpressing mutant alleles of the p53 oncogene. Mol. Cell. Biol., 99:
3982- 3991.
102
Lazar, V., Hazard, F., Bertin, F., Janin, N., Bellet, D. and Bressac, B., 1993. Simple
sequence repeat polymorphism within the p53 gene. Oncogene, 8: 1703-
1705.
Lee, H., Tainer, A. H., Friedman, L. S., Thislethwaite, F. C., Evans, M. J., Ponder, B. and
Venkitaraman, A. R., 1999. Mitotic checkpoint inactivation fosters
transformation in cells lacking the breast cancer susceptibility gene,
BRCA2. Mol. Cell, 4: 1– 10.
Leiros, G. J., Galliano, S. R., Sember, M. E., Kahn, T., Schwarz, E. and Eiguchi, K.,
2005. detection of human papillomavirus DNA and p53 codon 72
polymorphism n prostate carcinomas of patients from Argentina. BMC
Urol., 2490: 5-15.
Levine, A. J., 1997. p53, the cellular gatekeeper for growth and division. Cell. 88:323-
331.
Levine, A. J., Momand, J. and Finlay, C. A., 1991. The p53 tumour suppressor gene.
Nature, 351: 453-456.
Levine, A. J. and Oren, M. 2009. The first 30 years of p53: growing ever more complex.
Nat Rev Cancer. 9(10): 749–758.
Li, F. P. and Fraumeni, J. F., 1969a. Rhabdomyosarcoma in children: epidemiologic study
and identification of a familial cancer syndrome. J. natl. Cancer Inst., 43:
1365-1373.
Li, F. P., and Fraumeni, J. F. Jr., 1969b. Soft tissue sarcomas, breast cancer, and other
neoplasms. A familial syndrome? Ann. Intern. Med., 71: 747-752.
Li, F. P. and Fraumeni, J. F. J., 1992. Predictive testing for inherited mutations in cancer-
susceptibility genes. J. clin. Oncol., 10: 1203- 1204.
Li, F. P. and Fraumeni, J. F. Jr., Mulvihill, J. J., Blattner, W. A., Dreyfus, M. G., Tucker,
M. A. and Miller, R. W., 1988. A cancer family syndrome in twenty-four
kindreds. Cancer Res., 48: 5358- 5362.
Li, F. P., Garber, J. E., Friend, S. H., Strong, L. C., Patenaude, A. F., Juengst, E. T.,
Reilly, P. R., Correa, P. and Fraumeni, J. F. Jr., 1992. Recommendations
on predictive testing for germ line p53 mutations among cancer-prone
individuals. J. natl. Cancer Inst.,84: 1156- 1160.
103
Li, T., Lu, Z. M., Guo, M., Wu, Q. J., Chen, K. N., Xing, H. P., Mei, Q. and Ke, Y.,
2002. p53 codon 72 polymorphism (C/G) and the risk of human
papillomavirus-associated carcinomas in China. Cancer, 95: 2571-2576.
Liede, A., Malik, A. I., Aziz, Z., Rios, L. D. P., Kwan, E. and Narod, A. S., 2002.
Contribution of BRCA1 and BRCA2 mutations to breast and ovarian
cancer in Pakistan. Am. J. Gent., 71: 595- 605.
Lilbbe, J., von-Ammon, K., Watanabe, K., Hegi, M. E. and Kleihues, P., 1995. Familial
brain tumour syndrome associated with a ~53 germline deletion of codon
236. Brain, 5: 15- 23.
Lopez-Saez, J., Gómez-Biondi, V., Santamaría-Rodriguez, G., Dominguez-Villar, M.,
Amaya-Vidal, A., Lorenzo-Peñuelas, A. and Senra-Varela, A., 2010.
Concurrent overexpression of serum p53 mutation related with
Helicobacter pylori infection. J. Exp. Clin. Cancer Res., 29(1): 29-65.
Lovell, D. P., 2006. Population genetics of induced mutations. Environ. Mol. Mutag., 25:
65- 73.
Lovell, W. W., Winter, R., B. and Morrissy, R. T., 2006. Pediatric Orthopaedics. Chap.
14. pp. 496. Lippincott Williams and Wilcins, Philadelphia, PA 19106,
USA.
Lowe, S. W., Ruley, H. E., Jacks, T. and Housman, D. E., 1993. p53-dependent
apoptosis modulates the cytotoxicity of anticancer agents. Cell, 74: 957-
967.
Lukas, J., Groshen, S., Saffari, B., Niu, N., Reless, A., Wen, W. H., Felix, J., Jones, L.
A., Hall, F. L. and Press, M. F., 1997. WAF1/Cip1 gene polymorphism
and expression in carcinomas of the breast, ovary and endometrium. Am.
J. Pathol. 150: 167-175.
MacMahon, B., Trichopoulos, Brown, D., Anderson, A. P., Aoki, K., Cole, P., de Waard,
F., Kanrantemi, T., Morgan, R. W., Purde, M., Ravnihar, B., Stormby, N.,
Westland, K. and Woo, N. C. 1982. Age at menarche, probability of
ovulation and breast cancer risk. Int. J. Cancer, 29: 13-16.
104
Magewu, A. N. and Jones A. P., 1994. Ubiquitous and tenacious methylation of the CpG
Site in codon 248 of the p53 gene may explain its frequent appearance as a
mutational hot spot in human cancer. Mol. Cell Biol.,14 (6): 4225-4232.
Makwane, N. and Saxena, A., 2009. Study of mutations in p53 tumor suppressor gene in
human sporadic breast cancer. Ind. J. Clinic. Biochem., 24 (3) 223-228.
Malik, A. F., Ashraf, S., Kayani, A. M., Jiang, G. W., Mir, A., Ansari, M., Baloch, A. I.,
and Rafshan, S., 2008. Contribution of BRCA1 germline mutation in
patients with sporadic breast cancer. Int. Sem. Surg. Oncol., 5:21.
Malik, I. A., 2002. Clinico-pathological features of breast cancer in Pakistan. J. Pak.
med. Assoc., 52 (3): 100-104.
Malkin, D., Li, F. P., Strong, L. C., Fraumeni, J. F., Nelson, C. E., Kim, K. D., Kassel, J.,
Gryka, M. A., Bischoff, F. Z., Tainsky, M. A. and Friend, S.H., 1990.
Germ Line p53 mutations in a familial syndrome of breast cancer,
sarcomas, and other neoplasms. Science. 250: 1233-1238.
Maltzman, W. and Czyzyk, L., 1984. UV irradiation stimulates levels of p53 cellular
tumor antigen in nontransformed mouse cells. Mol. Cell Biol., 4 (9):
1689–1694.
Mamoon, N., Sharif, M. A., Mushtaq, S., Khadim, M. T. and Jamal, S., 2009. Breast
carcinoma over three decades in northern Pakistan. Are we getting
anywhere? J. Pak. med. Assoc., Suppl., 2:279-282.
Maqsood, B., Zeeshan, M. M., Rehman, F., Aslam, F., Zafar, A., Syed, B., Qadeer, K.,
Ajmal, S. and Imam, S. Z., 2009. Breast cancer screening practices and
awareness in women admitted to a tertiary care hospital of Lahore,
Pakistan. Pak Med Assoc., 59(6):418-421
Marin, M. C., Jost, C. A., Brooks, L. A., Irwin, M. S., O’Nions, J., Tidy, J. A., James, N.,
McGregor, J. M., Harwood, C. A., Yulug, I. G., Vousden, K. H., Allday,
M. J., Gusterson, B., Ikawa, S., Hinds, P. W., Crook, T. and Kaelin, W. G.
J. 2000. A common polymorphism acts as an intragenic modifier of
mutant p53 behaviour. Nat. Genet., 25: 47–54.
Martin, M. A., Kanetsky, A. P., Amirimani, B., Colligon, A. T., Athanasiadis, G. , Shih,
A. H., Gerrero, M. R., Calzone, K., Rebbeck, R. T. and Weber L. B.,
105
2003. Germline TP53 mutations in breast cancer families with multiple
primary cancers: is TP53 a modifier of BRCA1? J. med. Gen., 40 (4): e34.
Matakidou, A., Eisen, T. and Houlston, R. S., 2003. TP53 polymorphisms and lung
cancer risk a systemic review and meta-analysis. Mutagenesis, 18: 377-
385.
Matlashewski, G., Lamb, P., Pim, D., Peacock, J., Crawford, L.and Benchimol, S., 1984.
Isolation and characterization of a human p53 cDNA clone: expression of
the human p53 gene. Embo. J., 3 (13): 3257–3262.
Matlashewski, G., Pim, D., Banks, L. and Crawford, L., (1987). Alternative splicing of
human p53 transcripts. Oncogene Res., 1: 77-85.
McBride, O.W., Merry, D. and Givol, D., 1986. The gene for human p53 cellular tumor
antigen is located on chromosome 17, short arm 15p13. Proc.natl. Acad.
Sci. USA., 83: 130-134.
McDonald, F. and Ford, C. H. J., 1991. Oncogenes and tumor supressor genes.
Information Press, Oxford, pp.1- 16.
McInnis, M. G., 1996. Anticipation: an old idea in new genes. Am. J. Hum. Genet., 59:
973– 979.
McInnis, M. G., McMahon, F. J., Chase, G. A., Simpson, S. G., Ross, C. A. and DePaulo
J. R., 1993. Anticipation in bipolar affective disorder. Am. J. Hum.
Genet., 53: 385–390.
Mcintyre, D. H. and Mcintyre, P. A., 1942. The problem of brain tumor in psychiatric
diagnosis. Am. J. Psychiat., 98: 720- 726.
Melnik, Y., Slater, E. P., Steinitz, R. and Davies, M. A., 1979. Laterality and survival.
Neoplasma, 95(3): 291-293.
Mercer, W. E., Shields, M. T., Amin, M., Sauve, G. J., Appella, E., Romano, J. W. and
Ullrich, S., J., 1990. Negative growth regulatin in a glioblastoma tumor
cell line that conditionally expresses human wild-type p53. Proc. natl.
Acad. Sci., USA., 87: 6166-6170.
Mercer, W. E., Shields, M. T., Lin, D., Appella, E. and Ulrich, S. J.,1991. Growth
suppression induced by wild-type p53protein is accompanied by selective
106
down-regulation of proliferating-cell nuclear antigen expression. Proc.
natl. Acad. Sci. USA., 88: 1958-1962.
Miki, Y., Swensen, J. and Shattuck-Eidens, D., 1994. A Strong candidate for the breast
and ovarian cancer susceptability gene BRCA1. Science, 266: 66– 71.
Mills, A. A., 2005. p53: link to the past, bridge to the future. Genes Dev., 19: 2091-2099.
Miyashita, T. and Reed, J. C., 1995. Tumor suppressor p53 is a direct transcriptional
activator of the human bax gene. Cell, 80: 293–299.
Mojtahedi Z., Hashemi, S. B., Khademi, B., Karimi, M., Haghshenas, M., R., Fattahi, M.,
J. and Ghaderi, A. 2010. P53 codon 72 polymorphism association with
head and neck squamous cell carcinoma Braz. j. otorhinolaryngol., 76(3)..
316-320.
Nakazawa, H., English, D., Randell, N. P., Nakazawa, K., Martel, N., Armstrong, K. B.
and Yamasaki, H., 1994. UV and Skin cancer specific TP53 gene mutation
in normal skin as a biologically relevant exposure measurement. Proc.
natl. Acad. Sci. USA, 91: 360-364.
NIC. National institute of cancer America, (2011). http://www.cancer.gov/
cancertopics/ types/breast.
Nishigaki, K., Husimi, Y. and Tsubota, M., 1986. Detection of diference in higher order
structure between highly homologus single stranded DNA by low
temperature denaturant gradient gel electrophoresis. J. Biochem., 99 (3):
663- 671.
Norberg, T., Lennerstrand, J., Inganas, M. and Bergh, J. 1998., Comparison between p53
protein measurements using the luminometric immunoassay and
immunohistochemistry with detection of p53 gene mutations using cDNA
sequencing in human breast tumors. Int. J. Cancer, 79: 376– 383.
Nowell, P. C., 1992. Biology of disease: cancer, chromosomes and genes. Lab. Invest.,
66: 407-419.
Oliver, M., Hollstein, M., and Hainaut, P., 2009. TP53 Mutations in Human Cancers:
Origins, Consiquences and clinical use.http://cshperspectives.cshlp.org/
Olivier M. and Hainaut, P., 2001. TP53 mutation patterns in breast cancers: searching for
clues of environmental carcinogenesis. Semin. Cancer Biol., 11: 353– 360.
107
Olivier, M., Eeles, R., Hollstein, M., Khan, M. A., Harris, C. C. and Hainaut, P., 2002.
The IARC TP53 database: new online mutation analysis and
recommendations to users. Hum. Mutat., 19: 607– 614.
Olivier, M., Langer, A., Carrieri, p., Bergh, J., Klaar, S., Eyfjord, J., Theillet, C.,
Rodriguez, C., Lidereau, R., Bie' che, I., Varley, J., Bignon, Y.,
Uhrhammer, N., Winqvist, R., Jukkola-Vuorinen, A., Niederacher, D.,
Kato, S., Ishioka, C., Hainaut, P., and Borresen-Dale, L. A., 2006. The
clinical value of somatic TP53 gene mutations in 1,794 patients with
breast cancer. Clin. Cancer Res., 12(4): 1157- 1167.
Olschwang, S., Laurentpuig, P., Vassal, A., Salmon, R. J. and Thomas, G., 1991.
Characterization of a frequent polymorphism in the coding sequence of the
Tp53 gene in colonic cancer patients and a control population. Hum.
Genet., 86: 369- 370.
Olumi, A.F., Tsai, Y.C. Nichols, P.W., Skinner, D.G., Chain. D.R., Bender. L.I. and
Jones, P.A., 1990. Allelic loss of chromosome 17p distinguishes high
grade from low grade transitional cell carcinomas of the bladder. Cancer
Res., 50: 7081-7083.
Oncolink., 2007. http://www.oncolink.com/search/search.cfm
Oren, M., Maltzman, W. and Levine, A. J,. 1981. Post-translational regulation of the 53
K cellular tumor antigen in normal and transformed cells. Mol. Cell
Biol.,1: 101-110.
Ory, K., Legros, Y., Auguin, C. and Soussi, T., 1994. Analysis of the most representative
tumor-derived p53 mutants reveals that changesin protein conformation
are not correlated with loss of transactiation or inhibition of cell
proliferation. EMBO J., 13: 3496- 3504.
Osborne, H. R., Houben, A.W., Tijssen, C. C., Coebergh, W.W. and van Duijn, M. C.,
2001. The genetic epidemiology of glioma. Neurology, 57: 1751- 1755.
Overgaard, J., Yilmaz, M., Guldberg, P., Hansen, L. L., and Alsner, J., 2000. TP53
mutation is an independent prognostic marker for poor outcome in both
nodenegative and node-positive breast cancer. Acta Oncol., 39(3): 327 –
333.
108
Papadakis, E. N., Dokianakis, D. N. and Spandidos, D. A., 2000. p53 codon 72
polymorphism s a risk factor in the development of breast cancer. Mol.
Cell. Biol. Res. Commun., 3: 389-392.
Parkin, D. M. and Iscovich, J., 1997. Risk of cancer in migrants and their descendants in
Israel: II. Carcinomas and germ-cell tumors. Int. J. Cancer, 70: 654– 660.
Parkin, D. M., Muir, C. S. and Whelan, S. L., 1992. Cancer incidence in five continents.
Comparability and quality of data. Publication no.120. IARC.
Patel, K. and Sakamoto, M. K., 2006. Li. Fraumeni syndrome: www.emedicines.com.
Peller, S., Kopilova, Y., Slutzki, S., Halevy, A., Kvitko., K. and Rotter, V., 1995. A novel
polymorphism in intron 6 of the human p53 gene: a possible association
with cancer predisposition and susceptibility. DNA Cell Biol., 14: 983 -
990.
Perera, F. P., 1987. Molecular cancer epidemiology: a new tool in cancer prevention. J.
natl. Cancer Inst.,78: 887–898.
Perera, F. P., Poirier, M. C., Yuspa, S. H., Nakayama, J., Jaretzki, A., Curnen, M. M.,
1982. A pilot project in molecular cancer epidemiology: determination of
benzopyrene–DNA adducts in animal and human tissues by
immunoassays. Carcinogenesis, 3: 1405–1410.
Petitjean, A., Achatz, M., Borresen-Dale, I.W., Hainaut, P. and Olivier, M., 2007.TP53
mutations in human cancers: functional selection and impact on cancer
prognosis and outcomesTP53 mutations in human cancers. Oncogene 26,
2157-2165.| doi:10.1038/sj.onc.1210302.
Petitjean, A., Mathe, E., Kato, S., Ishioka, C., Tavtigian, S. V., Hainaut, P. and Olivier,
M., 2007. Impact of mutant p53 functional properties on TP53 mutation
patterns and tumor phenotype: lessons from recent developments in the
IARC TP53database Hum.Mutat.28(6):622-629.
Pezeshki, M. A., Farjadian, S., Talei, A., Vasei, M., Gharesi-Fard, B. , Doroudchi, M. and
Ghaderi, A., 2001. p53 gene alteration and protein expression in Iranian
women with infiltrative ductal breast carcinoma. Cancer Lett., 169: 69-75.
Pierce, L. M., Sivaraman, L., Chang, W., Lum, A., Donlon, T., Seifried, A., Wilkens, L.
R., Lau, A. F. and Le-Marchand, L. 2000. Relationships of TP53 codon 72
109
and HRAS1 polymorphisms with lung cancer risk in an ethnically diverse
population. Cancer Epidemiol. Biomark. Prev., 9: 1199-1204.
Pietsch, E. C., Humbey, O. and Murphy, M. E. 2006. Polymorphisms in the p53 pathway.
Oncogene, 25: 1602- 1611.
Pleasants, L. M. and Hansen, M. F., 1994. Identification of a polymorphism in intron 2 of
the p53 gene. Hum. Genet., 93: 607-609.
Pluquet, O. and Hainaut, P., 2001. Genotoxic and non-genotoxic pathways of p53
induction. Cancer Lett., 174: 1-15.
Prera, F. B. and Weinstein, I. P., 1982 .Molecular epidemiology and carcinogens- DNA
adduct detection new approaches to study of cancer causations. J. Chron.
Dis., 35: 581-600.
Prosser, J. and Condie, A. 1991. Biallelic apaI polymorphism of the human p53-gene
(TP53). Nucl. Acids Res., 19: 4799.
Prosser, J., Elder, P.A., Condie, A., MacFadyen, I., Steel, C. M. and Evans H. J., 1991.
Mutations in p53 do not account for heritable breast cancer: a study in five
affected families.Br. J. Cancer, 63: 181-184.
Pursianen, K., Boffetta, P., Kannio, A., Nyberg, F., Pershagen, G., Mukeria, A.,
Constintanescu, V., Fortes, C. and Benhamou, S. 2000. p53 mutations and
exposure to environmental tobacco smoke in a multicenter study on lung
cancer. Cancer Res, 60: 2906-2911.
Quesnel. B., Preudhomme, C., Fournier, J., Fenaux, P., Peyrat, J. P. 1994. MDM2 gene
amplification in human breast cancer. Eur. J. Cancer., 30A: 982-984.
Raman, V., Martensen, S. A., Reisman, D., Evron, E., Odenwald, W. F., Jaffee, E.,
Marks, J., Sukumar, S. 2000. Compromised HOXA5 function can limit
p53 expression in human breast tumours. Nature, 405: 974-978.
Rana, F., Younus, J., Muzammil, A., Raza, S., Siddiqui, S. K., Khan, U., Hameed, S., and
Shah, A. M., 1997. Breast cancer epidemiology in Pakistani women. J.
Coll. Phys.Surg. Pak., 8(1): 20- 23.
Rangan, A. 2008. NSW Breast Cancer institute. http://www.bci.org.au/index.
Rashid, U. M., Zaidi, A., Torres, D., Sultan, F., Benner, A., Naqvi, B., Shakoori, A. R.,
Seidel-Renkert, A., Farooq, H., Narod, S., Amin, A. and Hamann U. 2006.
110
Prevalence of BRCA1 and BRCA2 mutations in Pakistani breast and
ovarian cancer patients. Int. J. Cancer, 119: 2832-2839.
Rashid, M. U., Torres, D., Rasheed, F., Sultan, F., Shakoori, A. R. Amin, A. Schlaefer.
K., and Hamann, U., 2008. No association of miscarriage and BRCA
carrier status in Pakistani breast/ovarian cancer patients with a history of
parental consanguinity. Br. Can. Res. Treat. 116 (1). 211. 213.
Rasool, M. I., Malik, M. I., Luqman, M. and Khalilullah. 1987 .The clinicopathological
study of carcinoma breast. Pakistan J. med. Res., 6:135-136.
Reich, N. C. and Levine, A. J. 1984. Growth regulation of a cellular tumour antigen, p53
in non transformed cells. Natur, 308. 199-201.
Reid, R. and Robert, F. 2008. Pathology illustrated.www.amazon.com.
Rosen, P. P. 2001. Rosen’s breast pathology.2ND ed. Lippincott Williams and Wilkins.
Philadelphia.,PA, 19106. pp. 326.
Rossner Jr, P., Gammon, M. D., Zhang, Y. J., Terry, M. B., Hibshoosh, H., Memeo, L.,
Mansukhani, M., Long, C. M., Garbowski, G., Agrawal, M., Kalra, T. S.,
Gaudet, M. M., Teitelbaum, S. L., Neugut, A. I. and Santella, R. M., 2009.
Mutations in p53, p53 protein overexpression and breast cancer survival.
J. Cell mol. Med., 13(9B): 3847–3857.
Samuels-Lev, Y., O., Connor, D. J., Bergamaschi, D., Trigiante, G., Hsieh, J. K., Zhong,
S., Campargue, I., Naumovski, L., Crook, T. and Lu, X., 2001. ASPP
proteins specifically stimulate the apoptotic function of p53. Mol. Cell, 8:
781-794.
Santan, R. J., 2010. Benign breast diseases in women. www.endotext.org.
Santos, A. M., Sousa, H., Catarino, R., Pinto, D., Pereira, D., Vasconcelos, A., Atos, A.,
Lopes, C. and Medeiros, R., 2005.TP53 codon 72 polymorphism and risk
for cervical cancer in Portugal. Cancer Genet. Cytogenet., 159:143-147.
Sarfraz, S., Hamid, S., Siddiqui, A., Hussain, S., Pervez, S. and Alexander, G., 2008.
Altered expression of cell cycle and apoptotic proteins in chronic hepatitis
C virus infection. BMC Microbiol. 8: 133.
111
Sayhan, N., Yazici, H., Budak, M., Bitisik, O., and Dalay, N., 2001. p53 codon 72
genotypes in colon cancer: association with human papillomavirus
infection. Res. Commun. mol. Pathol. Pharmacol.,109: 25- 34.
Schlichtholz, B., Bouchind’homme, B., Pages, S., Martin, E., Liva, S., Magdelenat, H.,
Sastre-Garau, X., Stoppa-Lyonnet, D. and Soussi. T., 1998. p53 mutations
in BRCA1-associated familial breast cancer. Lancet, 352: 622- 635.
Sebastian, S., Azzariti, A., Silvestris, N., Porcelli, L., Russo, A. and Paradiso, A., 2010.
P53 as the main traffic controller of the cell signaling network. Front.
Biosci., 15: 1172-1190.
Serra, A., Gaidano, G. L., Revello, D., Guerrasio, A., Ballerini, P., Dallafavera, R. and
Saglio, G. 1992. A new Taql polymorphism in the p53 gene. Nucl. Acid.
Res., 20: 928.
Shaukat Khanum Hospital. 2011. www.shaukatkhanum.org.pk.
Sharpless, N. E. and DePinho, R. A., 2004. Telomeres, stem cells, senescence, and
cancer. J. Clin. Invest.,113:160–168.
Shaulsky, G., Benzeev, A. and Rotter, V., 1990. Subcellular distribution of the p53
protein during the cell cycle of Balb/c 3T3 cells. Oncogene, 5: 1707-1711.
Shaulsky, G., Goldfinger, N., Peled, A. and Rotter, V. 1991. Involvement of wild-type
p53 in pre-B-cell differentation in vitro. Proc. natl. Acad. Sci., 88: 8982-
8986.
Shi , H., Tan, S. J., Zhong, H., Hu, W., Levine, A., Xiao, C. J., Peng, Q. i XB., Shou, W.
H., Ma, R. L., Li, Y., Su, B. and Lu, X., 2009. Winter temperature and UV
are tightly linked to genetic changes in the p53 tumor suppressor pathway
in Eastern Asia. Am. J. Hum. Genet., 84(4): 534-541.
Shiao, Y. H., Chen, V.W., Scheer, W. D., Wu, X. C. and Correa, P. 1995. Racial
disparity in the association of p53 gene alterations with breast cancer
survival. Cancer Res., 55:1485–1490.
Shimizu, H., Ross, R.K, Bernstein, L., Yatani, R., Henderson, B. E., Mack, T. M., 1991.
Cancers of the prostate and breast amongJapanese and white immigrants
in Los Angeles County. Br. J. Cancer, 63:963– 966.
112
Shojaie, N. and Tirgari, F. 2008. Detection of somatic mutation of codon 248 of p53 gene
between Iranian women with breast cancer. Int. J. Clin. Pract.,1: 27-32.
Siddique, M. M., Balram, C., Fiszer-Maliszewska, L., Aggarwal, A., Tan, A., An, P.,
Soo, K. C. and Sabapathy, K., 2005. Evidence for selective expression of
the 53 codon 72 polymorphs: implications in cancer development. Cancer
Epidemiol. Biomark. Prev.,.14: 2245- 2252.
Siddiqui, M. S., Kayani, N., Sulaiman, S., Hussainy, A. S., Shah, S. H. and Muzaffar, S.,
2000. Breast carcinoma in Pakistani famales: a morphological study of
572 breast specimens. J. Pakistan. med. Assoc., 50(6).174-177.
Siervi, A. D., Luca, P. D., Byun, J. S., Di, L. J., Fufa, T., Haggerty, C. M., Vazquez, E.,
Moiola, C., Longo, D. L. and Gardner, K. 2010. Transcriptional
autoregulation by BRCA1. Cancer Res. 70(2): 532–542.
Simão, T. A., Ribeiro, F. S., Amorim, L. M. F., Albano, R. M., Andrada-Serpa, M.
J.,Cardoso, L. E. B., Mendonça, G. A. and Moura-Gallo, C. V., 2002.
TP53 mutations in breast cancer tumors of patients from Rio de Janeiro,
Brazil: Association with risk factors and tumor characteristIcs. Int. J. Can.
101(1): 69-73.
Sinha, R., Gustafson, D. R., Kulldorf, M., Wen, W. Q., Cerhan, J. R., Zheng, W., 2000.
2-Amino-1-methyl-6-phenylimidazo pyridine, a carcinogenin high-
temperature-cooked meat, and breast cancer risk. J. Natl. Cancer Inst.,
92:1352–1354.
Snyderwine, E. G., 2007. Mammary gland carcinogenesis by food derived heterocyclic
amines: metabolism and additional factors influencing carcinogenesis by
2-Amino-1-methyl-6- phenylimidazo[4,5-b]pyridine (PhIP). Environ. Mol.
Mutagen. 39: 165–170.
Sjalander, A., Birgander, R., Hallmans, G., Cajander, S., Lenner, P., Athlin, L., Beckman,
G. and Beckman, L., 1996. p53 polymorphisms and haplotypes in breast
cancer. Carcinogenesis,7:1313- 1316.
Sohail, S. and Alam, S. N., 2007. Breast cancer in Pakistan–awareness and early
detection. J. Coll. Phys. Surg. Pak., 7: 711–712.
113
Sorlie, T., Johnsen, H., Phuong, Vu., Elisabeth, G., Lind.- Lothe, R. and Borresen- Dale,
L. A., 2005. Mutation screening of the TP53 gene by temporal
temperature Gradient gel electrophoresis. Methods Mol. Biol., 291: 207-
216.
Souici, C. A., Mirkovitch, J., Hausel, P., Keefer, K. L. and Felley-Bosco, E., 2000.
Transition mutation in codon 248 of the p53 tumor suppressor gene
induced by reactive oxygen species and anitric oxide-releasing compound.
Carcinogenesis, 21(2): 281-287.
Soulitzis, N., Sourvinos, G., Dokianakis, D. N. and Spandidos, D. A., 2002. p53 codon 72
polymorphism and its association with bladder cancer. Cancer Lett., 179:
175- 183.
Soussi, T., (2011). http://p53.free.fr/
Soussi, T. and Beroud, C., 2001. Assessing TP53 status in human tumours to evaluate
clinical outcome. Nat. Rev. Cancer, 1: 233–240.
Soussi, T., Béroud, C., Hamroun, D. and Rubio-Nevado, J. M., 2011. P53 mutation
handbook. http://p53/free.fr.
Soussi, T., Legros, Y., Lubin, R., Ory, K. and Schlichtholz, B., 1994. Multifactorial
analysis of p53 alteration in human cancer-a review. Int. J. Cancer, 57: 1-
9.
Soussi, T., Rubio-Nevado, J. M. and Ishioka, C., 2006. MUT-TP53: a versatile matrix for
TP53 mutation verification and publication. Hum. Mutat., 27: 1151-1154.
Srivastava, S., Zou, Z. Q., Pirollo, K., Blattner, W. and Chang, E. H., 1990. Germ-line
transmission of a mutated p53 gene in a cancer-prone family with Li-
Fraumeni syndrome. Nature, 348: 747-749.
Stanford, J. L., Weiss, N. S. and Voigt, L. F., 1995. Combined estrogen and progestin
hormone replacement therapy in relation to risk of breast cancer in
middle-aged women. J. Am. med. Assoc., 274:137.
Storey, A., Thomas, M., Kalita, A., Harwood, C., Gardiol, D., Mantovani, F., Breuer, J.,
Leigh, I. M., Matlashewski, G. and Banks, L., 1998. Role of p53
polymorphism in the development of human papillomavirus-associated
cancer. Nature, 393: 229-234.
114
Streuli, C., 2004. The molecular basis of breast cancer prevention and treatment. Breast
Cancer Res., 6:179-180.
Strong, L. C., Stine, M. and Norsted, T. L., 1987. Cancer in survivors of childhood soft
tissue sarcoma and their relatives. J. natl. Cancer Inst., 79: 1213-1220.
Suspitsin, E. N., Buslov, K. G., Grigoriev, M. Y., Ishutkina, J. G., Ulibina, J. M.,
Gorodinskaya, V. M., Pozharisski, K. M., Berstein, L. M., Hanson, K. P.,
Togo. A. V. and Imyanitov, E. N., 2003. Evidence against involvement of
p53 polymorphism in breast cancer predisposition. Int. J. Cancer,103:
431-433.
Tabori, U., Nanda, S., Druker, H., Lees, J. and Malkin, D. 2007.Younger age of cancer
initiation is associated with shorter telomere length in Li-Fraumeni
syndrome. Cancer Res., 67 (4): 1415-1418.
Takahashi, T., Nau, M. M., Chiba, I., Birrer, M. J., Rosenberg, R. K., Vinocour, M.,
Levitt, M., Pass, H., Gazdar, A. F. and Minna, J. D. 1989. p53- a frequent
target for genetic abnormalities in lung cancer. Science, 246: 491-494.
Taneja, P., Maglic, D., Kai, F., Zhu, S., Kendig, R. D., Fry, E. A. and Inoue, K. 2010.
Classical and Novel Prognostic Markers for Breast Cancer and their
Clinical Significance. Clinic. Medicine Insights: Oncology . 4: 15-34.
Tenti, P., Vesentini, N., Rondo-Spaudo, M., Zappatore, R., Migliora, P., Carnevali, L.,
Ranzani, G. N., 2000. p53 codon 72 polymorphism does not affect the risk
of cervical cancer in patients from northern Italy. Cance Epidemiol.
Biomark. Prev., 9: 435-438.
Thor, A.D., Yandell, D.W. 1993. Prognostic significance of p53 over expression in node
negative breast carcinoma-preliminary studies support cautious support
cautious optimism. J. natl. Cancer Inst.,85: 176-177.
Toguchida, J., Yamagucbi, T., Dayton, S. H., Beau- Lilbbe, J., von-Ammon,
K.,Watanabe, K., Hegi, M. E. and Kleihues, P., 1995. Familial brain
tumour syndrome associated with a ~53 germline deletion of codon 236.
Brain, 5: 15-23.
Tommiska, J., Eerola, H., Heinonen, M., Salonen, L., Kaare, M., Tallila, J., Istimaki, A.,
von- Smitten, K., Aittomaki, K., Heikkila, P., Blomqvist, C. and
115
Evanlinna, H., 2005. Breast cancer patients with p53 Pro72 homozygous
genotype have a poorer survival. Clin Cancer Res., 11: 098-103.
Toruner, G. A., Ucar, A., Tez, M., Cetinkaya, M., Ozen, H. and Ozcelik, T., 2001. p53
odon 72 polymorphism in bladder cancer: no evidence of association with
increased risk -invasiveness. Urol. Res., 29:393-395.
Tsuda, H., Iwaya, K., Fukutomi, T. and Hirohashi, S., 1993. p53 mutations and c-erbB-2
amplification in intraductal and invasive breast carcinomas of high
histologic grade, Jpn. J. Cancer Res., 84: 394–401.
Tybulewicz, V. L. and Ashworth, A., 1997. Tumorigenseis and a DNA rapair defect in
mice with a truncating BRCA2 mutation. Nat. Genet., 17: 423–430.
Usmani, K., Khanum, A., Afzal, H. and Ahmad, N. 1996. Breast carcinoma in Pakistani
women. J. environ. Pathol. Toxicol. Oncol., 15. 251-253.
Varley, J. M., McGown, G., Thorncroft, M., Santibanez-Koref, M. F., Kelsey, A. M.,
Tricker, K. J., Evans, D. G. and Birch, J. M., 1997. Germ-line mutations
of TP53 in Li-Fraumeni families: an extended study of 39 families.
Cancer Res., 57: 3245-3252.
Varley, J. M., Thorncroft, M., McGown, G., Appleby, J., Kelsey, A. M., Tricker, K. J.,
Evans, D. G. and Birch, J. M., 1997. A detailed study of loss of
heterozygosity on chromosome 17 in tumours from Li- Fraumeni patients
carrying a mutation to the TP53 gene. Oncogene, 14: 865–871.
Vousden, K. H. and Lane, D. P., 2007. p53 in health and disease. Nat. rev., (8): 275-283.
Vásquez, A., Ahrné, S., Pettersson, B. and Molin, G., 2001. Temporal temperature
gradient gel electrophoresis (TTGE) as a tool for identification of
Lactobacillus casei Lactobacillus paracasei, Lactobacillus zeae and
Lactobacillus rhamnosus. Lett. appl. Microbiol., 32: 215-219.
Vousden, K., H. and Lu, X., 2002. Live or let die: the cell's response to p53. Nat. Rev.
Can., 2: 594-604.
Vousden, K. H. and Lane, D. P., 2007. TP53 in health and disease. Nature Rev. Molec.
Cell Biol. 8: 275-283.
Walsh, T., Casadei, S. and Coats, K. H., Swisher, E., Stray, S. M., Higgins, J., Roach, K,
C., Mandell, J., Ming, K., Lee, Ciernikova, S., Foretova, L., Soucek, P.
116
and King, M. C., 2006. Spectrum of mutations in BRCA1, BRCA2,
CHEK2 and TP53 in families at high risk of breast cancer. J. Am.
med.Assoc. 295: 1379 –1388.
Wang, Y. C., Lee, H. S., Chen, S. K., Yang, S. C. and Chen, C.Y., 1998. Analysis of K-
ras gene mutations in lung carcinomas: correlation with gender,
histological subtypes, and clinical outcome. J. Cancer Res. clin. Oncol.,
124: 517-22..
Wang-Gohrke, S., Rebbeck, T. R., Besenfelder, W., Kreienberg, R. and Runnebaum, I.
B., 1998. p53 germline polymorphisms are associated with an increased
risk for breast cancer in German women. Anticancer Res., 18: 2095-2099.
Weiss, A .H.,Devesa, S. S. and Brinton, A. L. 1996. Laterality of breast cancer in the
United States. Cancer Causes Cont., 7:539-543.
Weston, A. and Godbold, J. H., 1997. Polymorphisms of H-ras-1 and p53 inbreast cancer
and lung cancer: a meta-analysis. Environ. Hlth. Perspect., 105(Suppl.4):
919–926.
Weston, A., Pan, C. F., Ksieski, H. B., Wallenstein, S., Berkowitz, G. S., Tartter, P. I.,.
Bleiweis, I. J., Brower, S. T., Senie, R. T. and Wolff, M. S. 1997. p53
haplotype determination in breast cancer. Cancer Epidemiol. Biomarkers
Prev., 6:105-112.
Whibley, C., Pharoah, P. D., and Hollstein, M, 2009. P53 polymorphisms: cancer
implications. Nat. Rev.Cancer, 9(2): 95-107.
Wikipedia. 2008. http://en.wikipedia.org/wiki/Mammary_ductal_carcinoma.
Wittwer, C. T., Reed, G. H., Gundry, C. N., Vandersteen, J. G. and Pryor, R. J., 2003.
High-resolution genotyping by amplicon melting analysis using LC Green.
Clin. Chem., 49(6 Pt 1):853-860.
Xu, X., Wagner, K.U, Larson, D., Weaver, Z., Li, C., Ried, T., Hennighausen, L.,
Wynshaw-Boris, A. and Deng, C. X.,1999. Conditional mutation of
BRCA1 in mammary epithelial cells results in blunted ductal
morphogenesis and tumour formation. Nature Genet., 22: 37–43.
117
Yu, M., Ryu, D. and Snyderwine, E. G., 2000. Genomic imbalance in rat mammary gland
carcinomas induced by 2-amino-1-methyl-6-phenylimidazo(4,5-
b)pyridine, Mol. Carcinog., 27: 76–83.
Zeb,aA., Rasool, A. and Nasreen, S., 2008. Cancer incidence in the districts of Dir (North
West Frontier Province), Pakistan: A Preliminary study. J. Chin. Med.
Assoc.71(2): 62-65.
Zehbe, I., Voglino, G., Wilander, E., Genta, F. and Tommasino, M., 1999. Codon 72
olymorphism of p53 and its association with cervical cancer. Lancet,
354:218-219.
Zelada-Hedman, M., Borresen-Dale, A. L., Claro, A., Chen, J., Skoog, L. and Lindblom,
A., 1997. Screening for TP53 mutations in patients and tumours from 109
Swedish breast cancer families. Br. J. Cancer, 75: 1201–1204.
Zheng, W., Gustafson, D. R., Sinha, R., Cerhan, J. R., Moore, D. and Hong, C. P. 1998..
Well-done meat intake and the risk of breast cancer. J. Natl. Can. Inst.
90:1724-9.
Zhu, Z. Z., Cong, W. M., Zhu, G. S., Liu, S. F., Xian, Z. H., Wu, W.Q., Zhang, X. Z.,
Ang, Y. H. and Wu, M. C., 2005. Association of p53 codon 72
polymorphism with enetic susceptibility to hepatocellular carcinoma in a
Chinese population. World J. Gasteroentrol., 22: 632-635.
Ziemer, M. A., Mason, A. and Carlson, D. M., 1982. Cell-free translations of proline-
rich protein mRNAs. J. Biol. Chem. 257 (18): 11176–11180.
118
APPENDICES
Appendix-1
Proforma for the project of “Spectrum of TP53 tumor suppressor gene mutations in Pakistani breast cancer patients SCHOOL OF BIOLOGICAL SCIENCES University of the Punjab, Lahore, Pakistan
PATIENT INFORMATION SHEET Title of the Project: Spectrum of TP53 tumor suppressor gene mutations in
Pakistani breast cancer patients You are being asked to participate in a multi-center research study. In order to decide whether or not you should agree to be part of this research study, you should understand enough about its risks and benefits to make an informed judgment. This process is known as informed consent. Purpose of the research project: Breast Cancer (BC) is one of the most frequent cancers in Pakistan. The number of cases of BC cancer diagnosed has increased in recent years. Currently there are a number of treatments available for BC. From previous research we are able to advise patients with particular breast cancers the treatment or combination of treatments best suited to them. Within the research laboratory, we are working with and developing new techniques to look at genes and their protein products in cancer cells. The small amount of fresh tissue we have will be used in a variety of ways. The most important of these will be directed to improvements in the diagnosis and treatment of breast cancer. There are many causes for breast cancers. One of the major causes may be mutation(s) in certain genes. You have been diagnosed as having BC. The tissue retrieved by this procedure will be used in a study for analysis of any kind of mutation(s) in these genes. Confidentiality, privacy and disclosure of information The outcome of this research and your hospital records will be kept confidential. What are the benefits involved? It is not possible to predict whether any personal benefits will result from your participation in this research project. The information obtained from this research will be used scientifically and may be of benefit to patients with BC in future. Are there any risks involved?
119
The tissue we wish to collect is no longer needed for your medical care and would normally be destroyed if we did not collect it for use. Therefore, there are no physical risks to you in donating your tissue. You will not be required to take any medication or undergo any treatment that is not usually indicated for your therapy. There will be no risk to your health or ability to receive appropriate therapy. What if I do not want to donate my tissue? The choice to donate your tissue is entirely up to you, and no matter what you decide it will not affect your care in any way. You are under no obligation to donate your tissue. If you change your mind at any time, just contact us and let us know you do not want us to use your tissue. Any remaining tissue will be discarded. Will I find out about the results of the research using my tissue? You will receive the result of your surgery from your doctor, but you may not receive results of the research done with your tissue. This is because research can take many years and uses tissue samples from a large number of people and so will not affect your care right now. Who can I contact if I have more questions? We encourage you to call us with any concerns or questions you may have. You can contact following persons; Professor Dr. A. R. Shakoori Meritorious Professor & Director School of Biological Sciences, University of the Punjab, Lahore Cell: 03334673255 E mail: arshak@brain.net.pk
Dr. Qasim Ahmed Shaukat Khanum Memorial Cancer Hospital & Research Centre, Johar Town Lahore Tel: 042-5180725 E-mail: qahmed@skm.org.pk
120
SCHOOL OF BIOLOGICAL SCIENCES University of the Punjab, Lahore, Pakistan Title of the Project: Spectrum of p53 tumor suppressor gene
mutations in Pakistani breast cancer patients PATIENT CONSENT FORM
Project Title:
Patient Name:
Name of Surgeon:
Please read this section carefully and indicate whether you consent to each of these items.
1. I have read and understood the Patient Information Sheet and I have been given a copy to keep. All my questions have been answered to my satisfaction.
Yes/No
2. I have had the opportunity to fully consider my donation of tissue for cancer research purpose and understand that I may withdraw my consent at any time and for any reason and this will not affect my care now or in the future.
Yes/No
3. I consent to make a gift of my tissue/blood for use in any aspect of cancer research.
Yes/No
4.
I understand that I am consenting to make a 'gift' of tissue for use in any aspect of cancer research and waive all claims to patents, commercial exploitation, property or any material or products which may form part of or arise from this study.
Yes/No
5. I understand that some research projects may include genetic research, and the results of such investigations will not be made available to me.
Yes/No
6.
I understand that information will be collected from my medical records and stored on a computer database and that my identity and privacy will be protected at all times. No information about me or my family will be revealed in any research results.
Yes/No
7. You may contact me in the future to ask my permission to take part in more research.
Yes/No
8. I give permission for follow-up data to be collected from my medical records.
Yes/No
(Doctor/Health Professional/Research Team Member).…………………………………. has explained to me and I understand the consequences involved in participation in the collection of material and data for this cancer research project.
121
SIGNATURE…………………………………………….DATE…………………………………… INDEPENDENT WITNESS (someone who is not a member of the research team) NAME:………………………………………………SIGNATURE…………………...…………DATE………….……. WITNESS (research team member) NAME:………………………………………………SIGNATURE………………………..……..DATE…………………
122
QUESTIONNAIRE FOR THE BREAST CANCER PATIENTS
Title of Project: Spectrum of p53 tumor suppressor gene mutations in Pakistani breast cancer patients
Serial no.-________________ Date__________
General information
Name ------------------------- Date of birth ------------------------- Education ------------------------- Sex ------------------------- Marital status ------------------------- Age when married ------------------------- Any relative having breast cancer (degree) ------------------------ Monthly income ------------------------ Profession ------------------------ Religion ------------------------ Knowledge about self examination ------------------------ Address ----------------------- Age at menarche ----------------------- Regularity of menstrual cycle ---------------------- Age at menopause --------------------- Active smoking ----------------------- Passive smoking ---------------------- Fuel in use ---------------------- Alcohol intake ----------------------- Use of contraceptives ----------------------- Use of any other drug ----------------------- No. of children ----------------------- No. of miscarriages/child deathes ---------------------- Breast feeding ---------------------- Ovary discordment --------------------- Usual diet included (meat fonder/vegetarian) -------------------- Any other physical problem --------------------- Environmental exposure ---------------------------
123
Clinical information Tumor type ----------------------- Tumor size ----------------------- Tumor grade ---------------------- ER/PR status ---------------------- Node status ----------------------- Clinical stage ----------------------- Laterality -----------------------
Research article
top related