supplementary materials for -...
Post on 25-Aug-2020
2 Views
Preview:
TRANSCRIPT
www.sciencemag.org/cgi/content/full/science.1249161/DC1
Supplementary Materials for
PINK1 Loss of Function Mutations Affect Mitochondrial Complex I
Activity via NdufA10 Ubiquinone Uncoupling
Vanessa A. Morais,* Dominik Haddad, Katleen Craessaerts, Pieter-Jan De Bock,
Jef Swerts, Sven Vilain, Liesbeth Aerts, Lut Overbergh, Anne Grünewald,
Philip Seibler, Christine Klein, Kris Gevaert, Patrik Verstreken, Bart De Strooper*
*Corresponding author. E-mail: Bart.DeStrooper@cme.vib-kuleuven.be (B.D.S.);
Vanessa.Morais@cme.vib-kuleuven.be (V.A.M.)
Published 20 March 2014 on Science Express
DOI: 10.1126/science.1249161
This PDF file includes:
Materials and Methods
Figs. S1 to S8
Tables S1 and S2
References
2
Materials and Methods
Site-directed Mutagenesis and Generation of Stable Cell Lines
Pink1-/- MEFs stably transduced with PINK1 PD-causing mutations (G309D; W437X), and the
artificial kinase inactive mutant (K219S) were previously described (6). PINK1 truncated
mutants were generated using the reverse primer 5’-cagggctgccctccatgagca-3’ and the following
forward primers: for ∆N77-hPINK1 5’-caccatgctggcggcgcggttg-3’; for ∆N113-hPINK1 5’-
ccaccatggaaaaacaggcgg-3’; for ∆N153-hPINK1 5’-caccatgctggaggagtatctg-3’. Mouse NdufA10
cDNA was obtained from Origene (USA), and for detection purposes a 3xFLAG-tag or a GFP-
tag was inserted. NdufA10 mutants were constructed using the QuickChange multisite-directed
mutagenesis kit as described by supplier’s protocol (Stratagene), where Serine250 was mutated to
either an Alanine (phosphor-deficient mutant) or to a Glutamate (phosphomimetic mutant). To
generate stable cell lines, MEFs were transduced using a replication-defective recombinant
retroviral expression system (Clontech) and where selected based on their acquired hygromycin
resistance. HeLa NdufA10 downregulated cell line were generated using shRNA against human
NdufA10 (targeted sequence 5’-cagaagaaaggagatccacatgaaatgaa-3’) according to supplier’s
protocol (Origene) and where selected based on their acquired puromycin resistance.
Human fibroblasts and iPS cells derived from PINK1 PD-causing mutations
Human fibroblasts harbouring the homozygous p.Q456X nonsense mutation (L2122) and the
homozygous p. V170G missense mutation (L1703) and age-matched controls (L2134, L2132)
were previously described (20). Where indicated human fibroblasts were electroporated with
GFP-tagged NdufA10 mutants using the NEON system (Invitrogen) according to the supplier’s
protocol.
The PINK1 derived induced pluripotent stem (iPS) cells were obtained according to the previous
described protocol (21), where previously published patient (L2124; L2122) and control (L2135)
lines and newly established control (L2134) line were analysed.
Morphometric analysis
Human derived fibroblast cells were electroporated with mitochondrial targeted red fluorescent
protein (mtRFP) corresponding to pDsRed2-Mito obtained from Clontech (Mountain View, CA)
3
using the NEON system (Invitrogen) according to the supplier’s protocol. For epifluorescent
imaging of the mitochondrial network, 48h post-transfection medium was replaced with Hanks
balanced salt solution (HBBS) and 10 mM HEPES and cells were placed on the stage of an
Olympus IX81 inverted microscope equipped with a CellR imaging system (Olympus). Cells
were excited using a 525± 20nm excitation filter and emitted light was collected using a 40 x 1.4
NA Plan Apo objective (Olympus). Morphometric analysis was performed using ImageJ software
as previously described(31).
Mitochondrial isolation and Complex I immunocapture
Mitochondria were isolated from Pink1+/+ and Pink1-/- mice by standard differential
centrifugation and resuspended in Isolation buffer (IB: 0.2M sucrose, 10 mM Tris-MOPS pH 7.4,
0.1 mM EGTA-Tris pH 7.4) as previously described (32). Complex I was immunocaptured from
mitochondrial enriched fraction treated with 1% DDM according to manufacturer’s protocol
(Mitoscience).
LC-MS/MS analysis
After elution in 1% SDS, immunocaptured Complex I was analysed on an SDS-PAGE followed
by coomassie staining. The gel lanes were cut into 15 slices, and these gel slices were then
washed with water, followed by acetonitrile/water (1/1, v/v) and acetonitrile, and then vacuum-
dried. The dried gel slices were then re-swollen in 10% acetonitrile and 50 mM ammonium
bicarbonate (pH 8) containing 0.1 µg sequencing-grade modified trypsin (Promega, Madison,
WI, USA). Digestion was allowed to proceed overnight at 37°C. After digestion, the generated
peptide mixtures were vacuum-dried and re-dissolved in 20 µl of 2% acetonitrile and 0.1% TFA.
These peptide mixtures were then analyzed on an Ultimate 3000 HPLC system (Dionex,
Amsterdam, The Netherlands) in-line connected to an LTQ Orbitrap Velos mass spectrometer
(Thermo Electron, Bremen, Germany). Here, a 30 min gradient of 2% acetonitrile to 50%
acetonitrile, followed by a washing and re-equilibration step, on an in-house packed 15 cm long
and 75 µm inner diameter columns (Reprosil-Pur Basic C18-HD 3 µm, Dr. Maisch, Germany)
was used. Per LC-MS/MS analysis, 2.5 µl of the peptide mixture was consumed. Instrument
settings for LC-MS/MS analysis and the generation of MS/MS peak lists were as previously
described (33). These MS/MS peak lists were then searched using the Mascot Daemon interface
4
(version 2.3.0, Matrix Science, London, UK). The Mascot search parameters were as follows.
The spectra were searched in the mouse subsection of the Swiss-Prot database. Acetylation of the
protein N-terminus, pyroglutamate formation of N‐terminal glutamine, methionine oxidation to
methionine‐sulfoxide, propionamide formation of cysteine and phosphorylation of serine,
threonine and tyrosine were set as variable modifications. The protease was set to trypsin with
one missed cleavage allowed. The mass tolerance on the precursor ion was set to ± 10 ppm and
on fragment ions to ± 0.5 Da. In addition, Mascot’s C13 setting was set to 1. Only peptides that
were ranked one and had an ion score at least equal to the corresponding identity threshold at
99% confidence were withheld and further data handling was done in the ms_lims database(34).
Respiratory Assays
Oxidative phosphorylation complex measurements performed on mitochondrial homogenates
from fibroblast cells were analysed by spectrophotometric assays as previously described (25).
Briefly, measurements of Complex I were performed with either coenzyme Q1 (CoQ1) or
decylubiquinone (NADH:ubiquinone oxidoreductase, rotenone sensitive) or with
hexammineruthenium (HAR). The protein concentration was in the range of 2–4 mg/ml. Values
were plotted according to the ratio between the specific complex’s activity and citrate synthase
activity.
ATP determination
ATP levels measured in lysates from cell lines or adult flies were determined as described in (19)
using a luminescent solution (ATP Determination Kit, Invitrogen) according to the supplier’s
protocol. Luminescence values was measured on an EnVision Multilabel Reader (Perkin Elmer)
and luminescence ATP (nmol) was determined using a standard curve and normalized to total
protein content (mg) measured by BCA assay (Pierce).
Proteinase K accessibility assay and Sodium Carbonate extraction
Isolated mitochondria (0.1 mg/ml) from HeLa cells were treated with 100 µg/ml Proteinase K
(PK) in mitochondria Isolation buffer at 4°C for 30 min. A hypotonic rupture of the outer
membrane (OM) was achieved by diluting the mitochondrial suspension 1:40 in 2 mm
HEPES/KOH pH 7.4. Disruption of the inner mitochondrial membrane (IM) was achieved by
5
adding Triton X-100 at a final concentration of 0.3% (V/V). PK was inactivated by incubation
with 1 mm PMSF at 4°C for 5 min. Samples were prepared for SDS-PAGE analysis by
precipitation with 10% trichloroacetic acid (TCA), followed by cold acetone washes, and
resuspended in NuPAGE loading buffer (Invitrogen). For the Sodium Carbonate (Na2CO3)
extraction, 500µg of isolated mitochondria were treated with 100 mM Na2CO3 pH 11.5 for 30
min on ice, followed by centrifugation at 100.000 x g for 60 min. Supernatant is enriched for
soluble IMS and matrix proteins and pellet is enriched for OM and IM integral and associated
proteins. Samples were prepared for SDS-PAGE analysis and resuspended in NuPAGE loading
buffer (Invitrogen).
Immunoblot analyses
Proteins were separated by SDS-PAGE on 10% NuPAGE Bis-Tris gels (Invitrogen) in MOPS
buffer and electrophoretically transferred onto nitrocellulose membranes. Membranes were
blocked with 5% milk powder in Tris-buffered saline with 0.5% Tween (TBS-T) for 1 h. Primary
antibodies used: mouse anti-FLAG M2 1:5000 (Sigma), mouse anti-Hsp60 1:5000 (BD
laboratories), rabbit anti-NdufA10 1:1000 (ab96464; ABCAM), mouse anti-Tom20 1:1000 (BD
laboratories), goat anti-Tim23 1:500 (Santa Cruz), rabbit anti-PINK1 1:500 (Novus Biologicals
BC100-494), mouse anti-V5 tag 1:5000 (Invitrogen), rabbit anti-Omi 1:1000 (R&D). Secondary
antibodies: anti-rabbit HRP conjugated and anti-mouse HRP conjugated (Bio-Rad) at 1:10000,
anti-goat HRP conjugated (Sigma) at 1:2000. Detection was done using the ECL-Plus detection
kit (Amersham) and imaged on a Fuji-Film imaging system.
Mitophagy assay
To assess CCCP-mediated Parkin recruitment, MEF cells were treated with the mitochondrial
uncoupler CCCP at 25 μM for 8 h. Cells were fixed in 4% paraformaldehyde in PBS for 20 min
at room temperature. Cells were permeabilized with 0.1% Triton X-100 for 10 min, followed by
1h blocking with BSA supplemented with 5% goat serum. Primary antibodies used: rabbit anti-
TurboGFP 1:1000 (Evrogen), mouse anti-Hsp60 1:250 (BD BioSciences). Secondary antibodies:
Alexa-488 or -555 conjugated antibodies (Invitrogen) were used at 1:1000. Preparations were
mounted in Moviol and visualized with a Zeiss LAS510 confocal microscope and a 63X NA 1.4
oil lens.
6
H202-induced apoptosis
To measure H202-induced apoptosis, Pink1+/+, Pink1-/- and Pink1-/- fibroblasts expressing the
phosphomimetic NdufA10 mutants were treated with increasing concentrations of H2O2 and after
4 h apoptosis was determined using the luminescent Cleaved Caspase-Glo 3/7 assay (Promega)
according to the protocol supplied by the manufacturer.
Drosophila Genetics
Flies were kept on standard molasses medium. w pink1REV controls and w pink1B9 flies were
kindly provided by Jeehye Park and Jongkyeong Chung (Korea Advanced Institute of Science
and Technology)(12) and mutant larvae were selected using GFP balancers.
Generation of UAS-CG6343 transgenic flies
dNDUFA10 (CG6343) cDNA was ordered from DGRC (Drosophila Genomics Resource Center)
DGC (Drosophila Gold Collection) clone LD29280 and cloned with 5’-
CAGAATTCCAAAATGACCGCCGTGTTCCGCG-3’ and 5’ -
GTGCGGCCGCCTAGTGGTGATGGTGATGATGGATGCCCTGGTTGATGCCTATTTTC-3’
using 2x BIO-X-ACT Short Mix (BIOLINE), cloned in the EcoR1 and Not1 site of pUAST-Attb
(PMID: 17360644) and sequenced (A10wt). UAS-CG6343S-A (A10SA) and UAS-CG6343S-D
(A10SD) were generated similarly, with the following primers to introduce point mutations for
S-A: 5’-CGGCATGGGTGGCGATGTCCTTG-3’ and
5’-CAAGGACATCGCCACCCATGCCG-3’ and for S-D:
5’-CGGCATGGGTGTCGATGTCCTTG-3’ and 5’-CAAGGACATCGACACCCATGCCG-3’.
Transgenic flies were created at GenetiVision Inc. (Houston, USA) using PhiC31 mediated
transgenesis in the VK1 docking site (2R, 59D3) (PMID: 17138868).
For Drosophila genetics, pink1B9 null and pink1rev mutants were crossed with transgenic UAS-
(CG6343) (wild type; A10wt). UAS-CG6343S-A (phospho-deficient; A10SA) and UAS-CG6343S-D
(phosphomimetic; A10SD) flies (CG6343; dNdufA10; ND-42). Experiments were performed on
the following genotype: w pink1B9 / Y; UAS-CG6343 / +; daGal4 / + and pink1rev / Y; UAS-
CG6343 / +; daGal4 / +.
7
Imaging of mitochondrial membrane potential
The dye TMRE was used to evaluate mitochondrial membrane potential. Human fibroblasts and
MEFs were grown in 3 cm plastic dishes with glass coverslips (Nunc) and treated with 10 nM
TMRE for 10 min at 37 °C as previously described(35). TMRE fluorescence intensity was
measured using the ImageJ software.
For live imaging of membrane potential, fibroblast cells were grown in 3cm plastic dishes with
glass coverslips (Nunc) and after 24h loaded with 10nM TMRM (Molecular Probes) in the
presence of 2µg/ml cyclosporine H (Sigma) for 30 min at 37°C. Subsequently cells were placed
on the stage of an Olympus IX81 inverted microscope equipped with a CellR Imaging system.
Sequential images of TMRM fluorescence were acquired every 60s using exposure times of 40ms
with a 40x, 1.4 NA Plan Apo objective (Olympus), a 525 ± 20 excitation filter and an emission
570 LP filter. TMRM fluorescence over mitochondrial regions of interest was measured. When
indicated (arrows), 2 µg/ml oligomycin and 2 µM FCCP were added.
Third instar larval fillets were labelled with JC-1 (Molecular Probes) as described (22). Briefly,
larval fillets were incubated for 90 sec with 4 mM JC-1 in HL-3 buffer, washed in HL-3 buffer
and red and green fluorescence was imaged. Images were captured on a Nikon FN-1 microscope
with a DS-2MBWc digital camera, 63x water objective, NA 0.8 and quantification of labelling
intensity (red to green intensity in the red labelled areas within the boutons) was performed using
NIS-Elements BR 3.1 software.
Immunolabeling
Immunolabeling was performed as previously described in (19). Briefly, Drosophila larval fillets
were fixed using 3.7% formaldehyde in PBS for 20 min at room temperature, and permeabilized
with 0.4% Triton X-100 for 10 min, followed by 1h blocking with BSA supplemented with 5%
goat serum. As primary antibody mouse anti-Complex V subunit beta (MitoSciences) at 1:250
was used. For secondary antibody Alexa-488 conjugated antibodies (Invitrogen) at 1:1000 was
used. Preparations were mounted in Vectashield (Vector Laboratories) and visualized with a
Leica DMRXA confocal microscope and a 63X NA 1.4 oil lens.
8
Flight assay
Batches of five male flies were used to conduct the flight assays. Briefly, flies were placed in an
empty vial, gently tapped and flies that were able to fly were given a score of 1 while those that
did not were given a score of 0.
Electrophysiology
Larval electrophysiological recordings were performed as described (22, 36). Data was recorded
with a Multiclamp 700B amplifier (Molecular Devices) and stored using pClamp 10; 2 mM Ca2+
concentration was used. EJP amplitudes were binned per 30 s and normalized to the average
amplitude of the first 15s of recordings.
FM1-43
FM 1-43 labelling and unloading were performed as described (22). Briefly, both the exo/endo
cycling pool (ECP) and RP were labelled by electrically stimulating motor neurons of third instar
filets in the presence of 2 mM Ca2+ for 10 min and then leaving the dye with the preparation for 5
min. ECP and RP vesicles are labelled. Depolarisation with 90 mM KCl, 2 mM Ca2+ and
following washing in Ca2+ free medium results in unloading of the ECP vesicles but not RP
vesicles. Images were captured on a Nikon FN-1 microscope with a DS-2MBWc digital camera,
63x water objective, NA 0.8 and quantification of labelling intensity was performed using NIS-
Elements software.
Electron microscopy
Adult fly thoraxes were processed for electron microscopy as previously described (37). Briefly,
thoraxes were fixed in paraformaldehyde/glutaraldehyde, post-fixed in osmium tetroxide,
dehydrated and embedded in Epon. Sections 80 nm thick were stained with uranyl acetate and
lead citrate and subjected to electron microscopy analysis. The morphology of the mitochondria
were blindly scored as 1) normal mitochondria with organized cristae; 2) swollen mitochondria
with organized or partially-organized cristae and 3) swollen mitochondria devoid of cristae.
9
Statistical analysis
The statistical significance of differences between a set of two groups was evaluated using
student two-tailed unpaired t-tests (*, p<0.05; **, p<0.01; ***, p<0.001) in GraphPad Prism5.
Mean was calculated using standard deviation (s.d.) or standard error (s.e.m.).
10
Fig. S1.
Fig. S1. Human PINK1 patient derived fibroblasts present mitochondrial membrane
potential deficits.
A and B, Mitochondrial morphology analysis and quantification in fibroblasts of PINK1 patients
(L1703 and L2122) and age-matched controls (L2134 and L2132). Following electroporation of
cells with mitochondrial targeted RFP, fluorescent visualization and corresponding morphometric
analysis was performed using ImageJ. Absence of PINK1 does not lead to mitochondrial
morphological changes.
11
C and D, Analysis and quantification of the mitochondrial membrane potential in these
fibroblasts using the potentiometric dye TMRE. Quantification of TMRE fluorescence was
performed using ImageJ software. The mitochondrial membrane potential is decreased in the
patient derived fibroblasts.
E, Analysis of ATP levels in these fibroblasts where a decrease in overall ATP content is
observed in the patient derived fibroblasts.
F,G and H, Analysis of iPS cell derived neurons from a PD patient harboring a PINK1 mutation
and a healthy control individual. IPS cells were established from two PD patient with mutant
PINK1 (c.1366C>T) and from a healthy family member (H). Analysis and quantification of the
mitochondrial membrane potential in iPS cell derived neurons of PINK1 patients (L2124 and
L2122) and age-matched controls (L2134 and L2135) using the potentiometric dye TMRE (F).
Quantification of TMRE fluorescence was performed using ImageJ software. The mitochondrial
membrane potential is decreased in the patient derived iPS cells. Analysis of ATP levels in these
patient derived iPS cells shows a decrease in overall ATP content in the patient derived cells (G).
Statistical analysis: student t-test; **, p<0.01; *, p<0.05; mean ± s.d.; n = 100. Scale bar, 10 µm.
12
Fig. S2.
A) Non-phosphorylated peptide
13
B) Phosphorylated peptide
Fig. S2. CID-MS/MS spectra of the NdufA10 S250 non-phosphorylated (A) and
phosphorylated (B) peptide.
The tryptic peptide 249-MSEMCEVLVYDSWEAEDPTK-268 was identified in both Pink1+/+ as
well as Pink1-/- tissue samples, but was only found phosphorylated in Pink1+/+ tissue samples.
Representative and annotated MS/MS spectra for the non-phosphorylated (A) and the
14
phosphorylated peptide (B) are shown together with tables that indicate which b and y type of
fragment ions were covered (shown in red). Note that the Mascot search algorithm was used at
99% confidence settings and the non-phosphorylated peptide in panel (A) was identified with a
Mascot score of 95 (threshold score of 34), whereas the phosphorylated peptide in panel (B) was
identified with a score of 97 versus a threshold score of 32. Results indicate that phosphorylation
of Serine250 in NdufA10 is dependent on the presence of PINK1.
15
Fig. S3.
Fig. S3. Expression of phosphomimetic NdufA10 restores Complex I activity in down
regulated NdufA10 HeLa cells.
A, HeLa cells were transfected with an siRNA against NdufA10 or a control scrambled-siRNA
followed by reintegration of the 3xFLAG-tagged wild type NdufA10wt, phosphorylation-deficient
NdufA10S250A and phosphomimetic NdufA10S250D. Expression levels were analysed by
Immunoblotting of mitochondria-enriched fractions using anti-NdufA10 antibody that recognizes
both endogenous and exogenous NdufA10. Efficiency of downregulated is observed when
comparing expression levels between siRNA and scramble control for the endogenous protein.
H, homogenate; C, cytosol; M, mitochondria; exo, exogenous; endo, endogenous.
B, Analysis of enzymatic function of Complex I. Spectrophotometric assays were performed to
measure Complex I (NADH:ubiquinone oxidoreductase) and citrate synthase activities on
mitochondria homogenates from HeLa cells expressing NdufA10 mutants as indicated. In (B),
NADH:ubiquinone reduction (rotenone sensitive) was measured. Values were normalized to
citrate synthase acitivity. The enzymatic activity of Complex I is reduced in the down-regulated
NdufA10 cell line transfected with the phosphomimetic mutant NdufA10S250A.
16
Fig. S4.
Fig. S4. Restoration of synaptic defects in Drosophila pink1B9 null mutants by expressing
phosphomimetic NdufA10
A, Schematic representation of a neuromuscular junction (NMJ) from a Drosophila third instar
larva. The position of the stimulating electrode and nerves, and the recording electrode in the
muscle is illustrated.
B, Imaging of Reserve pool (RP) labelling in controls (pink1REV) and pink1 mutants (pink1B9).
Both the exo/endo cycling pool (ECP) and RP were labelled with FM1-43, after depolarization
only ECP vesicles but not RP vesicles were unloaded. Synapses were imaged after this unloading
procedure. Note that the loading defect in pink1B9 is restored upon expression of A10SD.
17
C, Imaging of mitochondrial membrane potential in third instar Drosophila larval NMJs in
controls (pink1REV) and pink1 mutants (pink1B9) using the ratiometric dye JC-1. The
mitochondrial membrane potential was restored upon expression of A10SD.
Scale bar, 4.5 µm.
18
Fig. S5
Fig. S5. Phosphomimetic NdufA10SD does not restore muscle morphology or flight defects in
pink1B9 flies, nor does it rescue CCCP-induced Parkin recruitments in MEF cells.
A and B, Imaging of the mitochondrial membrane potential in third instar Drosophila larval
NMJs in controls (pink1REV) and pink1 mutants (pink1B9), expressing NdufA10wt, NdufA10SA and
NdufA10SD using the ratiometric dye JC-1 . For quantification (B), the red JC-1 fluorescence
emission to green emission (in the same area) is compared. The mitochondrial membrane
potential was not altered upon expression of NdufA10 mutants in pinkREV.
19
Statistical analysis: student t-test; ns, not significant; mean ±s.d.; n = 6 animals. Scale bar, 4.5
µm.
C, Mitochondria morphology from third instar larval body wall muscles. Larval filets from
pink1rev, pink1B9 and in pink1B9 expressing NdufA10wt, NdufA10SA and NdufA10SD were stained
with Complex V antibody (labels mitochondria) and imaged. Defects in mitochondria
morphology observed in pink1B9 muscle tissue are not rescued with NdufA10 mutants. n = 5
animals.
D, Quantification of flight in pink1rev, pink1B9 and in pink1B9 expressing NdufA10wt, NdufA10SA
and NdufA10SD. Reduced flight observed in pink1B9 mutant flies is not restored with
phosphomimetic mutants of NdufA10.
Statistical analysis: student t-test; ns, not significant; mean ± s.e.m.; n = 10 experiments with 5
flies each.
E, CCCP-induced Parkin recruitment is not restored in Pink1-/- cells expressing the
phosphomimetic NdufA10 mutant. Pink1+/+, Pink1-/- and Pink1-/- cells expressing the
phosphomimetic NdufA10 mutants transfected with Parkin-GFP were treated with CCCP for 8h,
after which they were further processed for immunostaining.Anti-GFP and anti-HSP60 were used
to visualize Parkin and the mitochondrial matrix protein HSP60, respectively. Parkin
translocation to the mitochondria was assessed. As previously reported, Parkin fails to be
recruited to CCCP-treated mitochondria in the absence of Pink1, presenting a cytosolic
distribution pattern in the cells. Additionally, the phosphomimetic NdufA10 mutant does not
restore this defect either.
20
Fig. S6.
Fig. S6: Proteinase K accessibility assay peformed on HeLa cells indicates that PINK1 is
translocated to the Inner Mitochondrial Membrane.
A, Purified mitochondria from HeLa cells expressing endogenous hPINK1 were treated with 100
µg/ml Proteinase K (PK). Where indicated, hypotonic rupture of the outer mitochondrial
membrane (OM) was achieved by diluting the mitochondrial suspension 1:40 in 2 mm
HEPES/KOH pH 7.4; Triton X-100 was added where indicated at a final concentration of 0.3%
(V/V). PK was inactivated by incubation with 1 mm PMSF at 4°C for 5 min. Tom20 is an OM
protein, Tim23 is an integral Inner Mitochondrial Membrane (IM) protein. Results indicate that
PINK1 is a mitochondrial inner membrane integral or membrane-associated protein. The double
band is probably reflecting full length PINK1 and PINK1 processed by MPPβ (protease involved
in the cleaving of mitochondrial targeting sequences) or by AFG3L2 (a subunit of the mAAA
protease), based on comparison of these results with those described by Greene and co-workers
(40). SW, swelling.
21
Fig. S7.
Fig. S7: Proteinase K accessibility assay and Sodium carbonate extraction performed on
MEF cells expressing hPINK1 indicates that PINK1 is translocated to the Inner
Mitochondrial Membrane.
A, Purified mitochondria from MEF cells expressing hPINK1 with a V5 tag were treated with
100 µg/ml Proteinase K (PK). Where indicated, hypotonic rupture of the outer mitochondrial
membrane (OM) was achieved by diluting the mitochondrial suspension 1:40 in 2 mm
HEPES/KOH pH 7.4; Triton X-100 was added where indicated at a final concentration of 0.3%
(V/V). PK was inactivated by incubation with 1 mm PMSF at 4°C for 5 min. Tom20 is an OM
protein, Omi is a intermembrane space (IMS) protein and HSP60 is a mitochondrial matrix
protein. Results indicate that PINK1 is a mitochondrial inner membrane integral or membrane-
associated protein. The double band is probably reflecting full length PINK1 and PINK1
processed by MPPβ (protease involved in the cleaving of mitochondrial targeting sequences) or
by AFG3L2 (a subunit of the mAAA protease), and lower band to the PARL-cleavage product,
based on comparison of these results with those described by Greene and co-workers (40). SW,
swelling.
B, Sodium carbonate (Na2CO3) extraction was performed using 100 mM Na2CO3 on 500µg of
isolated mitochondria from MEF cells expressing hPINK1 with a V5 tag. Supernatant is enriched
22
for soluble IMS and matrix proteins (sup Na2CO3) and pellet is enriched for OM and IM integral
and associated proteins (pellet Na2CO3).
23
Fig. S8.
Fig. S8. Expression of phosphomimetic NdufA10 in Pink1 deficient cells expressing PINK1
PD-causing mutants.
A, Pink1-/- MEFs expressing human wildtype (hPINK1wt), PINK1 containing PD-causing
mutations (hPINK1G309D, hPINK1W437X) and a kinase inactive form of PINK1 (hPINK1KD) were
stably transduced with 3xFLAG-tagged wild type NdufA10wt, phosphorylation-deficient
NdufA10S250A and phosphomimetic NdufA10S250D. Expression levels were analysed by
Immunoblotting of mitochondria-enriched fractions using anti-FLAG and anti-Hsp60 (loading
control) antibody.
24
Table SI - Protein coverage of immunocaptured Complex I subunits.
Complex I was immunocaptured from Pink1+/+ and Pink1-/- mouse brain and liver. The peptide
sequences obtained are linked to a specific protein with a 99% confidence settings (p ≤ 0.01), and
proteins identified in at least two out of the three independent experiments in each tissue
performed are shown (+; a positive identification). Previously reported human subunits NdufA4L
and NdufB1 have no known mouse homologue. Notice that MS analysis covered 40 out of the 46
Complex I subunits.
Accession n° Brain LiverNADH dehydrogenase (ubiquinone) 1 alpha subcomplex O35683 NdufA1 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1, 7.5kDa + +Q9CQ75 NdufA2 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2, 8kDa + +Q9CQ91 NdufA3 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 3, 9kDa + +Q62425 NdufA4 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa + +Q4FZG9 NdufA4L2 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2 not identified not identifiedQ9CPP6 NdufA5 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5, 13kDa + +Q9CQZ5 NdufA6 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 6, 14kDa + +Q9Z1P6 NdufA7 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa + +Q9DCJ5 NdufA8 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8, 19kDa + +Q9DC69 NdufA9 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39kDa + +Q99LC3 NdufA10 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa + +Q9D8B4 NdufA11 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 11, 14.7kDa + +Q7TMF3 NdufA12 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12 + +Q9ERS2 NdufA13 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13 + +NADH dehydrogenase (ubiquinone) 1 beta subcomplex Q9CPU2 NdufB2 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 2, 8kDa + +Q9CQZ6 NdufB3 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 3, 12kDa + +Q9CQC7 NdufB4 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4, 15kDa + +Q9CQH3 NdufB5 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa + +Q3UIU2 NdufB6 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa + +Q9CR61 NdufB7 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7, 18kDa + +Q9D6J5 NdufB8 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa + +Q9CQJ8 NdufB9 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa + +Q9DCS9 NdufB10 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa + +O09111 NdufB11 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17,3kDa + +NADH dehydrogenase (ubiquinone) 1, subcomplex unknown Q9CQY9 NdufC1 NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 1, 6kDa not identified not identifiedQ9CQ54 NdufC2 NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14,5kDa + +NADH dehydrogenase (ubiquinone) Fe-S protein Q91VD9 NdufS1 NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa + not identifiedQ91WD5 NdufS2 NADH dehydrogenase (ubiquinone) Fe-S protein 2, 49kDa + +Q9DCT2 NdufS3 NADH dehydrogenase (ubiquinone) Fe-S protein 3, 30kDa + +Q9CXZ1 NdufS4 NADH dehydrogenase (ubiquinone) Fe-S protein 4, 18kDa + +Q99LY9 NdufS5 NADH dehydrogenase (ubiquinone) Fe-S protein 5, 15kDa + +P52503 NdufS6 NADH dehydrogenase (ubiquinone) Fe-S protein 6, 13kDa + +Q9DC70 NdufS7 NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa + +Q8K3J1 NdufS8 NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23kDa + +NADH dehydrogenase (ubiquinone) flavoprotein 1 Q91YT0 NdufV1 NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa + +Q9D6J6 NdufV2 NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa + +Q8BK30 NdufV3 NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa + +Mitochondrially encoded NADH dehydrogenase subunit P03888 ND-1 mitochondrially encoded NADH dehydrogenase subunit 1 + +P03893 ND-2 mitochondrially encoded NADH dehydrogenase subunit 2 + +P03899 ND-3 mitochondrially encoded NADH dehydrogenase subunit 3 + +P03911 ND-4 mitochondrially encoded NADH dehydrogenase subunit 4 + +P03903 ND-4L mitochondrially encoded NADH dehydrogenase subunit 4L not identified not identifiedP03921 ND-5 mitochondrially encoded NADH dehydrogenase subunit 5 + +P03925 ND-6 mitochondrially encoded NADH dehydrogenase subunit 6 not identified not identified
25
Table SII – Phosphorylation of Complex I subunit NdufA10 is dependent on the presence of
PINK1.
Phosphoproteome of Complex I from Pink1+/+ and Pink1-/- tissues was performed by LC-MS/MS
analysis. Identified phosphorylation sites are indicated in the table, where “-” corresponds to the
identification of the non-phosphorylated peptide sequence. Phosphopeptides that scored below
the threshold set by the 99% confidence interval are indicated in “±”. We identified phosphosite
Serine250 in Complex I subunit NdufA10 to be dependent on the presence of PINK1.
Additionally, nine novel Complex I phosphosites, that are independent of PINK1, were
identified; and previously described NdufA2-S78, NdufB4-S26 and NdufB10-S21 (38, 39) were
confirmed.
Pink1+/+ Pink1-/- Pink1+/+ Pink1-/-
Q9CQ75 NdufA2 ± ± S78 S78
Q9CPP6 NdufA5 ± T9/T8 T9 T9
± ± S68 S68
S250 - S250 -
Q9CQC7 NdufB4 ± ± S26 S26
Q9CQJ8 NdufB9 ± T144 T144 ±
Q9DCS9 NdufB10 S21 ± S21 S21
Q9CQ54 NdufC2 T41 T41 T41 T41
Q91VD9 NdufS1 / ± ± S216
Q9CXZ1 NdufS4 ± S116 ± ±
± Y112 Y112 Y112
± ± S189 S189
Brain LiverProtein
Q91YT0 NdufV1
Q99LC3 NdufA10
Accession n°
26
References
1. E. M. Valente, P. M. Abou-Sleiman, V. Caputo, M. M. Muqit, K. Harvey, S. Gispert, Z. Ali, D.
Del Turco, A. R. Bentivoglio, D. G. Healy, A. Albanese, R. Nussbaum, R. González-
Maldonado, T. Deller, S. Salvi, P. Cortelli, W. P. Gilks, D. S. Latchman, R. J. Harvey, B.
Dallapiccola, G. Auburger, N. W. Wood, Hereditary early-onset Parkinson’s disease caused
by mutations in PINK1. Science 304, 1158–1160 (2004). doi:10.1126/science.1096284
Medline
2. E. M. Valente, S. Salvi, T. Ialongo, R. Marongiu, A. E. Elia, V. Caputo, L. Romito, A. Albanese,
B. Dallapiccola, A. R. Bentivoglio, PINK1 mutations are associated with sporadic early-
onset parkinsonism. Ann. Neurol. 56, 336–341 (2004). doi:10.1002/ana.20256 Medline
3. D. P. Narendra, S. M. Jin, A. Tanaka, D. F. Suen, C. A. Gautier, J. Shen, M. R. Cookson, R. J.
Youle, PINK1 is selectively stabilized on impaired mitochondria to activate Parkin. PLOS
Biol. 8, e1000298 (2010). doi:10.1371/journal.pbio.1000298 Medline
4. R. J. Youle, D. P. Narendra, Mechanisms of mitophagy. Nat. Rev. Mol. Cell Biol. 12, 9–14
(2011). doi:10.1038/nrm3028 Medline
5. D. P. Narendra, R. J. Youle, Targeting mitochondrial dysfunction: Role for PINK1 and Parkin in
mitochondrial quality control. Antioxid. Redox Signal. 14, 1929–1938 (2011).
doi:10.1089/ars.2010.3799 Medline
6. V. A. Morais, P. Verstreken, A. Roethig, J. Smet, A. Snellinx, M. Vanbrabant, D. Haddad, C.
Frezza, W. Mandemakers, D. Vogt-Weisenhorn, R. Van Coster, W. Wurst, L. Scorrano, B.
De Strooper, Parkinson’s disease mutations in PINK1 result in decreased complex I activity
and deficient synaptic function. EMBO Mol. Med. 1, 99–111 (2009).
doi:10.1002/emmm.200900006 Medline
7. A. Y. Abramov, M. Gegg, A. Grunewald, N. W. Wood, C. Klein, A. H. Schapira, Bioenergetic
consequences of PINK1 mutations in Parkinson disease. PLOS ONE 6, e25622 (2011).
doi:10.1371/journal.pone.0025622 Medline
8. C. A. Gautier, T. Kitada, J. Shen, Loss of PINK1 causes mitochondrial functional defects and
increased sensitivity to oxidative stress. Proc. Natl. Acad. Sci. U.S.A. 105, 11364–11369
(2008). doi:10.1073/pnas.0802076105 Medline
9. D. Narendra, L. A. Kane, D. N. Hauser, I. M. Fearnley, R. J. Youle, p62/SQSTM1 is required for
Parkin-induced mitochondrial clustering but not mitophagy; VDAC1 is dispensable for both.
Autophagy 6, 1090–1106 (2010). doi:10.4161/auto.6.8.13426 Medline
10. N. Exner, B. Treske, D. Paquet, K. Holmström, C. Schiesling, S. Gispert, I. Carballo-Carbajal,
D. Berg, H. H. Hoepken, T. Gasser, R. Krüger, K. F. Winklhofer, F. Vogel, A. S. Reichert,
G. Auburger, P. J. Kahle, B. Schmid, C. Haass, Loss-of-function of human PINK1 results in
mitochondrial pathology and can be rescued by parkin. J. Neurosci. 27, 12413–12418
(2007). doi:10.1523/JNEUROSCI.0719-07.2007 Medline
11. A. K. Lutz, N. Exner, M. E. Fett, J. S. Schlehe, K. Kloos, K. Lämmermann, B. Brunner, A.
Kurz-Drexler, F. Vogel, A. S. Reichert, L. Bouman, D. Vogt-Weisenhorn, W. Wurst, J.
Tatzelt, C. Haass, K. F. Winklhofer, Loss of parkin or PINK1 function increases Drp1-
dependent mitochondrial fragmentation. J. Biol. Chem. 284, 22938–22951 (2009).
doi:10.1074/jbc.M109.035774 Medline
27
12. J. Park, S. B. Lee, S. Lee, Y. Kim, S. Song, S. Kim, E. Bae, J. Kim, M. Shong, J. M. Kim, J.
Chung, Mitochondrial dysfunction in Drosophila PINK1 mutants is complemented by
parkin. Nature 441, 1157–1161 (2006). doi:10.1038/nature04788 Medline
13. I. E. Clark, M. W. Dodson, C. Jiang, J. H. Cao, J. R. Huh, J. H. Seol, S. J. Yoo, B. A. Hay, M.
Guo, Drosophila pink1 is required for mitochondrial function and interacts genetically with
parkin. Nature 441, 1162–1166 (2006). doi:10.1038/nature04779 Medline
14. Y. Yang, S. Gehrke, Y. Imai, Z. Huang, Y. Ouyang, J. W. Wang, L. Yang, M. F. Beal, H.
Vogel, B. Lu, Mitochondrial pathology and muscle and dopaminergic neuron degeneration
caused by inactivation of Drosophila Pink1 is rescued by Parkin. Proc. Natl. Acad. Sci.
U.S.A. 103, 10793–10798 (2006). doi:10.1073/pnas.0602493103 Medline
15. H. Deng, M. W. Dodson, H. Huang, M. Guo, The Parkinson’s disease genes pink1 and parkin
promote mitochondrial fission and/or inhibit fusion in Drosophila. Proc. Natl. Acad. Sci.
U.S.A. 105, 14503–14508 (2008). doi:10.1073/pnas.0803998105 Medline
16. Y. Yang, Y. Ouyang, L. Yang, M. F. Beal, A. McQuibban, H. Vogel, B. Lu, Pink1 regulates
mitochondrial dynamics through interaction with the fission/fusion machinery. Proc. Natl.
Acad. Sci. U.S.A. 105, 7070–7075 (2008). doi:10.1073/pnas.0711845105 Medline
17. S. Vilain, G. Esposito, D. Haddad, O. Schaap, M. P. Dobreva, M. Vos, S. Van Meensel, V. A.
Morais, B. De Strooper, P. Verstreken, The yeast complex I equivalent NADH
dehydrogenase rescues pink1 mutants. PLOS Genet. 8, e1002456 (2012).
doi:10.1371/journal.pgen.1002456 Medline
18. W. Liu, R. Acín-Peréz, K. D. Geghman, G. Manfredi, B. Lu, C. Li, Pink1 regulates the
oxidative phosphorylation machinery via mitochondrial fission. Proc. Natl. Acad. Sci.
U.S.A. 108, 12920–12924 (2011). doi:10.1073/pnas.1107332108 Medline
19. M. Vos, G. Esposito, J. N. Edirisinghe, S. Vilain, D. M. Haddad, J. R. Slabbaert, S. Van
Meensel, O. Schaap, B. De Strooper, R. Meganathan, V. A. Morais, P. Verstreken, Vitamin
K2 is a mitochondrial electron carrier that rescues pink1 deficiency. Science 336, 1306–
1310 (2012). doi:10.1126/science.1218632 Medline
20. A. Grünewald, M. E. Gegg, J. W. Taanman, R. H. King, N. Kock, C. Klein, A. H. Schapira,
Differential effects of PINK1 nonsense and missense mutations on mitochondrial function
and morphology. Exp. Neurol. 219, 266–273 (2009). doi:10.1016/j.expneurol.2009.05.027
Medline
21. P. Seibler, J. Graziotto, H. Jeong, F. Simunovic, C. Klein, D. Krainc, Mitochondrial Parkin
recruitment is impaired in neurons derived from mutant PINK1 induced pluripotent stem
cells. J. Neurosci. 31, 5970–5976 (2011). doi:10.1523/JNEUROSCI.4441-10.2011 Medline
22. P. Verstreken, C. V. Ly, K. J. Venken, T. W. Koh, Y. Zhou, H. J. Bellen, Synaptic mitochondria
are critical for mobilization of reserve pool vesicles at Drosophila neuromuscular junctions.
Neuron 47, 365–378 (2005). doi:10.1016/j.neuron.2005.06.018 Medline
23. R. G. Efremov, R. Baradaran, L. A. Sazanov, The architecture of respiratory complex I. Nature
465, 441–445 (2010). doi:10.1038/nature09066 Medline
24. R. J. Janssen, L. G. Nijtmans, L. P. van den Heuvel, J. A. Smeitink, Mitochondrial complex I:
Structure, function and pathology. J. Inherit. Metab. Dis. 29, 499–515 (2006).
doi:10.1007/s10545-006-0362-4 Medline
28
25. V. D. Sled, A. D. Vinogradov, Kinetics of the mitochondrial NADH-ubiquinone oxidoreductase
interaction with hexammineruthenium(III). Biochim. Biophys. Acta 1141, 262–268 (1993).
doi:10.1016/0005-2728(93)90051-G Medline
26. L. Silvestri, V. Caputo, E. Bellacchio, L. Atorino, B. Dallapiccola, E. M. Valente, G. Casari,
Mitochondrial import and enzymatic activity of PINK1 mutants associated to recessive
parkinsonism. Hum. Mol. Genet. 14, 3477–3492 (2005). doi:10.1093/hmg/ddi377 Medline
27. L. A. Sazanov, P. Hinchliffe, Structure of the hydrophilic domain of respiratory complex I from
Thermus thermophilus. Science 311, 1430–1436 (2006). doi:10.1126/science.1123809
Medline
28. J. M. Berrisford, L. A. Sazanov, Structural basis for the mechanism of respiratory complex I. J.
Biol. Chem. 284, 29773–29783 (2009). doi:10.1074/jbc.M109.032144 Medline
29. M. A. Tocilescu, V. Zickermann, K. Zwicker, U. Brandt, Quinone binding and reduction by
respiratory complex I. Biochim. Biophys. Acta 1797, 1883–1890 (2010).
doi:10.1016/j.bbabio.2010.05.009 Medline
30. N. Matsuda, S. Sato, K. Shiba, K. Okatsu, K. Saisho, C. A. Gautier, Y. S. Sou, S. Saiki, S.
Kawajiri, F. Sato, M. Kimura, M. Komatsu, N. Hattori, K. Tanaka, PINK1 stabilized by
mitochondrial depolarization recruits Parkin to damaged mitochondria and activates latent
Parkin for mitophagy. J. Cell Biol. 189, 211–221 (2010). doi:10.1083/jcb.200910140
Medline
31. S. Cipolat, O. Martins de Brito, B. Dal Zilio, L. Scorrano, OPA1 requires mitofusin 1 to
promote mitochondrial fusion. Proc. Natl. Acad. Sci. U.S.A. 101, 15927–15932 (2004).
doi:10.1073/pnas.0407043101 Medline
32. C. Frezza, S. Cipolat, L. Scorrano, Organelle isolation: Functional mitochondria from mouse
liver, muscle and cultured fibroblasts. Nat. Protoc. 2, 287–295 (2007).
doi:10.1038/nprot.2006.478 Medline
33. B. Ghesquière, N. Colaert, K. Helsens, L. Dejager, C. Vanhaute, K. Verleysen, K. Kas, E.
Timmerman, M. Goethals, C. Libert, J. Vandekerckhove, K. Gevaert, In vitro and in vivo
protein-bound tyrosine nitration characterized by diagonal chromatography. Mol. Cell.
Proteomics 8, 2642–2652 (2009). doi:10.1074/mcp.M900259-MCP200 Medline
34. K. Helsens, N. Colaert, H. Barsnes, T. Muth, K. Flikka, A. Staes, E. Timmerman, S.
Wortelkamp, A. Sickmann, J. Vandekerckhove, K. Gevaert, L. Martens, ms_lims, a simple
yet powerful open source laboratory information management system for MS-driven
proteomics. Proteomics 10, 1261–1264 (2010). doi:10.1002/pmic.200900409 Medline
35. D. Narendra, A. Tanaka, D. F. Suen, R. J. Youle, Parkin-induced mitophagy in the pathogenesis
of Parkinson disease. Autophagy 5, 706–708 (2009). doi:10.4161/auto.5.5.8505 Medline
36. P. Verstreken, T. W. Koh, K. L. Schulze, R. G. Zhai, P. R. Hiesinger, Y. Zhou, S. Q. Mehta, Y.
Cao, J. Roos, H. J. Bellen, Synaptojanin is recruited by endophilin to promote synaptic
vesicle uncoating. Neuron 40, 733–748 (2003). doi:10.1016/S0896-6273(03)00644-5
Medline
37. G. Esposito, M. Vos, S. Vilain, J. Swerts, J. De Sousa Valadas, S. Van Meensel, O. Schaap, P.
Verstreken, Aconitase causes iron toxicity in Drosophila pink1 mutants. PLOS Genet. 9,
e1003478 (2013). doi:10.1371/journal.pgen.1003478 Medline
29
38. E. L. Huttlin, M. P. Jedrychowski, J. E. Elias, T. Goswami, R. Rad, S. A. Beausoleil, J. Villén,
W. Haas, M. E. Sowa, S. P. Gygi, A tissue-specific atlas of mouse protein phosphorylation
and expression. Cell 143, 1174–1189 (2010). doi:10.1016/j.cell.2010.12.001 Medline
39. J. R. Wiśniewski, N. Nagaraj, A. Zougman, F. Gnad, M. Mann, Brain phosphoproteome
obtained by a FASP-based method reveals plasma membrane protein topology. J. Proteome
Res. 9, 3280–3289 (2010). doi:10.1021/pr1002214 Medline
40. A. W. Greene, K. Grenier, M. A. Aguileta, S. Muise, R. Farazifard, M. E. Haque, H. M.
McBride, D. S. Park, E. A. Fon, Mitochondrial processing peptidase regulates PINK1
processing, import and Parkin recruitment. EMBO Rep. 13, 378–385 (2012).
doi:10.1038/embor.2012.14 Medline
top related