the insertion sequence is aba11 is involved in colistin...
Post on 14-Jul-2018
213 Views
Preview:
TRANSCRIPT
1
The insertion sequence ISAba11 is involved in colistin 1
resistance and loss of lipopolysaccharide in Acinetobacter 2
baumannii 3
4
Jennifer H. Moffatt1, Marina Harper
1,2, Ben Adler
1,2, Roger L. Nation
3, Jian Li
3 and 5
John D. Boyce1,2*
6
7
1Department of Microbiology, Monash University, Victoria, Australia,
2Australian 8
Research Council Centre of Excellence in Structural and Functional Microbial 9
Genomics, Monash University, Victoria, Australia, 3Facility for Anti-infective Drug 10
Development and Innovation, Drug Delivery, Disposition and Dynamics, Monash 11
Institute of Pharmaceutical Sciences, Monash University, Victoria, Australia.
12
13
Running title: Colistin resistance due to ISAba11 insertion. 14
Keywords: Colistin, Acinetobacter baumannii, lipopolysaccharide, insertion sequence 15
16
* Corresponding author. Mailing address: Department of Microbiology, Building 76, Monash 17
University, Clayton, Victoria, 3800, Australia. Phone: +61 3 9902 9179. Fax: +61 3 9902 9222 Email: 18
john.boyce@monash.edu 19
Copyright © 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Antimicrob. Agents Chemother. doi:10.1128/AAC.01732-10 AAC Accepts, published online ahead of print on 14 March 2011
on July 17, 2018 by guesthttp://aac.asm
.org/D
ownloaded from
2
ABSTRACT 20
Infections caused by Acinetobacter baumannii are of increasing concern, largely due 21
to the multidrug-resistance of many strains. Here we show that ISAba11 movement 22
can result in inactivation of the A. baumannii lipid A biosynthesis genes lpxA and 23
lpxC, resulting in the complete loss of lipopolysaccharide production and high-level 24
colistin resistance. 25
26
on July 17, 2018 by guesthttp://aac.asm
.org/D
ownloaded from
3
INTRODUCTION 27
The Gram-negative pathogen Acinetobacter baumannii is a leading cause of 28
hospital-acquired infections including septicemia, pneumonia and urinary tract 29
infections. The treatment of infections caused by A. baumannii is significantly 30
hampered by an increase in multi-drug resistance (MDR), including resistance to last-31
line antibiotics such as colistin (9). Recently, colistin resistance in the A. baumannii 32
type strain ATCC 19606 was shown to result from the loss of lipopolysaccharide 33
(LPS), the initial binding target of colistin and the major component of the outer 34
leaflet of the Gram-negative outer membrane (7). 35
We have previously shown that we could select for colistin-resistant mutants 36
of the A. baumannii strain ATCC 19606 by growth on Mueller-Hinton agar 37
containing 10 µg/mL colistin sulphate (7). Our initial study reported the 38
characterization of a group of 13 colistin-resistant mutants which each contained point 39
mutations or deletions in one of the first three genes in the lipid A biosynthesis 40
pathway, lpxA, lpxC or lpxD, resulting in the loss of LPS production and high level 41
colistin resistance (minimum inhibitory concentration >128 µg/mL) (7). In the present 42
study we report the characterization of a second group of eight colistin-resistant 43
mutants of the A. baumannii strain ATCC 19606. Carbohydrate-specific silver stain 44
(7) of the proteinase K-treated whole cell lysates of these strains indicated that they 45
also produced no LPS (Fig. 1), which was confirmed by Limulus amebocyte lysate 46
assay (7) (data not shown). However, sequencing analsyis of the lpxA, lpxC and lpxD 47
genes in these strains showed that they contained no point mutations or deletions but 48
rather an insertion sequence element, ISAba11 (Genbank Accession number: 49
JF309050), in either lpxA or lpxC. 50
on July 17, 2018 by guesthttp://aac.asm
.org/D
ownloaded from
4
In seven of the strains, the ISAba11 element had inserted into lpxC, while in 51
the remaining strain it had inserted into lpxA (Table 1). In six of the colistin-resistant 52
strains, ISAba11 was bracketed by 5 bp direct repeats, indicating target-site 53
duplication. However, in strain AL1838 it was bracketed by 34 bp direct repeats and 54
in strain AL1837 no direct repeats were observed, but rather ISAba11 was associated 55
with a 27 bp deletion within lpxC (Table 1). In four of the colistin-resistant strains 56
ISAba11 inserted between nucleotides 390 and 393 of the lpxC gene while in three of 57
the strains it inserted at either nucleotide 420 or 421 of the lpxC gene, indicating that 58
these regions may represent hotspots for ISAba11 insertion. 59
ISAba11 has previously only been identified as part of the transposon Tn6021 60
(http://www-is.biotoul.fr/index.html?is_special_name=ISAba11) from A. baumannii 61
ATCC 17978 (10). The 1.1 kb element, ISAba11, is flanked by perfect 13 bp inverted 62
repeats and is predicted to encode a transposase with a conserved DDE motif; 63
considered essential for transposition (8). ISAba11 shows the greatest similarity to 64
insertion sequence elements from the IS701 and IS4 families; these elements have 65
inverted repeats of 14-24 bp and 13-26 bp respectively, which contain conserved 66
nucleotides, and target-site duplications of 4 bp (IS701) and 10-13 bp (IS4) (2). The 67
absence of conserved nucleotides in the inverted repeats and the different target-site 68
duplication sizes observed here for ISAba11 do not fit the defining characteristics of 69
either family (2) and given these key differences we propose that ISAba11 represents 70
an emerging IS family. 71
The number of ISAba11 copies present in the ATCC 19606 genome, and the 72
ability of the IS element to replicate and mobilize in this strain, was assessed by 73
Southern hybridization. We compared the number of copies and the position of the 74
element in the parent strain ATCC 19606, with the number of copies and position of 75
on July 17, 2018 by guesthttp://aac.asm
.org/D
ownloaded from
5
the element in the genome of the colistin-resistant, LPS-deficient derivatives. 76
Genomic DNA from the parent strain ATCC 19606 and the colistin-resistant, LPS-77
deficient derivative strains was digested with DraI (ISAba11 does not contain any 78
DraI sites), separated by gel electrophoresis and the resulting DNA fragments 79
transferred to a nylon membrane. The membrane was hybridized under high 80
stringency conditions using a probe specific for the ISAba11 transposase gene (Fig. 81
2). The 760-bp probe was amplified from ATCC 19606 genomic DNA using the 82
primers BAP6531 (GAAGACTACACACCGCACGA) and BAP6532 83
(TCCGCTCAAACTGGTTCTTTT) with DIG-11-dUTP (Roche) incorporation. At 84
least three DNA fragments of approximately 2.1, 1.5 and 1.3 kb in size hybridized 85
with the ISAba11 probe in the ATCC 19606 genomic DNA, indicating that this strain 86
contains multiple copies of ISAba11. However, in the lanes containing genomic DNA 87
isolated from the colistin-resistant, LPS-deficient derivatives of ATCC 19606, up to 88
two additional bands hybridized with the probe, indicating that the insertion element 89
had mobilized, and that in most instances mobilization involved replicative movement 90
of the element (Fig. 2). For the seven mutants where ISAba11 was identified by DNA 91
sequencing as present in lpxC (AL1835-AL1841; Table 1), one hybridizing fragment 92
of 2.9 kb (Fig. 2) was consistently observed across all strains. This fragment 93
corresponded to the expected size of the lpxC DraI fragment containing ISAba11. For 94
the mutant where ISAba11 had inserted into lpxA (AL1850; Table 1) a unique 95
hybridizing fragment was observed that corresponded to the predicted size of the lpxA 96
DraI fragment containing ISAba11 (1.9 kb; Fig. 2)). In summary, these data indicate 97
that ISAba11 in ATCC 19606 is mobile and replicative (Fig. 2). 98
Further bioinformatic analyses indicated that ISAba11 is present in the 99
A. baumannii ATCC 17978 genome and in the unclosed genome sequences of A. 100
on July 17, 2018 by guesthttp://aac.asm
.org/D
ownloaded from
6
haemolyticus, A. lwoffii and A. johnsonnii. However, there is no evidence that the 101
element is present in any of the recently sequenced clinical A. baumannii isolates, 102
suggesting that ISAba11 is not present in the global European clone I and clone II 103
lineages. However, we have recently shown the involvement of a separate novel IS 104
element in the disruption of the lipid A biosynthesis gene lpxD of a colistin-resistant 105
clinical A. baumannii isolate, B0707-070 (7), thus supporting our hypothesis that IS 106
elements may play a significant role in the mechanism of colistin resistance in A. 107
baumannii. Indeed, 15 different IS elements have been described in A. baumannii to 108
date, and the mobilization of many of these elements is associated with an increase in 109
antibiotic resistance (1, 3-6). This study highlights the significant role that IS element 110
movement and insertion plays in the genome plasticity and increasing antibiotic 111
resistance profile of A. baumannii and shows that ISAba11 movement can directly 112
result in colistin resistance in ATCC 19606. 113
114
ACKNOWLEDGEMENTS 115
This work was supported by an Australian National Health and Medical Research 116
Council project grant. J.H. Moffatt is supported by an Australian Postgraduate Award 117
scholarship. J.L is an Australian National Health and Medical Research Council R. 118
Douglas Wright Research Fellow. 119
on July 17, 2018 by guesthttp://aac.asm
.org/D
ownloaded from
7
TABLE 1: Position of ISAba11 insertions and target-site duplications in the ATCC 120
19606 colistin-resistant, LPS-deficient strains. 121
122
Strain Gene Insertion Target-site duplication
AL1835 lpxC nt 393 aaata
AL1836 lpxC nt 393 aaata
AL1837 lpxC nt 391 No duplicationa
AL1838 lpxC nt 420 aaaaatattaaagccagttgaggctttaattgat
AL1839 lpxC nt 421 tgatg
AL1840 lpxC nt 420 ttgat
AL1841 lpxC nt 390 taaaa
AL1850 lpxA nt 588 gtata
123 a 27 base pair deletion of lpxC following insertion of ISAba11 124
on July 17, 2018 by guesthttp://aac.asm
.org/D
ownloaded from
8
FIGURE LEGENDS 125
126
Figure 1: Colistin-resistant derivatives of ATCC 19606 do not produce LPS. SDS-127
PAGE separation and carbohydrate-specific silver staining of proteinase K-treated 128
whole cell lysates of the colistin sensitive strain ATCC 19606 and eight colistin-129
resistant derivatives. The positions of standard molecular mass markers are shown on 130
the left. 131
132
Figure 2: The insertion sequence ISAba11 is mobile and replicative in ATCC 19606. 133
Southern hybridization using a probe specific for the ISAba11 transposase gene 134
against DraI digested genomic DNA isolated from; ATCC 19606, AL1835-AL1841 135
(lpxC::ISAba11 mutants) and AL1850 (lpxA::ISAba11 mutant). The positions of DNA 136
size markers are shown on the left. Arrows at right indicate the positions and sizes of 137
the novel hybridizing fragments present in the LPS-deficient, colistin-resistant strains. 138
on July 17, 2018 by guesthttp://aac.asm
.org/D
ownloaded from
9
REFERENCES 139
1. Corvec, S., N. Caroff, E. Espaze, C. Giraudeau, H. Drugeon, and A. 140
Reynaud. 2003. AmpC cephalosporinase hyperproduction in Acinetobacter 141
baumannii clinical strains. J Antimicrob Chemother 52:629-635. 142
2. De Palmenaer, D., P. Siguier, and J. Mahillon. 2008. IS4 family goes 143
genomic. BMC Evol Biol 8:18. 144
3. Figueiredo, S., L. Poirel, A. Papa, V. Koulourida, and P. Nordmann. 2009. 145
Overexpression of the naturally occurring blaOXA-51 gene in Acinetobacter 146
baumannii mediated by novel insertion sequence ISAba9. Antimicrob Agents 147
Chemother 53:4045-4047. 148
4. Heritier, C., L. Poirel, and P. Nordmann. 2006. Cephalosporinase over-149
expression resulting from insertion of ISAba1 in Acinetobacter baumannii. 150
Clin Microbiol Infect 12:123-130. 151
5. Jeoung, O. Y., S. J. Jang, X. M. Li, G. Park, D. E. Yong, J. O. Kang, S. H. 152
Koo, W. Y. Kim, E. C. Kim, Y. J. Park, W. K. Song, J. H. Shin, J. Y. Ahn, 153
Y. Uh, K. W. Lee, S. H. Lee, W. G. Lee, H. S. Lee, T. Y. Choi, J. H. Cho, 154
S. H. Jeong, S. G. Hong, J. Lee, D. M. Kim, C. L. Chang, S. H. Shin, and 155
D. S. Moon. 2009. Prevalence and spread of integron-IS26 in imipenem-156
resistant Acinetobacter baumannii clinical isolates in South Korea. Int J 157
Antimicrob Agents 34:612-614. 158
6. Lee, Y., C. K. Kim, H. Lee, S. H. Jeong, D. Yong, and K. Lee. 2010. A 159
novel insertion sequence, ISAba10, inserted into ISAba1 adjacent to the 160
blaOXA-23 gene and disrupting the outer membrane protein carO gene in 161
Acinetobacter baumannii. Antimicrob Agents Chemother. Epub ahead of 162
print, October 11 doi:10.1128/AAC.01672-09 163
on July 17, 2018 by guesthttp://aac.asm
.org/D
ownloaded from
10
7. Moffatt, J. H., M. Harper, P. Harrison, J. D. Hale, E. Vinogradov, T. 164
Seemann, R. Henry, B. Crane, F. St Michael, A. D. Cox, B. Adler, R. L. 165
Nation, J. Li, and J. D. Boyce. 2010. Colistin resistance in Acinetobacter 166
baumannii is mediated by complete loss of lipopolysaccharide production. 167
Antimicrob Agents Chemother 54:4971-4977. 168
8. Nesmelova, I. V., and P. B. Hackett. 2010. DDE transposases: Structural 169
similarity and diversity. Adv Drug Deliv Rev 62:1187-1195. 170
9. Peleg, A. Y., H. Seifert, and D. L. Paterson. 2008. Acinetobacter baumannii: 171
emergence of a successful pathogen. Clin Microbiol Rev 21:538-1582. 172
10. Post, V., P. A. White, and R. M. Hall. 2010. Evolution of AbaR-type 173
genomic resistance islands in multiply antibiotic-resistant Acinetobacter 174
baumannii. J Antimicrob Chemother 65:1162-1170. 175
11. Smith, M. G., T. A. Gianoulis, S. Pukatzki, J. J. Mekalanos, L. N. 176
Ornston, M. Gerstein, and M. Snyder. 2007. New insights into 177
Acinetobacter baumannii pathogenesis revealed by high-density 178
pyrosequencing and transposon mutagenesis. Genes Dev 21:601-614. 179
180
181
on July 17, 2018 by guesthttp://aac.asm
.org/D
ownloaded from
top related