thesis variation in chromosomal aberration …
Post on 30-Apr-2022
3 Views
Preview:
TRANSCRIPT
THESIS
VARIATION IN CHROMOSOMAL ABERRATION INDUCTION IN DIFFERING ATM
AND ASPM GENOTYPIC BACKGROUNDS DETECTED VIA A MODIFIED PNA FISH
TECHNIQUE
Submitted by
Ashley Romero
Department of Environmental and Radiological Health Sciences
In partial fulfillment of the requirements
For the Degree of Master of Science
Colorado State University
Fort Collins, Colorado
Summer 2013
Master’s Committee:
Advisor: Takamitsu Kato Joel Bedford Douglas Thamm
Copyright by Ashley Romero 2013
All Rights Reserved
ii
ABSTRACT
VARIATION IN CHROMOSOMAL ABERRATION INDUCTION IN DIFFERING ATM
AND ASPM GENOTYPIC BACKGROUNDS DETECTED VIA A MODIFIED PNA FISH
TECHNIQUE
A modified PNA (peptide nucleic acid) FISH (fluorescence in situ hybridization) method has
been developed for efficient quantitative and qualitative analysis of chromosomal aberration
formation. PNA FISH was used to detect a heightened sensitivity in mouse fibroblasts in
response to ionizing radiation with Atm-/-
and in mouse embryonic fibroblasts (MEFs) in
response to loss of the Aspm gene respectively. For Atm analysis, four commonly used
inbred mouse strains were used, C57BL/6J, A/J, 129S6, and BALB/cByJ, and exposed to
cesium-137 at a dose rate of approximately 2.5 Gy/min. For Aspm analysis, MEF cell lines
were used and exposed to 0.2 M tamoxifen for inducible Cre-lox excision of floxed Aspm
alleles. Upon analysis of chromosome-type aberrations, there were statistically significant
elevations in acentric fragment and/or dicentric average frequencies seen across all strain
backgrounds of the Atm-/-
genotype, however, only the 129S6 Atm-/-
strain backgrounds
exhibited a significant increase in mean telomere-associated fusion events. In addition, there
was a heightened dose response from a 0 to 2 Gy dose in Atm-/-
BALB/cByJ and C57BL/6J
backgrounds indicating a lack of synergism of the Prkdc (protein kinase, DNA-activated,
catalytic polypeptide) defect in BALB/cByJ strains. For Aspm analysis, in comparison to
control, or untreated, MEF strains, there was an increased average aberration frequency in
Aspm-/-
cell lines over a 48-hour time period. However, there was also an increased
frequency in Aspm+/-
cell lines comparable to the frequency observed in Aspm-/-
cells, which
is characteristic of haploinsufficiency. Therefore, not only is Atm status an important
determinant of radiosensitivity, but strain backgrounds can also contribute to a heightened
iii
response. In addition, Aspm expression is critical for the maintenance and repair of DNA.
Together, this data suggests that the Atm and Aspm genes are crucial components in the
preservation of chromosomal integrity and genomic stability in response to DNA damage.
iv
ACKNOWLEDGEMENTS
I would like to acknowledge and thank the National Institute of Radiological Sciences for the
use of their facilities and the opportunity of collaborating with them in this research as well
as the opportunity to be apart of the open laboratory experience. I would also like to
especially thank Dr. Fujimori for providing the MEF cell strains used in the Aspm project and
the support of his expertise.
I would also like to express my appreciation to the Environmental and Radiological Health
Sciences Department at Colorado State University for all help with regards to this project in
using their equipment and laboratory. I would especially like to thank Dr. Weil, Dr. Genik,
and Dr. Nagasawa for their knowledge, for characterizing and supplying the mice strains, and
for preparation of the primary cell cultures used in the Atm project.
I would especially like to thank and express my appreciation to my advisor and mentor Dr.
Takamitsu Kato who has provided me with a multitude of educational experiences as well as
for his encouragement and direction. It has been a privilege to work in his lab and to learn
the many laboratory techniques that helped me grow as a graduate student. I would also like
to thank my committee members Dr. Joel Bedford and Dr. Douglas Thamm for their support,
guidance and expertise.
I am very grateful and appreciative of the support and assistance provided by my fellow
laboratory colleagues Ian Cartwright, Justin Bell, and Carissa Burke who selflessly donated
their time and efforts in completing this project.
v
TABLE OF CONTENTS
ABSTRACT .................................................................................................................................... ii
ACKNOWLEDGEMENTS ........................................................................................................... iv
TABLE OF CONTENTS .................................................................................................................v
LIST OF TABLES ........................................................................................................................ vii
LIST OF FIGURES ..................................................................................................................... viii
LIST OF SYMBOLS ..................................................................................................................... ix
LIST OF ACRONYMS ...................................................................................................................x
CHAPTER ONE - INTRODUCTION
1.1. GENOMIC INSTABILITY AND DNA DAMAGE ..............................................................1
1.1.1. Chromosomal aberrations ............................................................................................2
1.1.2. DNA repair pathways ..................................................................................................5
1.2. ATM AND ASPM ....................................................................................................................7
1.2.1. ATM and DNA repair ................................................................................................11
1.2.2. ATM disruption ..........................................................................................................11
1.2.3. ASPM function ..........................................................................................................12
1.2.4. ASPM disruption .......................................................................................................13
1.3. CYTOGENETIC ASSAYS ...................................................................................................14
1.3.1. Advancements in cytochemical techniques .................................................................15
1.3.2. PNA FISH ..................................................................................................................15
CHAPTER TWO – Strain Dependent Variations in Radiation-Induced Chromosome-
type Aberrations on Atm+/+
and Atm-/-
Genotypic Backgrounds.
2.1. BACKGROUND ...................................................................................................................19
2.2. MATERIALS AND METHODS ............................................................................................20
2.2.1. Cell culture ...................................................................................................................21
vi
2.2.2. Irradiation .....................................................................................................................22
2.2.3. Metaphase chromosome preparation ...........................................................................22
2.2.4. Modified PNA FISH method .......................................................................................23
2.2.5. Scoring method for chromosome aberrations ..............................................................23
2.2.6. Statistical Analysis .......................................................................................................23
2.3. RESULTS ..............................................................................................................................24
2.4. DISCUSSION ........................................................................................................................29
CHAPTER THREE - Induction of Chromosomal Aberrations Consequent to Aspm
Excision Via the Cre-Lox Recombination System.
3.1. BACKGROUND ...................................................................................................................30
3.2. MATERIALS AND METHODS ...........................................................................................31
3.2.1. Cell culture ..................................................................................................................34
3.2.2. Metaphase chromosome preparation ..........................................................................35
3.2.3. Modified PNA FISH method ......................................................................................35
3.2.4. Scoring method for chromosome aberrations .............................................................36
3.2.5. Statistical analysis .......................................................................................................36
3.3. RESULTS ..............................................................................................................................36
3.4. DISCUSSION ........................................................................................................................40
CHAPTER FOUR – CONCLUSIONS ......................................................................................41
REFERENCES .............................................................................................................................43
APPENDIX I ................................................................................................................................50
vii
LIST OF TABLES
Table 1: Origin and Atm status of mouse cells ..............................................................................21
Table 2: Summary of aberration frequencies for C57BL/6J, BALB/cByJ, A/J and 129S6
Atm+/+
and Atm-/-
strain backgrounds .............................................................................................25
Table 3: Origin and Aspm status of mouse cells ..........................................................................34
Table 4: Summary of aberration frequencies for MEF strains across differing Aspm
genotypes .......................................................................................................................................37
Table 5: Signal strength over time ................................................................................................52
Table 6: Signal strength over varying temperatures .....................................................................53
viii
LIST OF FIGURES
Figure 1: Examples of chromosome-type aberrations in metaphase murine chromosome
spreads as detected by DAPI staining and PNA hybridization ........................................................4
Figure 2: Representation of the NHEJ DNA repair pathway ........................................................6
Figure 3: Schematic representation of the ATM gene ....................................................................8
Figure 4: Molecular location of the ASPM gene ...........................................................................10
Figure 5: Comparison of PNA FISH and Giemsa staining techniques ........................................18
Figure 6: Comparison of average dicentric aberration yield over a 0, 1, and 2 Gy dose for
each strain background of Atm+/+
and Atm-/-
genotypes .................................................................26
Figure 7: Comparison of average acentric fragment yield over a 0, 1, and 2 Gy dose for each
strain background of Atm+/+
and Atm-/-
genotypes. ......................................................................27
Figure 8: Comparison of average telomere-associated fusion yield over a 0, 1, and 2 Gy
dose for each strain background of Atm+/+
and Atm-/-
genotypes ...................................................28
Figure 9: The loxP sequence ........................................................................................................32
Figure 10: Diagram representing variations of the Cre-lox recombination system .....................33
Figure 11: Average dicentric frequencies compared at 0 (Control), 24-hour, and 48-hour
time points ......................................................................................................................................38
Figure 12: Average acentric fragment formation frequency across 0 (Control), 24, and 48-
hour time period. ............................................................................................................................39
ix
LIST OF SYMBOLS
C degrees Celsius
% percentage
bp base pairs
Gy Gray
Gy/min Gray per minute
kb kilobases
kDa kilo Daltons
g/ml micrograms per milliliter
l microliter
m micrometer
mg/ml milligram per milliliter
ml milliliter
min minute
mM millimolar
M molar
nM nanomolar
U/ml units per milliliter
x
LIST OF ACRONYMS
ANOVA analysis of variance
ASPM abnormal spindle-like microcephaly-associated
ATM ataxia telangiectasia mutated
BER base excision repair
BrdUrd 5`-bromodeoxyuridine
CO2 carbon dioxide
DAPI 4`, 6-diamidino-2-phenylindole
DNA deoxyribose nucleic acid
DNA-PK DNA-dependent protein kinase
DNA-PKcs catalytic subunit of the DNA-dependent protein kinase
DSB double-strand break
ER estrogen receptor
FBS fetal bovine serum
FEN1 flap endonuclease 1
FISH fluorescence in situ hybridization
FRAP FKBP12 rapamycin-associated protein
HCl hydrogen chloride
HiCEP high-coverage expression profiling
HR homologous recombination
IQ isoleucine-glutamine
IR ionizing radiation
KCl potassium chloride
MCPH autosomal recessive primary microcephaly
MEF mouse embryonic fibroblasts
xi
MEM minimal essential medium
MMR mismatch repair
mRNA messenger RNA
NE neuroepithelial
NER nucleotide excision repair
NHEJ non-homologous end-joining
PBS phosphate-buffered saline
PCC premature chromosome condensation
PCR polymerase chain reaction
PFA paraformaldehyde
PNA peptide nucleic acid
PRKDC protein kinase, DNA-activated, catalytic polypeptide
RNAi RNA interference
siRNA small interfering RNA
SSB single-strand break
TRRAP transformation/transcription domain-associated protein
1
CHAPTER ONE
INTRODUCTION
1.1. GENOMIC INSTABILITY AND DNA DAMAGE
Genomic instability is a condition where the rate of introduction of genomic changes
is elevated relative to the normal condition (1). The genomic changes can be attributed to
genetic alterations and environmental influences resulting in cellular damage including gene
mutation, gene amplification, chromosomal destabilization, and cellular transformation (2).
The direct or indirect damages that accumulate from transient or prolonged exposures to
DNA damaging agents are presumably the impetus needed for carcinogenicity. Exposure to
ionizing radiation, e.g. X-rays or gamma rays, exemplifies a catalyst for genomic alterations
manifested through chromosomal destabilization and rearrangements. DNA single-strand
breaks (SSBs) and DNA double-strand breaks (DSBs) are such lesions that occur with
exposure to clastogenic agents, such as ionizing radiation, but also are a result of natural
biological processes such as replication and recombination events in the cell cycle (3). DNA
SSBs, lesions that occur on one strand of the chromosome, after exposure to ionizing
radiation are able to efficiently be repaired in normal cells, however, DNA DSBs, lesions that
occur on both strands of the chromosome, can have genotoxic results due to incomplete
restoration of the DNA. Due to the more critical outcomes that are associated with DNA
DSBs, including radiation-induced chromosomal damage, mutagenesis, and cell killing, it has
become an increasingly important topic to study in order to elucidate underlying molecular
mechanisms of disease onset and progression (4-6). Cytogenetic assays of radiation-induced
cellular changes have become a more important focus in radiobiological studies over the
years in the wake of innovative genetic research. Such research includes studies done with
Drosophilia where spontaneous mutations were comparable to the mutations induced by X-
ray treatment. However, by observation of Drosophilia sperm cells and oocytes, the
2
transforming action of X-rays caused other genetic problems other than gene mutations. It
was found that the condition of the chromosomes themselves were being compromised which
was reflected in altered rearrangement, fragmentations, and inversions of portions of the
chromosomes (7). A closer look at causation takes us further into the microcosm of the
nucleus of the cell, the chromosomes that are housed within and the diverse lesions that can
arise.
1.1.1. Chromosomal aberrations
In order to observe the lesions in their entirety, cells are examined at the first
metaphase after exposure to ionizing radiation or a radiomimetic drug. The structural
alterations that can be distinguished upon observation of the chromosomes can be categorized
into chromosome- or chromatid-type aberrations (8). Chromosome-type aberrations arise
when the damage to an unduplicated chromatid thread, corresponding to the pre-DNA
synthesis stage of the cell cycle, is passed along to the duplicated chromosome. Chromatid-
type aberrations occur when damage is inflicted to only one of the sister chromatids after
duplication at the time of exposure (8). However, for the purposes of this thesis, only
chromosome-type aberrations will be discussed. Two primary structures that are involved in
improper or incomplete biological processes that result in chromosome-type aberrations are
the centromere and telomere structures. The centromere, or kinetochore, is the primary
constriction point between two sister chromatids and it is at these foci during anaphase of the
cell division cycle where spindle organization occurs for migration of the chromosomal piece
to opposite poles of the cell (9, 10). Telomeres are nucleoprotein structures consisting of
repetitive sequences of (TTAGGG)n that cap the ends of eukaryotic chromosomes and play
important roles in preservation of genomic stability through end protection and maintenance
of chromosomal ends (11). Radiation-induced cellular damage resulting in commonly
observed chromosome-type lesions involving these structures are classified as exchange-type
3
aberrations, or aberrations resulting from illegitimate reunions involving two or more double-
strand breaks. An example of this aberration is known as a dicentric where one of the two
interchanged chromosomes now have two centromeres (12). Within the occurrence of a
dicentric, further classification is applied to account for telomere abnormalities which occur
when cellular damage or improper telomere regulation and maintenance results in the
recognition of DNA ends as double-strand breaks consequently activating cell cycle
checkpoint responses and aberrant recombination events resulting in fusions (11, 13, 14).
Figure 1 highlights examples of these chromosome-type aberrations through PNA FISH.
4
A B
C
Figure 1. Examples of chromosome-type aberrations in metaphase murine
chromosome spreads as detected by DAPI (diamidino-2-phenylindole) staining and
PNA hybridization. (A) Acentric fragments designated at both green arrows. (B) A
complete asymmetrical interchange (top red arrow) accompanied by an acentric
fragment, or compound fragment (bottom orange arrow). (C) A telomere-associated
fusion event (yellow arrow).
5
1.1.2. DNA repair pathways
Cellular compensation mechanisms that are specific for DNA SSBs and DNA DSBs
include mismatch repair (MMR), base excision repair (BER), nucleotide excision repair
(NER), non-homologous end-joining (NHEJ), and homologous recombination (HR) (15).
The repair mechanisms that are specific to DNA DSBs are NHEJ and HR. The non-
homologous end-joining (NHEJ) DNA pathway is the primary repair mechanism for DSB
repair in the initial G0/G1 phases of the cell cycle in response to ionizing radiation and is
relatively independent of terminal DNA sequence homology when joining the two ends of a
DSB and produces junctions that vary in sequence composition as shown in Figure 2 (16, 17).
6
Figure 2. Representation of the NHEJ DNA repair pathway (15).
7
Specifically, the Ku heterodimer, Ku80/Ku70, binds to the end of the DNA fragments and
activates the catalytic subunit of DNA-PK (DNA-dependent protein kinase) which interacts
with other cofactors, such as XRCC4 and Ligase IV, to provide a linkage between the two
DNA strands. Processing of the 5’ and 3’ overhangs is done through a protein kinase, ataxia
telangiectasia mutated (ATM), the MRN complex comprised of MRE11, RAD50, and NBS1,
and presumably the flap endonuclease 1 (FEN1) (15). Dysfunction of one or more of these
proteins can lead to diseased states resulting in hypersensitivity to various DNA-damaging
agents where long-term exposure increases susceptibility to the development of cancer.
1.2. ATM AND ASPM
Two such important genes associated with DNA repair, that when compromised can
lead to debilitating susceptibilities, are ATM and ASPM. The ATM, ataxia telangiectasia
mutated, protein has sequence homology to the phosphatidylinositol-3-OH-kinase family of
proteins and is a relatively large protein extending over 160 kb of genomic DNA containing
66 exons giving rise to a 350 kDa protein (18, 19). The kinase activity of the protein occurs at
the C-terminal end where the FAT (FRAP, ATM, TRRAP)- related, domain maintains
influence on the adjacent kinase domain and its activity as seen in Figure 3 (20).
8
Figure 3. Schematic representation of the ATM gene. (19).
9
The ASPM, abnormal spindle-like microcephaly-associated protein, gene encoding a 10,434
bp coding sequence with 28 exons spanning 65 kb of genomic DNA is mapped on
chromosome 1q31 as depicted in Figure 4. The gene consists of four regions: the
microtubule-binding N-terminal domain, a calponin-homology domain, isoleucine-glutamine
(IQ) repeat domain, and a C-terminal region (21, 22). The expression of each gene is
essential for maintaining chromosomal integrity, therefore, each play an important role in the
preservation of genomic stability.
10
Figure 4. Genetic map of the ASPM gene. The ASPM gene is mapped on the long
(q) arm of chromosome 1 at position 31 (23).
11
1.2.1. ATM and DNA repair
Primarily, the ATM protein is one of the primary responders to DNA DSBs by
increasing its kinase activity for preparation of a series of phosphorylation events,
specifically, targeting threonine and serine residues followed by glutamine (SQ/TQ motifs).
Prior to activation, ATM is held in an inactive dimeric or multimeric form where the kinase
domain is blocked by the FAT region of the other. When DNA damage occurs,
autophosphorylation at Ser1981 residues will allow the proteins to transform into active
monomeric forms where after damage is inflicted, ATM is recruited to the DSB sites where
enzymatic reactions such as signaling transduction through phosphorylation of various
downstream substrates such as the MRN complex, checkpoint proteins, γ-H2AX, among
others (24).
1.2.2. ATM disruption
Mutations can occur throughout the gene, most of which are truncating or missense,
and consequently can result in the decreased production of the protein, or a reduction in
kinase activity with normal amounts of the protein produced (19). Therefore, if ATM is
compromised and in response to ionizing radiation, the rejoining capacity of the cell is
hindered leading to an increase in chromosomal damage and a decrease in cellular viability.
The cell`s progeny is also affected due to continued proliferation despite any damage
incurred due to the lack of G1/S phase checkpoint activation to allow for cellular arrest and
proper ATM-dependent repair (25). Consequent to mutations of the ATM gene, debilitating
effects ensue such as a condition characterized by hypersensitivity to radiation, cancer
susceptibility, immune dysfunction, and decreased neurological function. Ataxia
telangiectasia (A-T) is a rare, early onset neurological disorder characterized by
hypersensitivity to ionizing radiation, immunodeficiency, cancer susceptibility, and motor
deficits. Young children, usually between 2-3 years of age, begin expressing the classical A-
12
T phenotype initially with ataxia, which renders them incapable to walk by age ten.
Oculocutaneous telangiectasias, dilated blood vessels, appear usually after the onset of
neurological symptoms such as oculomotor apraxia and dysarthria. Most patients are
immunodeficient with frequent sinopulmonary infections and predisposed to cancer, usually
lymphoid (26). The disease is autosomal recessive with cells exhibiting null mutation in both
copies of the ATM gene, however, individuals exhibiting heterozygosity have shown to have
a increase in cancer predisposition, albeit a less severe phenotype, depending on the nature of
the mutation in which a dominant negative effect can further disrupt ATM signaling (18, 26).
A demonstrable model in this disease progression can be found in mice due to an 84% amino
acid identity and 91% similarity to the ATM homolog (27). Mice that are rendered
nullizygous via disruption of Atm through gene targeting exhibit a similar phenotype to that
of individuals with A-T in which growth retardation, neurologic dysfunction, sterility, and
thymic lymphoma formation was observed (28).
1.2.3. ASPM function
Interspecies comparisons of ASPM homologues reveal that a larger brain size is correlated
with a greater number of IQ repeats and thus a larger protein size (22). In addition, it has
been suggested that the evolving ASPM gene may have been positively selected in hominids
due to highly conserved coding and noncoding regions (21). The ASPM gene is a homologue
to the asp (abnormal spindle) gene of Drosophilia melanogaster where it is known to be
essential for the organization of structural components, microtubule and mitotic spindle
development, during mitosis and meiosis (29). This can be attributed to the resultant gene
product that is reported to be a spindle pole/centrosome protein (30). This aspect was also
studied in mouse embryonic neuroepithelial (NE) cells where the loss of Aspm, via RNA
interference (RNAi), resulted in centromere detachment from sister chromatids, and thus
altering spindle position during mitosis. Consequently, an alteration of the cleavage plane
13
increased the probability of asymmetrical division (31). The ASPM gene is preferentially
expressed in embryonic and fetal mammalian neuroepithelium, however, in human adults,
ASPM mRNA is also expressed in the breast, lung, pancreas, uterus, colon, thyroid, liver,
bladder, kidney, ovary, testis, stomach, lymph node, cervix, and esophagus, but expression
was not found in the brain and skeletal muscle (22, 32-34).
1.2.4. ASPM disruption
Because the ASPM gene is responsible for proper cell division, mutations result in the
mitotic arrest of neuroblasts resulting in an underdeveloped central nervous system (33, 35,
36). In humans, cerebral cortical size is diminished in individuals that carry the mutated gene.
Specifically, mutations at the MCPH5 locus of the ASPM gene causes a rare condition called
autosomal recessive primary microcephaly (MCPH) which is characterized by a reduction in
fetal brain growth and thus a reduction in head circumference, particularly the cerebral cortex
(37). As a result, a small but structurally normal brain size and accompanied mental
retardation occurs, but no other neurological abnormalities are observed (22, 38). These
outcomes have also been induced through ionizing radiation as seen in atomic bomb
survivors of Hiroshima and Nagasaki as well as artificial induction by exposing laboratory
mice in utero. The mouse homologue, Aspm, exhibits 74.4% homology to the human ASPM
gene and therefore is an adequate model for studying functionality and disease mechanisms.
Similar mutational outcomes are seen in the brain of Mus musculus where the Aspm gene
plays a central role in cerebral cortical neurogenesis (22). To underline this role in
neurogenesis, Pulvers et. al. created two mutant mouse cell lines, AspmI-25
and AspmI-7
,
containing truncating mutations in the microtubule-binding domain and C-terminal amino
acids respectively to mimic the phenotype expressed by human microcephaly patients.
Indeed there was a decrease in brain size and weight in both mutated mice, however, the
severity of the outcome was less than that seen in human primary microcephaly (39). Aside
14
from mutant alterations, it has been suggested, through studies with fetal murine neural cells,
that the mechanism underlying microcephaly was through cell killing through ionizing
radiation exposure which reduces the number of neural stem/progenitors during cellular
proliferation at day 11-14 fetal brains (40, 41). In addition, Fujimori et al. proposed another
mechanism suggesting that through radiation-induced downregulation of the Aspm gene,
symmetric division of neuronal progenitors is suppressed resulting in a reduction of neuronal
cells and thus microcephaly (42).
1.3. CYTOGENETIC ASSAYS
In order to elucidate mechanisms of disease initiation and progression resulting from
genetic disruption, chromosomal alterations must be examined and so cytogenetic assay have
become an integral tool for analysis at the level of the individual cell (43). A variety of
cytogenetic assays have been developed for the independent or simultaneous
genotoxicological monitoring of chemical agents, pharmaceuticals, and mutagens. For
example, the chromosome aberration analysis assay is used to detect chromosomal anomalies
in metaphase spreads where structural and/or numerical aberrations are scored. Another
technique is the micronucleus cytokinesis-block assay which takes advantage of cells that
express micronuclei though the identification of their binucleate appearance through the
inhibition of cytokinesis by cytochalasin-B (44). Sister-chromatid exchanges are measured
and visualized through the incorporation of a DNA base analog 5`-bromodeoxyuridine
(BrdUrd) for the standard fluorescence and Giemsa staining method or alternatively, the
utilization of antibody detection (45). The premature chromosome condensation (PCC)
method is involves the fusion of mitotic with interphase cells and provides a way to analyze
the fragility of chromatin, or capacity to repair initial damage from radiation exposure (46,
47). In conjunction with molecular identifiers, qualitative analysis is enhanced by
15
strengthening the resolution of these assays, thereby ensuring consistent, quantifiable data for
the generation of dose-response relationships.
1.3.1. Advancements in cytochemical techniques
Over the years, the development of cytochemical techniques for the identification and
detection of cellular structures has led to improved methods that allow a more specific and
detailed view at the molecular level. Historically, non-specific natural and synthetic dyes
were used to label general molecular entities such as basic proteins, nucleic acids, and
carbohydrates. In the early 1940`s, fluorescently conjugated antibodies were developed
which led to the first antibody-dependent fluorescent detection of nucleic acid hybrids (48,
49). In the late 1960`s, the earliest in situ hybridization utilizing radiolabeled probes
consisting of non-specific labeling through the random incorporation of radioactive modified
bases into growing cells and autoradiography (48, 50). Finally, in 1980, the first application
of fluorescent in situ detection was developed where fluorophore-labeled RNA was used as a
probe for DNA sequences (51). In the years following, improved hybridization methods for
direct labeling of synthetic, single-stranded DNA probes were created for better sensitivity
and resolution for fluorescent detection (52). For example, multicolor banding (mBAND) is
a painting technique which is used to detect any aberration leading to the loss or
rearrangement of longitudinal colored bands along the axis of the chromosome (53). Another
painting technique used for the detection of intrachanges, among other aberrations, is the
PNA FISH technique.
1.3.2. PNA FISH
A specific and sophisticated qualitative cytogenetic technique used to measure the
effects of cellular damage is the PNA (peptide nucleic acid) FISH (fluorescence in situ
hybridization) method. This method was developed for studies involving chromosome
structure and function, genome mapping, and clinical cytogenetics and has become more
16
widely used due to its high hybridization efficiency and its high reproducibility (54, 55).
Fluorescent in situ hybridization (FISH) is a technique using molecular DNA probes for the
detection of complementary DNA sequences along a chromosome. Peptide nucleic acids
(PNAs) mimic nucleic acids such that they contain pseudo-peptide backbone that consist of
charge neutral and achiral N-(2-aminoethyl) glycine units where the nucleobases are
connected though a methylene carbonyl linker (56-58). The fluorochrome-labeled PNA
oligomers then hybridize to tandem DNA repeats such as telomeres (TTAGGG) and
centromeres with high affinity and specificity. Together with the application of the DAPI
counterstain, the signals can then be clearly seen with fluorescent microscopy and the proper
imaging software. Traditionally, for the probe to hybridize to DNA, both have to be rendered
single-stranded through the application of heat in a formamide solution followed by
hybridization of the probe which requires multiple hours (59). However, the modified method
used for these experiments does not require denaturation and ranges in hybridization periods
from 6 to 18 hours (Appendix 1). Visually, this method provides a clear distinction between
simple and complex chromosomal aberrations that arise from radiation-induced damage in
cytological preparations. This technique provides a more in depth look into the various types
of telomeric and centromeric chromosomal aberrations such as dicentric formation and
telomeric fusions that cannot be seen with other practical staining methods such as the
Giemsa stain. Although, the Giemsa stain will allow for the identification of exchanges and
other chromosomal structural rearrangements, this stain does not account for other structural
entities that may provide a more mechanistic view of damage induction (Figure 5).
Specifically, the modified PNA FISH technique was utilized to examine our overall
hypothesis through the detection and identification of chromosome aberrations due to an
increased cellular sensitivity in response to radiation exposure and/or genotypic variation of
two genes involved in DNA repair, Atm and Aspm. This methodology allowed for the
17
characterization of three different types of chromosome-type aberrations that may be
indistinguishable through other conventional cytogenetic techniques.
18
A
B
Figure 5. Comparison of PNA FISH and Giemsa staining techniques. (A) FISH-
labeled human peripheral lymphocyte chromosome spread. (B) Human fibroblast
chromosome spread shown with Giemsa stain. With PNA FISH centromere and
telomere structures are clearly identifiable and distinguished through the use of the
probe specificity against a DAPI background.
19
CHAPTER TWO
Strain Dependent Variations in Radiation-Induced Chromosome-type Aberrations on
Atm+/+
and Atm-/-
Genotypic Backgrounds.
2.1. BACKGROUND
Differences in radiosensitivity in response to a particular dose of radiation have
proven to be dependent upon the capacity of the cell to repair DNA DSBs which can lead to
differences in cell killing sensitivity, chromosome aberrations production, or mutation
induction (60). A previous study has shown that cells from Atm-/-
mice showed an increase in
radiosensitivity as detected by an increase in γ-H2AX mean foci formation per cell via the γ-
H2AX assay in comparison to Atm+/+
and Atm+/-
cell strains in response to acute high-dose
radiation exposure. This same γ-H2AX assay was used to distinguish a 2.7-fold increase in
average foci per cell in response to low dose-rate radiation exposure between Atm+/+
and
Atm+/-
cells and a 6.3-fold larger increase for Atm-/-
cells. The implications of these results
indicate the occurrence of mild hypersensitivities in even heterozygous populations in
response to radiation exposure and the initial mechanism of disease progression is predicated
on DNA DSB processing and repair (61). However, experimental outcomes with mice of
differing genetic backgrounds for the Atm gene in conjunction with differing mice strains are
not well known. Therefore, we used four different inbred mice strains, C57BL/6J,
BALB/cByJ, A/J, and 129S6, to quantify variations in genetic background, Atm+/+
and Atm-/-
,
resulting in a uniformly increased radiosensitivity that might increase or reduce to the
sensitivity of the mice on these different backgrounds. The BALB/cByJ strain carries a
hypomorphic allele of a protein kinase, DNA-activated, catalytic polypeptide (Prkdc or
DNA-PKcs), a key component of the NHEJ pathway in repairing radiation-induced double-
strand breaks, and so mice of this background would be expected to be especially sensitive to
neoplastic formation and genomic instability (62). The C57BL/6J mice are a commonly used
20
inbred strain that provides a controlled background in mutation expression due to its
resistance to most tumor formations. These mice are often used as an experimental control as
is the 129S6 strain, due to relatively normal fecundity and viability. The A/J strain is another
widely used strain for cancer research and has a high incidence of spontaneous lung tumors
and myoepitheliomas (63, 64). However, not much is known about the radiosensitivity of
these strains in conjunction with the differing Atm backgrounds. Given the various mutations
that can occur throughout the gene as well as the relatively large size of it, it is difficult and
expensive to isolate and study. Therefore, we hypothesized a variation in radiosensitivity
across the four inbred strains and that a Atm-/-
genotypic background results in an increased
radiosensitivity that adds to or reduces the sensitivity of the mice strains. Radiosensitivity
was detected through the formation of chromosomal aberrations via a modified PNA FISH
technique.
2.2. MATERIALS AND METHODS
The cell strains were primary cultures derived from ear punch biopsies from adult
mice that were being used to generate congenic strains for the Atmtm1Awb knockout allele.
The founder strain is 129S6/SvEvTac-Atmtm1Awb. At the time tissues were collected, the
knockout allele was fully introgressed onto and A/J background and partially introgressed
onto the CBA/J background. The progeny of Atmtm1Awb/1 3 Atmtm1Awb/1 matings were
genotyped by PCR amplification of tail snip DNA using a protocol provided by Dr. Carrolee
Barlow (65). The amplification primers used were GACTTCTGTCAGATGTTGCTGCC
(ATM-F), CGAATTTGCAGGAGTTGCTGAG (ATM-B), and
GGGTGGGATTAGATAAATGCCTG (ATM-Neo). Mating and genotyping were performed
under protocol no. 03-132A of the Colorado State University Animal Care and Use
Committee and were funded by the Ataxia-Telangiectasia Children’s Project. BALB/cByJ
Atmtm1Awb congenic mice were generated by thirteen generations of conventional
21
backcrosses followed by five intercross generations. These congenic strains are available
from the Jackson Laboratory (Bar Harbor, ME). Atm-/-
mice are infertile so the congenic
strains are maintained with Atm+/-
breeders (66). The strains, genotypes and sex of mice used
for establishing the cultures are summarized in Table 1.
TABLE 1
Origin and Atm status of mouse cells
2.2.1. Cell culture
Fibroblast cultures were established from mouse ear from at least five mice of each
mouse strain. Ears were washed with penicillin and streptomycin containing growth medium.
The ear sample was cut with two sharp scalpels into smaller sample tissue pieces. These
small tissue pieces were suspended in 15 ml centrifuge tube containing 2 U/ml of collagenase
solution and digested on the shaker for 40 min. at 37ºC. The fragments were washed three
times with warm growth medium to remove collagenase. The pellets of the digested tissue
were pipetted hard to obtain single cells or small tissue fragments before plating on tissue
Atm status Mouse ID
no. Mouse strain Sex
+/+ B-36 C57BL/6J Male
+/+ B-70 C57BL/6J Male
+/+ B-28 BALB/cByJ Male
+/+ B-29 BALB/cByJ Male
+/+ B-34 A/J Male
+/+ B-42 A/J Male
+/+ B-38 129S6 Male
+/+ B-58 129S6 Male
-/- B-57 C57BL/6J Female
-/- B-68 C57BL/6J Male
-/- B-46 BALB/cByJ Male
-/- B-55 BALB/cByJ Female
-/- B-47 A/J Male
-/- B-49 A/J Male
-/- B-26 129S6 Male
-/- B-41 129S6 Female
22
culture dish. Fibroblasts were cultured in minimal essential medium (MEM) supplemented
with 10% fetal bovine serum (FBS), 100 U/ml penicillin, and 100 µg/ml of streptomycin and
maintained at 37°C in a humidified atmosphere of 5% CO2 in air. These cells were
synchronized and maintained after two days in a G0/G1 state during irradiation and using the
isoleucine deprivation method (67).
2.2.2. Irradiation
Irradiations were carried out using either a J. L. Shepherd Model Mark I-68 222-TBq
(6000 Ci) 137
Cs irradiator. The dose rate for the acute high-dose-rate exposure was 2.5
Gy/min at room temperature.
2.2.3. Metaphase chromosome preparation
Immediately after irradiation, the fibroblasts were sub-cultured and treated for 6 hours
with colcemid prior to harvest. 0.1 g/ml of colcemid (Invitrogen) was added to the media
inside the flask of cells in order to capture the chromosomes in the first metaphase post-
irradiation. The cells were then trypsinized and suspended in 75 mM KCl solution at 37°C in
a water bath for 20 minutes. Each sample was fixed in Carnoy`s solution (3:1 methanol to
acetic acid) according to standard cytogenetic procedures (68). Before the cell solution was
dropped, the slides were chilled in ice water. After application, the slides were set aside and
allowed to air dry for approximately 5 minutes. For PNA FISH staining, once the slides were
dry, they were immersed in 4% paraformaldehyde (PFA) in phosphate-buffered saline (PBS)
for 10 minutes after which they were immediately washed with PBS and then immersed in
0.1 mg/ml of RNase A in PBS solution for 15 minutes at 37°C. The slides were then washed
again with fresh PBS and placed in a solution prepared with 1% pepsin in 40 mL of 100 mM
HCl at 37°C for 20 minutes. After, the slides were washed again in fresh PBS and then
placed in an ethanol series for dehydration for 2 to 3 minutes each.
23
2.2.4. Modified PNA FISH method
After dehydration, hybridization was performed using a hybridization solution
containing formamide, 200 nM of TelG-Cy3, 200 nM of CENPB Box-FAM (Panagene,
Thousand Oaks, CA), 1M Tris-HCl, and pure water. 15 µL of the staining solution was
pipetted onto the slide and covered with a cover slip that contained rubber cement along the
edges to create a firm seal over the stain and slide. The slides were then allowed to set
overnight at room temperature after which the cover slip was removed and placed in PN
buffer at 37°C for five minutes and then washed with freshly prepared PBS at room
temperature. After washing, the slides were counterstained with DAPI in antifade
(Invitrogen). Digital images were captured using a Zeiss Axioskop Microscope with
CoolSnapHQ and Metamorph software. The slides were analyzed at 60X magnification to
view and obtain pictures of stained centromere and telomere configurations as described
below.
2.2.5. Scoring method for chromosome aberrations
Fluorescence images were captured using a Zeiss Axioskop microscope equipped
with filters for observation of DAPI (blue), FITC (green), and TRITC (red). The total number
of chromosomes per metaphase spread was counted and all aberrations were recorded. The
observed aberrations include: Dicentric chromosomes, chromosomes with two centromeric
signals. Acentric fragments which indicates loss of the centromere signal. Telomeric-
associated fusions were classified based on presence of telomeric signals at the fusion site of
the chromosome.
2.2.6. Statistical Analysis
Multiple comparisons among means for aberration formation frequencies were
performed with a one-way ANOVA followed by Tukey`s multiple comparison test on Prism
Version 5.0c. Results were considered significantly different at P < 0.05.
24
2.3. RESULTS
A normalized aberration frequency was calculated for each Atm+/+
and Atm-/-
genotype
per strain background as seen in Table 2. Frequencies of aberration formation for each cell
strain were calculated per 50 metaphase cell spreads.
25
TABLE 2
Summary of aberration frequencies for C57BL/6J, BALB/cByJ, A/J and 129S6
Atm+/+
and Atm-/-
strain backgrounds
The values were also normalized to 40 chromosomes per cell spread to account for the
polyploidy and aneuploidy seen across most cell strains. There was no significant statistical
difference observed in mean aberration frequency, for all chromosome-type aberrations,
across a 0,1, and 2 Gy dose for each of the four mice strains with an Atm+/+
genotype, as
shown in Figures 6, 7, and 8, as well as strains of the Atm-/-
genotype of 129S6.
Gene Mutation ATM Status
Mouse Cell
Strain Dose (Gy)
Metaphase
analyzed
Average
chromosome
number per
cell
Chromosome
Fusion Event
Chromosome
Telomeric
Fusion Event
Frequency
of Telomere-
Associated
Fusion per
Total Fusion
Event
0 45 54.69 0 0 0
1 50 52.86 4 0 0
2 50 58.48 15 1 0.067
0 50 77.70 0 0 0
1 50 73.02 6 0 0
2 46 73.61 29 0 0
0 50 68.00 4 1 0.250
1 49 73.51 39 3 0.077
2 50 76.32 29 0 0
0 50 64.58 6 2 0.333
1 50 68.50 18 0 0
2 50 70.90 61 8 0.131
0 50 56.10 0 0 0
1 50 63.86 7 3 0.429
2 40 55.68 8 0 0
0 50 44.38 3 1 0.333
1 45 40.71 2 0 0
2 50 60.10 13 1 0.077
0 49 116.80 19 1 0.053
1 50 101.04 58 3 0.052
2 50 101.88 139 11 0.079
0 50 89.38 10 0 0
1 50 84.40 26 1 0.038
2 50 81.44 73 3 0.041
0 50 83.58 0 0 0
1 50 81.6 4 0 0
2 50 75.24 16 0 0
0 50 75.02 0 0 0
1 50 73.8 2 0 0
2 50 64.44 11 0 0
0 50 69.24 45 1 0.022
1 50 71.76 63 1 0.016
2 50 69.26 92 3 0.033
0 50 62.14 9 0 0
1 50 59.40 37 2 0.054
2 48 60.58 30 0 0
0 40 75.85 1 0 0
1 50 68.04 2 0 0
2 24 59.71 3 0 0
0 50 70.34 3 0 0
1 50 62.46 11 0 0
2 50 56.24 20 1 0.050
0 50 66.20 14 1 0.071
1 50 41.50 7 1 0.143
2 46 45.30 14 1 0.071
0 50 83.58 26 1 0.038
1 50 74.92 27 0 0
2 50 70.12 69 5 0.072
129S6 +/+
B-38
B-58
129S6 -/-
B-26
B-41
AJ +/+
B-42
B-34
AJ -/-
B-47
B-49
BALB/c +/+
B-28
B-29
BALB/c -/-
B-55
B-46
B6 +/+
B-36
B-70
B6 -/-
B-57
B-68
Normalized
Frequency of
Dicentric
Formation
per cell
Normalized
Frequency of
acentric
fragment per
cell
0 0
0.061 0.008
0.178 0.102
0 0
0.022 0.061
0.307 0.200
0.094 0
0.333 0.342
0.283 0.298
0.074 0
0.175 0.210
0.609 0.604
0 0
0.338 0.417
0.162 0.365
0.036 0
0.022 0.197
0.146 0.224
0.126 0
0.435 0.281
0.966 0.648
0.090 0
0.246 0.177
0.639 0.673
0 0
0.029 -0.008
0.128 0.156
0 0
0.022 -0.014
0.124 0.158
0.231 0
0.468 0.409
0.762 0.658
0.103 0
0.458 0.131
0.330 0.147
0 0
0.012 0.081
0.084 0.054
0.023 0
0.128 0.088
0.270 0.310
0.145 0
0.116 0.127
0.250 0.197
0.134 0
0.256 0.262
0.582 0.838
26
Figure 6. Comparison of normalized dicentric formation per metaphase over a 0, 1, and 2
Gy dose for each strain background of Atm+/+
and Atm-/-
genotypes. Error bars indicate
standard errors of the mean. * indicates a statistically significant difference between Atm+/+
cells and Atm-/-
cells at P < 0.05.
C57BL/6J
+/+ 0
Gy
+/+ 1
Gy
+/+ 2
Gy
-/- 0
Gy
-/- 1
Gy
-/- 2
Gy
0.0
0.5
1.0
1.5
*
Atm Status /Dose (Gy)
Norm
ali
zed
Fre
qu
ency
*
BALB/cByJ
+/+ 0
Gy
+/+ 1
Gy
+/+ 2
Gy
-/- 0
Gy
-/- 1
Gy
-/- 2
Gy
0.0
0.5
1.0
1.5
*
Atm status/ Dose (Gy)
Nor
mal
ized
Fre
qu
ency
*
** *
A/J
+/+ 0
Gy
+/+ 1
Gy
+/+ 2
Gy
-/- 0
Gy
-/- 1
Gy
-/- 2
Gy
0.0
0.5
1.0
1.5
*
Atm status/ Dose (Gy)
Norm
ali
zed
Fre
qu
ency
* *
129S6
+/+ 0
Gy
+/+ 1
Gy
+/+ 2
Gy
-/- 0G
y
-/- 1G
y
-/- 2G
y
0.0
0.5
1.0
1.5
Atm status/ Dose (Gy)
Norm
ali
zed
Fre
qu
ency
27
Figure 7. Comparison of normalized acentric fragment formation per metaphase over a 0, 1,
and 2 Gy dose for each strain background of Atm+/+
and Atm-/-
genotypes. Error bars indicate
standard errors of the mean. * indicates a statistically significant difference between Atm+/+
cells and Atm-/-
cells at P < 0.05.
C57BL/6J
+/+ 0
Gy
+/+ 1
Gy
+/+ 2
Gy
-/- 0
Gy
-/- 1
Gy
-/- 2
Gy
0.0
0.2
0.4
0.6
0.8
1.0
*
Atm status/ Dose (Gy)
Norm
ali
zed
Fre
qu
ency
* * *
BALB/cByJ
+/+ 0
Gy
+/+ 1
Gy
+/+ 2
Gy
-/- 0
Gy
-/- 1
Gy
-/- 2
Gy
0.0
0.2
0.4
0.6
0.8
1.0
*
Atm status/ Dose (Gy)
Norm
ali
zed
Fre
qu
ency
*
* *
*
*
A/J
+/+ 0
Gy
+/+ 1
Gy
+/+ 2
Gy
-/- 0G
y
-/- 1G
y
-/- 2G
y
-0.2
0.0
0.2
0.4
0.6
0.8
1.0
Atm status/ Dose (Gy)
Norm
ali
zed
Fre
qu
ency
129S6
+/+ 0
Gy
+/+ 1
Gy
+/+ 2
Gy
-/- 0G
y
-/- 1G
y
-/- 2G
y
0.0
0.2
0.4
0.6
0.8
1.0
Atm status/ Dose (Gy)
Norm
ali
zed
Fre
qu
en
cy
28
Figure 8. Comparison of normalized telomere-telomere fusion formation per metaphase
over a 0, 1, and 2 Gy dose for each strain background of Atm+/+
and Atm-/-
genotypes. Error
bars indicate standard errors of the mean. * indicates a statistically significant difference
between Atm+/+
cells and Atm-/-
cells at P < 0.05.
C57BL/6J
+/+ 0
Gy
+/+ 1
Gy
+/+ 2
Gy
-/- 0
Gy
-/- 1
Gy
-/- 2
Gy
0.0
0.1
0.2
0.3
0.4
0.5
*
Atm Status /Dose (Gy)
Norm
ali
zed
Fre
qu
ency
* ** *
*
BALB/cByJ
+/+ 0
Gy
+/+ 1
Gy
+/+ 2
Gy
-/- 0
Gy
-/- 1
Gy
-/- 2
Gy
0.0
0.1
0.2
0.3
0.4
0.5
Atm Status /Dose (Gy)
Norm
ali
zed
Fre
qu
ency
A/J
+/+ 0
Gy
+/+ 1
Gy
+/+ 2
Gy
-/- 0
Gy
-/- 1
Gy
-/- 2
Gy
0.0
0.1
0.2
0.3
0.4
0.5
Atm Status /Dose (Gy)
Norm
ali
zed
Fre
qu
ency
129S6
+/+ 0
Gy
+/+ 1
Gy
+/+ 2
Gy
-/- 0
Gy
-/- 1
Gy
-/- 2
Gy
0.0
0.1
0.2
0.3
0.4
0.5
Atm Status /Dose (Gy)
Norm
ali
zed
Fre
qu
ency
29
There was a statistically significant elevation in acentric fragments and telomere-associated
fusions in Atm-/-
strains from a 0 to 2 Gy dose for the C57BL/6J strain (P= 0.0213, P= 0.0107
respectively). Furthermore, the BALB/cByJ strain showed a statistically significant increase
in average dicentric and acentric fragment yield across a 0 to 2 Gy dose for the Atm-/-
genotype (P= 0.0132, P= 0.0015 respectively).
2.4. DISCUSSION
The C57BL/6J Atm-/-
strains showed the greatest sensitivity due to the significant
difference in every chromosome aberration type when compared to Atm+/+
strains of the same
strain background. In addition, there was a heightened dose response effect over a 0-2 Gy
dose for the C57BL/6J Atm-/-
strains for average acentric fragment and telomere-associated
fusion yield. The BALB/cByJ mice strains also exhibited a dose response effect for the Atm-/-
genotype in average acentric fragment and dicentric yield, but when comparing Atm+/+
and
Atm-/-
strains, there was only in increase in average dicentric frequency which suggests a lack
of synergism between the loss of Atm and DNA-PKcs activity. The 129S6 and A/J strains
yielded a similar radiosensitivity, however, the 129S6 knockouts were the only strains that
showed an increase in telomere-associated fusion frequency. Collectively, the Atm-/-
genotypes for all inbred strain backgrounds exhibited a greater radiosensitivity through the
increased frequency of chromosome-type aberration formation, however, the differing strain
backgrounds determined whether that increase was dose-dependent. Therefore, an important
consideration is that ATM status as well as the natural genetic variation of the inbred cell
strain background provides diverse effects to DNA DSB repair and processing. This assay
may provide a means of identifying and studying how radiosensitivity can be attributed, not
only to genetic background, but also in variations among the background of the individual.
30
CHAPTER THREE
Induction of Chromosomal Aberrations Consequent to Aspm Excision Via the Cre-Lox
Recombination System
3.1. BACKGROUND
A study by Fujimori et al. revealed a gene whose expression contributes to the
maintenance and proper symmetric division of neuronal progenitors. The authors
demonstrated, through HiCEP (high-coverage expression profiling), that after exposure to
carbon and X-rays, the expression of the ASPM gene is downregulated in human and murine
tissue culture cells (42). In another study done by Kato et. al. to further understand the role
of ASPM on radiosensitivity, the authors were able to down-regulate ASPM through siRNA
(small interfering RNA) in order to observe cellular sensitivity to irradiation as well as other
clastogenic agents such as hydrogen peroxide, camptothecin, or cisplatin with the use of three
different immortalized cell lines, U87MG glioblastoma cells, AG1521 human fibroblasts, and
HeLa cervical carcinoma cells. Interestingly, the two tumor cell lines showed a greater
sensitization versus the normal fibroblasts, which suggest a tumor targeting means of
radiotherapy. Upon further examination, the mechanism of radiosensitivity through
knockdown of ASPM with siRNA was through the inhibition of DNA DSB repair,
specifically through the NHEJ pathway by using DNA-PKcs deficient human cells.
Furthermore, PNA FISH techniques were used to monitor the effects of impaired DNA DSBs
through the formation of IR-induced chromosomal aberrations in normal fibroblasts.
Chromosomal translocations and breaks were seen after irradiation the cells in the G0/G1
stage of the cell cycle. Confirmation in the reduction of DNA double-strand break repair in
cells through the NHEJ pathway was gained as well as the linear increase in the number of
aberrations in ASPM knockdown cells (69). These studies clearly recognize the ASPM gene
as important to chromosomal integrity. Therefore, we hypothesized that over a 48-hour time
31
period, conditional knockout MEF strains, Aspm-/-
will exhibit an increase in chromosomal
sensitivity observed as chromosome-type aberrations. In order to observe these changes in
cellular sensitivity, we were able to monitor chromosomal aberration formation through a
modified PNA FISH technique.
3.2. MATERIALS AND METHODS
For this project, tamoxifen, in the absence of radiation, was used to create a series of
MEF cell lines with variations in floxed alleles for the ASPM gene via Cre-lox site-specific
recombination. The Cre-lox site-specific recombination system involves an inducible gene
targeting method, such as the enzymatic activity of the Cre recombinase, to specifically and
efficiently modify DNA sequences flanked by loxP sites, 34-bp sequences composed of two
13-bp inverted repeats separated by an asymmetric 8-bp core sequence (Figure 9).
Modifications can result in inversion, deletion, or translocation of the loxP sites depending on
their orientation as diagrammed in Figure 10.
32
Figure 9. The loxP sequence. The underlined sequence is the 8-bp core sequence
where recombination takes place. The core sequence is flanked by two inverted
repeats (70).
33
Figure 10. Diagram representing variations of the Cre-lox recombination system.
The different outcomes of a recombination event are determined by the orientation
and location of the loxP sites. (A) Inversion occurs when the loxP sites are oriented in
opposing directions. (B) Chromosomal translocation results when the loxP sites are
located on different chromosomes. (C) Deletion results when the loxP sites are
oriented in the same direction on a chromosome segment (70).
34
The particular Cre-lox system used in this experiment is tamoxifen-inducible where by fusing
the Cre recombinase to a mutant ligand-binding domain of the estrogen receptor (ER), the
chimeric recombinase activity in the cultured cells of the transgenic mouse is then dependent
on the presence of the synthetic ligands, tamoxifen and 4-hydroxytamoxifen, but not
endogenous estrogen (71, 72). Upon the addition of tamoxifen, the fusion protein is
transported to the nucleus for the excision of one or both floxed alleles of the ASPM gene.
3.2.1. Cell culture
Mouse embryonic fibroblasts (MEFs) were prepared from day 14.5 mouse embryo and
cultured in minimal essential medium (MEM) with 10% fetal bovine serum (FBS) and 1%
penicillin maintained at 37°C in a humidified atmosphere of 5% CO2 in air. Genotypes were
determined by quantitative RT-PCR using tissue from the heads of the embryo using primers
specific for the murine Aspm (Table 3). All MEF cultures had a similar passage range
between two and five. All experimental protocols involving mice were reviewed and
approved by the Animal Care and Use Committee of the National Institute of Radiological
Sciences (NIRS), and the experiments were performed in strict accordance with the NIRS
Guidelines for the Care and Use of Laboratory Animals.
TABLE 3
Origin and Aspm status of mouse cells
Aspm
genotype
MEF ID
no.
Cre
Activity
Aspm genotype (Post
Tamoxifen addition)
F/F 1 - F/F
F/F 2 + -/-
+/F 3 - +/F
+/F 4 - +/F
+/F 5 + +/-
F/F 6 + -/-
+/F 7 + +/-
+/F 10 + +/-
F/F 15 + -/-
35
3.2.2. Metaphase chromosome preparation
Each of the nine MEF cell cultures were grown to confluency in T25 flasks, then sub-
cultured where the media of each flask was spiked with 0.2 M tamoxifen in ethanol prior to
colcemid addition. 0.1 g/ml of colcemid (Invitrogen) was added to the media inside the
flask of cells six hours prior to harvesting of chromosomes at time periods of 24 and 48 hours
post-tamoxifen addition. The cells were then trypsinized and suspended in 75 mM KCl
solution at 37°C in a water bath for 20 minutes. Each sample was fixed in Carnoy`s solution
(3:1 methanol to acetic acid) according to standard cytogenetic procedures (68). Before the
cell solution was dropped, the slides were chilled in ice water. After application, the slides
were set aside and allowed to air dry for approximately 5 minutes. For PNA FISH staining,
once the slides were dry, they were immersed in 4% PFA in PBS for 10 minutes after which
they were immediately washed with PBS and then immersed in 0.1 mg/ml of RNase A in
PBS solution for 15 minutes at 37°C. The slides were then washed again with fresh PBS and
placed in a solution prepared with 1% pepsin in 40 ml of 100 mM HCl at 37°C for 20
minutes. After, the slides were washed again in fresh PBS and then placed in an ethanol
series for dehydration for 2 to 3 minutes each.
3.2.3. Modified PNA FISH method
After dehydration, hybridization was performed using a hybridization solution containing
60% formamide, 200 nM of TelG-Cy3, 200 nM of CENPB Box-FAM (Panagene, Thousand
Oaks, CA), 1M Tris-HCl, and pure water. 15 µL of the staining solution was pipetted onto
the slide and covered with a cover slip that contained rubber cement along the edges to create
a firm seal over the stain and slide. The slides were then allowed to set overnight at room
temperature after which the cover slip was removed and placed in PN buffer at 37°C for five
minutes and then washed with freshly prepared PBS at room temperature. After washing, the
slides were counterstained with DAPI in antifade (Invitrogen). Digital images were captured
36
using a Zeiss Axioskop Microscope with CoolSnapHQ and Metamorph software. The slides
were analyzed at 60X magnification to view and obtain pictures of stained centromere and
telomere configurations as described below.
3.2.4. Scoring method for chromosome aberrations
As stated previously, fluorescence images were captured using a Zeiss Axioskop
microscope equipped with filters for observation of DAPI (blue), FITC (green), and TRITC
(red). The total number of chromosomes per metaphase spread was counted and all
aberrations were recorded. The observed aberrations include: Dicentric chromosomes,
chromosomes with two centromeric signals. Acentric fragments, or induced complete loss,
which indicates loss of the centromere signal.
3.2.5. Statistical Analysis
Multiple comparisons among means for aberration formation frequencies were
performed with a one-way ANOVA followed by Tukey`s multiple comparison test on Prism
Version 5.0c. Results were considered significantly different at P < 0.05.
3.3. RESULTS
For each cell strain and chromosome-type aberration, the frequency of formation was
calculated per 50 metaphase chromosome spreads and then normalized to 40 chromosomes
per metaphase spread to account for polyploidy and aneuploidy. The cell strains were then
grouped by Aspm genotype status and an average frequency of each aberration formed was
calculated as shown in Table 4.
37
TABLE 4
Summary of aberration frequencies for MEF strains across differing Aspm genotypes
A slight increase in dicentric formation was seen across Aspm+/+
, Aspm+/-
, and Aspm-/-
genotypes over 24-hours post-tamoxifen addition in comparison to the control, or untreated
cells. However, over 48-hours, a more pronounced increase in dicentric formation was
observed for the conditional knockout cell strains (Figure 11). A greater increase in acentric
fragment yield was observed over cell lines of the Aspm+/-
and Aspm-/-
genotype over a 48-
hour time period, although a greater elevation was observed in Aspm+/- over a 24-hour time
period (Figure 12). However, the increases seen between the Aspm+/-
and Aspm-/-
genotypes
were not statistically different.
Aspm Genotype
post-Tamoxifen
addition MEF ID Time (hr)
Metaphase
analyzed
Average
chromosome
number per
cell
Normalized
Frequency of
Dicentric
Formation
per cell
Normalized
Frequency of
acentric
fragment per
cell
0 50 61.48 0 0
24 50 51.74 0.046 0.031
48 50 55.78 0.014 0.043
0 50 69.76 0.000 0.998
24 50 44.52 0.072 2.102
48 45 43.8 0 0.649
0 48 55.67 0 0.898
24 48 51.27 0 1.008
48
0 49 47.88 0.017 0.034
24 50 49.46 0.065 1.844
48 50 51.82 0.185 1.497
0 43 38.88 0 1.005
24 47 52.55 0 1.781
48
0 49 55.57 0 1.204
24 50 51.5 0.062 2.439
48 32 46.00 0.163 1.359
0 50 51.98 0.031 1.28
24 50 62.08 0.180 2.977
48 45 45.27 0.098 1.591
0 50 51.90 0.015 0.971
24 47 52.55 0.015 2.072
48
0 50 57.55 0 0.965
24 50 56.84 0.014 0.915
48
0 50 65.22 0.024 0.037
24 50 53.26 0 1.127
48 33 70.55 0.412 2.320
AspmF/F MEF 1
MEF 3
MEF 15
Aspm+/F
Aspm+/-
Aspm-/-
MEF 2
MEF 6
MEF 7
MEF 10
MEF 4
MEF 5
38
Figure 11. Average dicentric formation per metaphase at 24 and 48-hours post-tamoxifen
addition compared to control (untreated) frequencies. MEF cell lines were grouped
according to Aspm status. MEF cell lines that were not included in the 48-hour time period
are MEF 4, 6, and 7. Error bars indicate standard errors of the mean.
Control
Aspm+/F Aspm+/- Aspm-/-
0.0
0.1
0.2
0.3
0.4
0.5
Aspm status
Norm
ali
zed
Freq
uen
cy
24-Hour Post-Tamoxifen
Aspm+/F Aspm+/- Aspm-/-0.0
0.1
0.2
0.3
0.4
0.5
Aspm status
Norm
ali
zed
Freq
uen
cy
48-Hours Post-Tamoxifen
Aspm+/F Aspm+/- Aspm-/-
0.0
0.1
0.2
0.3
0.4
0.5
Aspm status
Norm
ali
zed
Freq
uen
cy
39
Figure 12. Average acentric fragment formation per metaphase at 24 and 48-hours post-
tamoxifen addition compared to control (untreated) frequencies. MEF cell lines were
grouped according to Aspm status. MEF cell lines that were not included in the 48-hour time
period are MEF 4, 6, and 7. Error bars indicate standard errors of the mean.
Control
Aspm+/F Aspm+/- Aspm-/-
0.0
0.5
1.0
1.5
2.0
2.5
Aspm status
Norm
ali
zed
Freq
uen
cy
24-Hour Post-Tamoxifen
Aspm+/F Aspm+/- Aspm-/-
0.0
0.5
1.0
1.5
2.0
2.5
Aspm status
Norm
ali
zed
Freq
uen
cy
48-Hour Post-Tamoxifen
Aspm+/F Aspm+/- Aspm-/-
0.0
0.5
1.0
1.5
2.0
2.5
Aspm status
Norm
ali
zed
Freq
uen
cy
40
3.4. Discussion
This study utilized a conditional knockout model, via the Cre-lox recombination
system, where MEFs of the conditional knockout genotype led to an increase in DSBs,
observed as dicentric and acentric fragment formation, as early as 24 hours post-tamoxifen
addition. Interestingly, the heterozygous Aspm genotype also exhibited an increase in
acentric fragment and dicentric formation over a 24-hour time period. The frequency of
average dicentric yield was comparable, than cell strains of the Aspm-/-
genotype at 24-hours,
and even surpassed the Aspm-/-
strains in average acentric fragment formation at 24-hours.
However, since no statistical differences were observed between the Aspm+/-
and Aspm-/-
cells, a possible pathogenic mechanism is haploinsufficiency where a single functional copy
of a gene is insufficient to maintain normal function (73). Frequently, organisms that are
heterozygous for a loss-of-function allele exhibit a normal phenotype due to the presence of
one wild-type allele which masks any phenotypic consequences due to a redundancy of
cellular physiology (74). Biochemical studies provide a possible explanation when a reduced
fitness in these heterozygous strains is observed which states that a balance of protein levels
are required to maintain cytoskeletal integrity (75). In agreement with the experimental work
by Kato et. al. where a suppression of the Aspm gene via siRNA, increased radiosensitization
as well as impairs DNA double-strand break repair (69). The observations presented in this
study suggest a possible underlying mechanism for the onset of microcephaly where
chromosomal instability consequent to mutations in the ASPM gene promotes an increase in
DNA DSBs, and with the impairment of proper repair mechanisms, will result in a disruption
of crucial cellular mechanisms involved in proper neurogenesis.
41
CHAPTER FOUR
CONCLUSIONS
In conclusion, DNA damage, through SSBs or DSBs, resulting in chromosomal
instability is a crucial component in cancer research. Due to the complex nature of the scope,
it is ideal to have methods and assays in place that provide a quick and simple way for the
detection of such alterations of the genome. The modified PNA FISH technique has provided
a quick and efficient method in cytogenetic analysis. This method has been simplified from
previous adaptations of radiolabeling, denaturation, and synthetic dye applications, which are
more error prone and less distinctive of molecular structures. This was exemplified in the
Atm experiment where telomere-associated fusions could be definitively verified quickly
upon location of the red interstitial telomere signal on a blue DAPI background. Thus,
through this easily identifiable method, we were able to classify and differentiate
chromosome-type aberrations for four inbred mouse strains with differing genetic
backgrounds of either Atm+/+
or Atm-/-
. The comparative evidence that was provided here has
confirmed the necessity of the Atm protein in the NHEJ DNA repair pathway, when a
statistically significant increase in dicentric and acentric fragment aberrations was seen in
Atm-/-
strains across three of the four backgrounds: A/J, 129S6, and C57BL/6J, although this
response was not dose-dependent. Another interesting result was seen in the BALB/cByJ
strain, with a known Prkdc defect, where there was no synergistic affect and the Atm+/+
and
Atm-/-
replicative strains did not show any differences in average aberration frequencies.
Therefore, with the absence of the Atm gene, as seen in the A-T phenotype, there is an
increase in radiosensitivity among these strain backgrounds, which is an important aspect
when using these models for studying A-T. We were also able to classify aberrations across
differing Aspm genotypes in MEF cell lines. Through the Cre-lox recombination system, we
were able to observe an increased sensitivity in conditional knockout strains in comparison to
42
untreated controls over a 24 and 48 hour time period. This further corroborates the study of
Kato et. al. where when Aspm is suppressed, there is an elevation in chromosomal instability
as seen through an increase in DNA DSBs. It was also shown in this experiment, that there is
a prominent increase in sensitivity of the heterozygous genotype, which is characteristic of
haploinsufficiency, and that Aspm is an essential component not only for neuronal
development but in DNA repair regulation and/or maintenance.
43
REFERENCES
1. Bedford JS & Dewey WC (2002) Radiation Research Society. 1952-2002. Historical
and current highlights in radiation biology: has anything important been learned by
irradiating cells? Radiat Res 158(3): 251-291.
2. Morgan WF, Day JP, Kaplan MI, McGhee EM, & Limoli CL (1996) Genomic
instability induced by ionizing radiation. Radiat Res 146(3): 247-258.
3. Jeggo PA (1998) Identification of genes involved in repair of DNA double-strand
breaks in mammalian cells. Radiat Res 150(5 Suppl): S80-91.
4. Bender MA, et al. (1988) Current status of cytogenetic procedures to detect and
quantify previous exposures to radiation. Mutat Res 196(2): 103-159.
5. Ward JF (1995) Radiation mutagenesis: the initial DNA lesions responsible. Radiat
Res 142(3): 362-368.
6. Limoli CL, Kaplan MI, Phillips JW, Adair GM, & Morgan WF (1997) Differential
induction of chromosomal instability by DNA strand-breaking agents. Cancer Res
57(18): 4048-4056.
7. Muller HJ (1927) Artificial Transmutation of the Gene. Science 66(1699): 84-87.
8. Savage JR (1975) Classification and relationships of induced chromosomal structural
changes. J Med Genet 13: 103-122.
9. Choo KHA (1997) The Centromere. Oxford University Press: 320.
10. Ohzeki J, Nakano M, Okada T, & Masumoto H (2002) CENP-B box is required for
de novo centromere chromatin assembly on human alphoid DNA. J Cell Biol 159(5):
765-775.
11. Wu L, et al. (2006) Pot1 deficiency initiates DNA damage checkpoint activation and
aberrant homologous recombination at telomeres. Cell 126(1): 49-62.
12. Sachs RK, Chen AM, & Brenner DJ (1997) Review: proximity effects in the
production of chromosome aberrations by ionizing radiation. Int J Radiat Biol 71(1):
1-19.
44
13. de Lange T (2005) Shelterin: the protein complex that shapes and safeguards human
telomeres. Gene Dev 19(18): 2100-2110.
14. Zakian VA (1995) Telomeres: beginning to understand the end. Science 270(5242):
1601-1607.
15. Christmann M, Tomicic MT, Roos WP, & Kaina B (2003) Mechanisms of human
DNA repair: an update. Toxicology 193(1-2): 3-34.
16. Takata M, et al. (1998) Homologous recombination and non-homologous end-joining
pathways of DNA double-strand break repair have overlapping roles in the
maintenance of chromosomal integrity in vertebrate cells. Embo J 17(18): 5497-
5508.
17. Sonoda E, Hochegger H, Saberi A, Taniguchi Y, & Takeda S (2006) Differential
usage of non-homologous end-joining and homologous recombination in double
strand break repair. DNA Repair (Amst) 5(9-10): 1021-1029.
18. McKinnon PJ (2004) ATM and ataxia telangiectasia. EMBO reports 5(8): 772-776.
19. Lavin MF, et al. (2005) ATM signaling and genomic stability in response to DNA
damage. Mutat Res 569(1-2): 123-132.
20. Bosotti R, Isacchi A, & Sonnhammer EL (2000) FAT: a novel domain in PIK-related
kinases. Trends in biochemical sciences 25(5): 225-227.
21. Kouprina N, et al. (2004) Accelerated evolution of the ASPM gene controlling brain
size begins prior to human brain expansion. PLoS Biol 2(5): E126.
22. Bond J, et al. (2002) ASPM is a major determinant of cerebral cortical size. Nat
Genet 32(2): 316-320.
23. National Institutes of Health (2011) ASPM. (U.S. National Library of Medicine).
24. Shiloh Y (2003) ATM and related protein kinases: safeguarding genome integrity.
Nature reviews. Cancer 3(3): 155-168.
25. Riballo E, et al. (2004) A pathway of double-strand break rejoining dependent upon
ATM, Artemis, and proteins locating to gamma-H2AX foci. Mol Cell 16(5): 715-
724.
45
26. Chun HH & Gatti RA (2004) Ataxia-telangiectasia, an evolving phenotype. DNA
Repair (Amst) 3(8-9): 1187-1196.
27. Pecker I, et al. (1996) Identification and chromosomal localization of Atm, the mouse
homolog of the ataxia-telangiectasia gene. Genomics 35(1): 39-45.
28. Barlow C, et al. (1996) Atm-deficient mice: a paradigm of ataxia telangiectasia. Cell
86(1): 159-171.
29. Higgins J, et al. (2010) Human ASPM participates in spindle organisation, spindle
orientation and cytokinesis. BMC Cell Biol 11: 85.
30. Kouprina N, et al. (2005) The microcephaly ASPM gene is expressed in proliferating
tissues and encodes for a mitotic spindle protein. Hum Mol Genet 14(15): 2155-2165.
31. Fish JL, Kosodo Y, Enard W, Paabo S, & Huttner WB (2006) Aspm specifically
maintains symmetric proliferative divisions of neuroepithelial cells. Proc Natl Acad
Sci U S A 103(27): 10438-10443.
32. Lin SY, et al. (2008) ASPM is a novel marker for vascular invasion, early recurrence,
and poor prognosis of hepatocellular carcinoma. Clin Cancer Res 14(15): 4814-4820.
33. Riparbelli MG, Callaini G, Glover DM, & Avides Mdo C (2002) A requirement for
the Abnormal Spindle protein to organise microtubules of the central spindle for
cytokinesis in Drosophila. J Cell Sci 115(Pt 5): 913-922.
34. Jackson AP, et al. (2002) Identification of microcephalin, a protein implicated in
determining the size of the human brain. Am J Hum Genet 71(1): 136-142.
35. Ripoll P, Pimpinelli S, Valdivia MM, & Avila J (1985) A cell division mutant of
Drosophila with a functionally abnormal spindle. Cell 41(3): 907-912.
36. do Carmo Avides M, Tavares A, & Glover DM (2001) Polo kinase and Asp are
needed to promote the mitotic organizing activity of centrosomes. Nat Cell Biol 3(4):
421-424.
37. Bond J, et al. (2003) Protein-truncating mutations in ASPM cause variable reduction
in brain size. Am J Hum Genet 73(5): 1170-1177.
38. Aicardi J (1998) Malformations of the central nervous system (Mac Keith, London) 2
Ed.
46
39. Pulvers JN, et al. (2010) Mutations in mouse Aspm (abnormal spindle-like
microcephaly associated) cause not only microcephaly but also major defects in the
germline. Proc Natl Acad Sci U S A 107(38): 16595-16600.
40. Ishida Y, et al. (2006) Dose-response and large relative biological effectiveness of
fast neutrons with regard to mouse fetal cerebral neuron apoptosis. J Radiat Res
47(1): 41-47.
41. Blaschke AJ, Staley K, & Chun J (1996) Widespread programmed cell death in
proliferative and postmitotic regions of the fetal cerebral cortex. Development
122(4): 1165-1174.
42. Fujimori A, et al. (2008) Ionizing radiation downregulates ASPM, a gene responsible
for microcephaly in humans. Biochem Biophys Res Commun 369(3): 953-957.
43. Geard CR (1992) Cytogenetic assays for genotoxic agents. Lens Eye Toxic Res 9(3-
4): 413-428.
44. Fenech M (2008) The micronucleus assay determination of chromosomal level DNA
damage. Methods Mol Biol 410: 185-216.
45. Wilson DM, 3rd & Thompson LH (2007) Molecular mechanisms of sister-chromatid
exchange. Mutat Res 616(1-2): 11-23.
46. Hittelman WN & Rao PN (1975) The nature of adriamycin-induced cytotoxicity in
Chinese hamster cells as revealed by premature chromosome condensation. Cancer
Res 35(11 Pt 1): 30-27-35.
47. Cornforth MN & Bedford JS (1985) On the nature of a defect in cells from
individuals with ataxia-telangiectasia. Science 227(4694): 1589-1591.
48. Levsky JM & Singer RH (2003) Fluorescence in situ hybridization: past, present and
future. J Cell Sci 116(Pt 14): 2833-2838.
49. Rudkin GT & Stollar BD (1977) High resolution detection of DNA-RNA hybrids in
situ by indirect immunofluorescence. Nature 265(5593): 472-473.
50. Gall JG & Pardue ML (1969) Formation and detection of RNA-DNA hybrid
molecules in cytological preparations. Proc Natl Acad Sci U S A 63(2): 378-383.
47
51. Bauman JG, Wiegant J, Borst P, & van Duijn P (1980) A new method for
fluorescence microscopical localization of specific DNA sequences by in situ
hybridization of fluorochromelabelled RNA. Exp Cell Res 128(2): 485-490.
52. Kislauskis EH, Li Z, Singer RH, & Taneja KL (1993) Isoform-specific 3'-untranslated
sequences sort alpha-cardiac and beta-cytoplasmic actin messenger RNAs to different
cytoplasmic compartments. J Cell Biol 123(1): 165-172.
53. Hada M, Cucinotta FA, Gonda SR, & Wu H (2007) mBAND analysis of
chromosomal aberrations in human epithelial cells exposed to low- and high-LET
radiation. Radiat Res 168(1): 98-105.
54. Yurov YB, et al. (1996) High resolution multicolor fluorescence in situ hybridization
using cyanine and fluorescein dyes: rapid chromosome identification by directly
fluorescently labeled alphoid DNA probes. Hum Genet 97(3): 390-398.
55. Yan J, Chen BZ, Bouchard EF, & Drouin R (2004) The labeling efficiency of human
telomeres is increased by double-strand PRINS. Chromosoma 113(4): 204-209.
56. Nielsen PE, Egholm M, Berg RH, & Buchardt O (1991) Sequence-selective
recognition of DNA by strand displacement with a thymine-substituted polyamide.
Science 254(5037): 1497-1500.
57. Egholm M, Buchardt O, Nielsen PE, & Berg RH (1992) Peptide Nucleic-Acids (Pna)
- Oligonucleotide Analogs with an Achiral Peptide Backbone. J Am Chem Soc
114(5): 1895-1897.
58. Chen C, Hong YK, Ontiveros SD, Egholm M, & Strauss WM (1999) Single base
discrimination of CENP-B repeats on mouse and human Chromosomes with PNA-
FISH. Mamm Genome 10(1): 13-18.
59. Czepulkowski B (2001) Analyzing Chromosomes (BIOS Scientific Publishers Limited
London, UK).
60. Kato TA, et al. (2009) Variations in radiosensitivity among individuals: a potential
impact on risk assessment? Health Phys 97(5): 470-480.
61. Kato TA, et al. (2006) gamma-H2AX foci after low-dose-rate irradiation reveal atm
haploinsufficiency in mice. Radiat Res 166(1 Pt 1): 47-54.
62. Okayasu R, et al. (2000) A deficiency in DNA repair and DNA-PKcs expression in
the radiosensitive BALB/c mouse. Cancer Res 60(16): 4342-4345.
48
63. Bogen KT & Witschi H (2002) Lung tumors in A/J mice exposed to environmental
tobacco smoke: estimated potency and implied human risk. Carcinogenesis 23(3):
511-519.
64. Sundberg JP, Hanson CA, Roop DR, Brown KS, & Bedigian HG (1991)
Myoepitheliomas in Inbred Laboratory Mice. Vet Pathol 28(4): 313-323.
65. Barlow C, et al. (1996) Atm-deficient mice: A paradigm of ataxia telangiectasia. Cell
86(1): 159-171.
66. Genik PC, Bielefeldt-Ohmann, H., Liu, x., Story, M.D., Ding, L., Bush, J., Fallgren,
C., Weil, M.M. (Strain background determines lymphoma incidence in Atm knockout
mice. Manuscript (Colorado State University, Fort Collins).
67. Tobey RA & Ley KD (1971) Isoleucine-Mediated Regulation of Genome Replication
in Various Mammalian Cell Lines. Cancer Res 31(1):46-51.
68. Cartwright IM, Genet MD, & Kato TA (2013) A simple and rapid fluorescence in situ
hybridization microwave protocol for reliable dicentric chromosome analysis. J
Radiat Res 54(2): 344-348.
69. Kato TA, Okayasu R, Jeggo PA, & Fujimori A (2011) ASPM influences DNA
double-strand break repair and represents a potential target for radiotherapy. Int J
Radiat Biol 87(12): 1189-1195.
70. Nagy A (2000) Cre recombinase: the universal reagent for genome tailoring. Genesis
26(2): 99-109.
71. Feil R, et al. (1996) Ligand-activated site-specific recombination in mice. Proc Natl
Acad Sci U S A 93(20): 10887-10890.
72. Sauer B (1987) Functional expression of the cre-lox site-specific recombination
system in the yeast Saccharomyces cerevisiae. Mol Cell Biol 7(6): 2087-2096.
73. Huang N, Lee I, Marcotte EM, & Hurles ME (2010) Characterising and predicting
haploinsufficiency in the human genome. PLoS Genet 6(10): e1001154.
74. Kacser H & Burns JA (1981) The molecular basis of dominance. Genetics 97(3-4):
639-666.
49
75. Deutschbauer AM, et al. (2005) Mechanisms of haploinsufficiency revealed by
genome-wide profiling in yeast. Genetics 169(4): 1915-1925.
76. Ijichi K, et al. (1996) Inhibitory effect of 4-(2, 6-dichlorophenyl)-1, 2, 5-thiadiazol-3-
yl-N-methyl, N-ethylcarbamate on replication of human immunodeficiency virus type
1 and the mechanism of action. Biochem Mol Biol Int 39(1): 41-52.
50
APPENDIX I
MODIFIED PNA FISH PROTOCOL
51
Traditionally, FISH techniques required the denaturation of target DNA for the
successful hybridization of the molecular probe to complementary DNA sequences. The
denaturing process required the use of formamide and salt solutions, which lower the
temperature at which the DNA denatures to preserve the structural integrity of the
chromosomes (76). Subsequent to denaturation, hybridization at 37C allows the probe to
anneal to target DNA, although several hours are required for optimal binding specificity, as
outlined in the following protocol:
Initially, slides are placed in a RNase A (0.1 mg/mL) solution at 37 C for 10
minutes, followed by a PBS wash. Then, placed in 4% PFA in PBS for 10 minutes at room
temperature, washed in PBS, and then dehydrated in an ethanol series of 70%, 85%, and
100% for two minutes each in an ice water bath. They were then placed in a 2XSSC 70%
formamide solution at 80C for 2 minutes, followed by the same ethanol wash followed by
the preparation of a probe solution consisting of 60% of formamide, 20 mM of Tris-HCl, 200
nM of TelC-Cy3 (Cy3-O-CCCTAACCCTAACCCTAA) and 200 nM of CENPB Box-FAM
(FAM-O-ATTCGTTGGAAACGGGA). The solution is denatured at 85C for 5 minutes,
cooled down to 37C, and 30 L is added to each slide. After overnight hybridization at
37C, slides are washed in a 2XSSC 70% formamide solution for 15 minutes at 37C,
followed by 5 minutes in PN buffer at room temperature. Finally, a counter stain with
Prolong Gold Antifade with 4’,6-diamidino-2-phenylindole (DAPI) is applied.
The modified PNA FISH protocol used in these experiments allow PNA probes to
bind to centromeric and telomeric regions without denaturation and a shorter hybridization
period:
Slides are placed into 4% PFA in PBS for ten minutes at room temperature then
washed in PBS. Slides are then placed in a RNase A (0.1 mg/mL) solution at 37C for 15
minutes, followed by a PBS wash, then treated a with pepsin (1%) in 100 mM HCl solution at
52
37C for ten minutes. The slides are washed with fresh PBS and then placed in an ethanol
series of 70%, 90%, and 100% for two minutes each. The probe solution used for staining
was prepared and consisted of 200 nM of TelC-Cy3, (Cy3-O-TTAGGGTTAGGGTTAGGG),
200 nM of CENPB Box-FAM, (FAM-O-ATTCGTT GGAAACGGGA), 60% formamide,
1M Tris-HCl, and pure water. Approximately 15 L of the probe solution is added to the
slides and secured with a coverslip and allowed to hybridize at room temperature anywhere
between 6-18 hours. After hybridization, slides are placed in PN buffer at 37C for 10
minutes, followed by a five minute wash with PBS at room temperature. A counter stain is
applied with Prolong Gold Antifade with 4’,6-diamidino-2-phenylindole (DAPI). Analysis
of the modified PNA FISH signal strength of TelC-Cy3 and CENPB Box-FAM probes, via
fluorescence microscopy, without denaturing and in a formamide probe solution was rated
after hybridization at varying times at room temperature as shown in Table 5.
TABLE 5 Signal strength over time
The signal strength for the centromere probe, CENPB Box, required a full 18-hour
hybridization period for adequate signal strength, whereas the telomere probe signal was not
time-dependent. In addition, when comparing the signal strength of the telomere and
centromere probes after an 18-hour hybridization period at varying temperatures between the
traditional FISH and modified PNA FISH protocols, the telomere signal remains strong at all
temperatures for both protocols, however, centromere signals are strongest at room
temperature and at 37C as shown in Table 6.
Time in Room Temperature
1 Hour 4 Hours 18 Hours
TelC Strong Strong Strong
CENP B Box Absent Poor Strong
Probes
53
TABLE 6
Signal strength over varying temperatures
The optimal strength of differing probe signals may vary over time and temperature,
however, hybridization without denaturation remains sufficient which suggests another
binding mechanism other than a PNA-DNA interaction. Therefore, without denaturation, the
assay becomes more efficient, due to the ease and rapidity of its usage, as well as providing a
less invasive technique that limits DNA alterations for a more reliable cytogenetic analysis.
4 °C RT 37°C
TelC Strong Strong Strong Strong
CENP B Box Fair Strong Strong Strong
Modified PNA FISHProbes FISH
top related