y-chromosomal str variation in malays of kelantan and minang papers/jtas vol. 31 (1... ·...

Pertanika J. Trop. Agric. Sci. 31(1): 135 - 140 (2008) ISSN: 1511-3701©Universiti Putra Malaysia Press

Y-chromosomal STR Variation in Malays of Kelantan and Minang

Hoh Boon Peng1,*, Nur Shafawati Abdul Rajab1, Ooi Keat Gin2

and Zilfalil Alwi1

1Human Genome Centre, School of Medical Sciences, Health Campus, Universiti Sains Malaysia,16150 Kota Bharu, Kelantan, Malaysia

2School of Humanities, Universiti Sains Malaysia, 11800 Penang, Malaysia*E-mail: [email protected]

ABSTRACTMalays in Malaysia are a mixture of different races, caused by the history of migration centuries ago and mayconsist of 14 sub-ethnic groups. We used the Y-chromosomal STR (Y-STRs) to genotype two of the sub-ethnicgroups namely, Kelantan and Minang Malays. In this ongoing study we investigated the polymorphisms of six Y-STR loci namely, DYS19, DYS388, DYS390, DYS391, DYS392 and DYS393 in the two populations mentioned.Twenty males (10 Kelantanese and 10 Minang) were analyzed by PCR amplifications followed by 8% non-denatured polyacrylamide gel electrophoresis. Randomly selected samples were sequenced for validation. Resultsrevealed a total of 32 alleles, ranging from three (DYS19) to nine (DYS390). Allele frequency distributionsranged from 0.05 (DYS388, DYS 391, and DYS393) to 0.65 (DYS388). Although the level of polymorphisms ofthe two sub-groups were similar (average number of alleles, 4; average heterozygosity, 0.6), allele frequencydistribution appeared to be imbalanced. Significant differences of allele frequency distributions were observedin loci DYS390, DYS391, and DYS393. None of the individuals shared the same haplotypes. However, errors ofscoring and factors like small sample size should be considered. Preliminary results revealed polymorphisms inthe six loci among the two Malay sub-ethnic groups. Significant differences of the allele frequency distributionswere observed, but a further investigation with a larger sample size is warranted to confirm these findings.

Keywords: Y–STRs, polymorphisms, sub-ethnic groups, PCR amplifications

task of assessing the extent of genetic variationin living human relatively straight forward as theaccumulation of mutations is fairly byevolutionary forces over the period.

In this ongoing study, we investigated thepolymorphisms of two of the unique Malay sub-ethnic groups namely, the Malays of Kelantan(Melayu Kelantan) and the Minangs (MelayuMinang) using six Y-STR markers.

MATERIALS AND METHODSSample CollectionEthical approval was obtained from the Researchand Ethics Committee of USM Health Campus.After obtaining the informed consent, 20 healthyand unrelated male subjects were recruited (10for each sub-ethnic group). The samples of theMalays of Kelantan were collected from variousdistricts of Kelantan including Machang, KualaKrai, Rantau Panjang, Bachok and Kota Bharu);

INTRODUCTIONThe Malays in Malaysia are a mixture of differentraces, caused by history of migration centuriesago. Speculations were made on their pre-historicmigration patterns to the Southeast Asia (SEA)region. Dental morphological traits suggestedthat two migrations into SEA originated fromChina about 30,000 years before present (Turner,1987); while the linguistic groups proposed twomajor wave of migrations (Bellwood, 1985).Today, the Malays are heterogenous. Wepostulated that they may consist of 14 sub-ethnicgroups namely, Melayu Kelantan, Minang, Bataq,Jambi, Kurinchi, Jawa, Riau, Melayu Yunnan,Mendeleng, Banjar, Bugis, Acheh, Champa, andRawa.

The Y-chromosome, much like mtDNA, isinherited in a sex-specific manner. Its mostattractive feature has been an apparent inabilityto undergo genetic recombination, making the

* Corresponding Author

15. 36/2007-Hoh boon peng 11/19/08, 11:54135

136 Pertanika J. Trop. Agric. Sci. Vol. 31(1) 2008

Hoh Boon Peng, Nur Shafawati Abdul Rajab, Ooi Keat Gin and Zilfalil Alwi

while the samples of Minangs were collectedfrom Seri Menanti and Lenggeng, NegeriSembilan. Subjects were interviewed to confirmtheir family history. They must be born at thespecified location and their family at least threegenerations. Those with unknown family history,mixed marriage and consanguineous marriageand consanguity marriage were excluded fromthis study. Blood samples were collected fromthese subjects and DNA was extracted usingcommercial kit (QIAamp ® DNA Blood MiniKit, Germany).

PCR AmplificationA total of six Y-STR markers were chosen basedon the study done by Thomas et al. (1999).Details of the selected markers are outlined inTable 1. PCR was performed in a total volume of10 ml consisting 20 ng DNA, 1 unit of Taqpolymerase (Promega, Madison, MI, USA), 1xPCR reaction buffer (Promega, USA), 0.5 mMdNTPs (Promega, USA), appropriateconcentration of Mg2+, and forward and reverseprimers (Table 1). The PCR protocol comprisedof 5 min 95oC predenaturation; 38 cycles of 94oCdenaturation (1 min); appropriate annealingtemperature, and 72oC extension (30 sec; exceptDYS390, 90 sec). Amplification products wereseparated by vertical gel electrophoresis through8% non-denaturing polyacrylamide gel along

with 20 bp DNA ladder. Some alleles, whichwere subsequently used as references, were laterconfirmed by DNA sequencing.

Statistical AnalysisAllele frequency of the six loci for each ethnicgroup were estimated and compared. Geneticdiversity (h) in each ethnic group was estimatedas 1 - !pi

2, where pi represents the frequency ofthe ith allele at the locus.

RESULTSThe allele frequency distributions of the six Y-STR loci in the two Malay sub-ethnic groups aresummarized in Fig. 1. Results revealed a total of32 alleles, ranging from three (DYS19) to nine(DYS390) of the 20 individuals analyzed. Bothgroups seemed to have similar diversity both interms of the number of alleles and their allelefrequencies. The allelic variations at one of theseloci are shown in Fig. 2.

Table 2 represents the diversity statistics forsix Y-STR loci in the two Malay sub-ethnic groupsstudied. Table 3 indicates the haplotype data forboth Minang and Kelantan Malays. Interestingly,none of the individuals shared the same six-locus haplotypes. However, sample sizes are toosmall to permit a complete analysis of the Y-chromosomal structure of these two sub-populations.

TABLE 1Summary of loci selected, indicating the primer sequences, repeat motif, expected allele sizes,

primers and MgCl2 concentrations and annealing temperatures of PCR

Locus Primer sequence (5’ – 3’) Repeat Exp [primers]+ MgCl2 Ta *motif allele (mM) (oC)

sizes(bp)

DYS19 F: CTACTGAGTTTCTCTGTTATAGT (TAGA)n 186 50 "mol 2.25 58R: ATGGCATGTAGTGAGGACA

DYS388 F: GTGAGTTAGCCGTTTAGCGA (ATT)n 127 50 "mol 2.25 57R: CAGATCGCAACCACTGCG

DYS390 F: TATATTTTACACATTTTTGGGCC (TCTA/ 215 40 "mol 1.5 54R: TGACAGTAAAATGAACACATT TCTG)n

DYS391 F: CTATTCATTCAATCATACACCCATAT (TCTA)n 171 40 "mol 1.5 57R: ACATAGCCAAATATCTCCTGGG

DYS392 F: AAAAGCCAAGAAGGAAAACAAA (TAT)n 176 40 "mol 1.5 57R: CAGTCAAAGTGGAAAGTAGTCTGG

DYS393 F: GTGGTCTTCTACTTGTGTCAATAC (TAGA)n 128 50 "mol 2.25 57R: AACTCAAGTCCAAAAATGAGG

+[primers], concentration of primers; *Ta, annealing temperature

15. 36/2007-Hoh boon peng 11/19/08, 11:54136

137Pertanika J. Trop. Agric. Sci. Vol. 31(1) 2008


Fig. 1: Allele frequency distribution of locus (A) DYS19, (B) DYS388, (C) DYS390, (D) DYS391, (E) DYS392 and(F) DYS393, among Malays of Kelantan (bright colour) and Minang (dark colour)

Fig. 2: Resolution of DYS393 on native polyacrylamide gel electrophoresis Lanes 1 to 5, Subjects ofMalays of Kelantan; Lanes 6 to 10, subjects of Malays of Minang; Lane L, 25 bp ladder

15. 36/2007-Hoh boon peng 11/19/08, 11:54137



DNA sequencing performed on the selectedsamples confirmed the number of repeat motifsof the loci (Fig. 3).

DISCUSSIONThe Minangs originated from West Sumatra,Indonesia. They are believed to be one of thelargest martilineal groups in this modern time.Traditionally, the wife remained with hermaternal relatives after marriage and inheritanceare passed through the women. Islam wasbrought into the Minangs as a result of increased

external trade with India, Acheh, and Melaka;and now they are among the most committedpeople to practice traditional Islam in thearchepelago (Gall, 1998). Their ethnic traditions,was believed to be derived from animistic andHindu-Buddhist beliefs. During the late 17th andearly 18th centuries, migration of the Minangsfrom West Sumatra to the state of NegeriSembilan, Peninsular Malaysia took place andtheir descendants now form the main sub-ethnicgroup in this state.

TABLE 2Diversity statistics for six Y-chromosome microsatellite loci in two Malay sub-ethnic groups

Population Average Total number of Average number ofheterozygosity allele alleles

Melayu Kelantan 0.658 26 4.333Melayu Minang 0.617 25 4.167

TABLE 3Y-STR haplotypes in the males subjects of the Malay sub-ethnic group

Sample Locus*

DYS19 DYS388 DYS390 DYS391 DYS392 DYS393

1 194 127 199 179 160 1282 194 124 207 175 160 132

Melayu 3 127 175 136Kelantan 4 186 127 215 183 156 124

5 186 127 199 171 160 1246 190 145 199 163 172 1287 194 127 203 163 172 1248 190 130 187 163 172 1209 190 127 195 163 184 12810 186 139 195 163 176 128

Average locus diversity 0.5926

11 186 127 207 165 164 13612 194 127 207 163 184 13213 190 127 187 163 164 132

Melayu 14 186 127 195 171 172 132Minang 15 190 127 203 167 176 132

16 186 127 223 167 176 13217 190 124 215 163 168 13218 186 124 207 167 160 13219 186 127 211 167 176 12420 186 124 223 167 168 136

Average locus diversity 0.8000

* Locus haplotypes were indicated as the size of amplicon, bp

15. 36/2007-Hoh boon peng 11/19/08, 11:54138

139Pertanika J. Trop. Agric. Sci. Vol. 31(1) 2008


Meanwhile, long before the emergence ofthe Melaka Sultanate, Kelantan was a crucialcentre of overland trans-peninsular trade route.Kelantanese also embraced Islam earlier thanMelaka and was reputed as the centre of Islamiclearning and scholarship. History resourcesshowed that the ancient Hindu-Malay Empire ofLangkasuka was centred in Pattani, whichencompassed of Modern Malaysia states ofKelantan, Terengganu and Northern Kedah, aswell as the provinces of Pattani, Yala, Narathiwat,Songkhla and Satun in Thailand. The PattaniMalays are very much similar in ethnicity, cultureand language to the Malays of Kelantan.

Although the level of polymorphisms of thetwo sub-groups were similar (average number ofalleles, 4; average heterozygosity, 0.6), allelefrequency distribution appeared to beimbalanced. The differences of the history ofsettlement and their socio-cultural practices couldprobably explain this phenomenon.

Significant difference of locus diversity wasobserved in DYS392, where Kelantan appearedto have lower locus diversity (h = 0.5926) thanMinang (h = 0.800). This could be an interestinglocus to investigate its ability to differentiate thetwo sub-ethnic groups. Previous studies foundthat the locus diversity of this locus ranged from0.7 – 0.75 (Yong et al., 2006; Chang et al., 2007).Meanwhile, Srikummool et al. (2000) reported arelatively lower frequency of allele 132 bp inDYS393 among the Thai population studied.Interestingly, this was found to be similar withthe the Malays of Kelantan in the current study,with a contrasting result from the Minangs, whichrevealed a significantly higher frequency for allele132 bp, proposing a closer affinity of the Malays

of Kelantan to the Thai population. In addition,allele 167 bp of locus DYS391 was also interestingsince it was a common allele in Minang but wasnot found in Malays of Kelantan. Few of thesedifferences may be significant even with thesmall number of samples and loci currentlyexamined but the consistency of the results,however, is reassuring.

The 8% PAGE offered a rapid, sensitive,and reproducible method for genotyping thesesix Y- STRs locus. Due to overall large fragmentsizes, the point mutations were ignored, as theydo not change the migration behaviour in thenative PAGE seperation. However, technicalerrors like miscoring and null alleles should beconsidered.

In summary, our preliminary results revealedpolymorphisms in the six loci among the twoMalay sub-ethnic groups. Significant differencesof the allele frequency distributions wereobserved, but a further investigation with largersample size is warranted to confirm thesefindings.

REFERENCESBELLWOOD, P. (1985). Prehistory of the Indo-

Malaysian Archipelago. Sydney: AcademicPress.

CHANG, Y.M. PERUMAL, R., PHOON, Y.K. and DANIEL,L.C. KUEHN. (2007). Haplotype diversity of16 Y-chromosomal STRs in three main ethnicpopulations (Malays, Chinese and Indians)in Malaysia. Forensic Sc. Int., 167, 70-76.

GALL, T.L. (1998). Worldmark Encyclopedia ofCultures and Daily Life (Vol. 3). Asia andOceania. Gale Research, USA.

Fig. 3: DNA sequencing performed on a selected sample confirmed presence of the repeat motif(TAGA)11 of the loci

15. 36/2007-Hoh boon peng 11/19/08, 11:54139



THOMAS, M.G., BRADMAN, N. and FINN, H.M.(1999). High throughput analysis of 10microsatellite and 11 diallelic polymorphismson the human Y-chromosome. Hum Genet.,105, 577-581.

TURNER, C.G. (1987). Late Pleistocene andHolocene population history of East Asiabased on dental variation. Am. J. Phys.Anthrol., 73, 305-321.

SRIKUMMOOL, M., KANGWANPONG, D., SINGH, N. andSEIELSTAD, M. (2001). Y-chromosomal

variation in uxirilocal and patrilocalpopulations in Thailand. In J. Lee, M.Seielstad and C. Xiao (Eds.), Recent advancesin human biology, genetic, linguistic &archaeological perspectives on human diversity inSoutheast Asia (8, pp. 69-82). Singapore:World Scientific Publishing.

YONG, R.Y.Y., LEE, L.K.H. and YAP, E.P.H. (2006).Y-chromosome STR haplotype diversity inthree ethnic populations in Singapore.Forensic Sc. Int., 159, 244-257.

15. 36/2007-Hoh boon peng 11/19/08, 11:54140

y-chromosomal str variation in malays of kelantan and minang papers/jtas vol. 31 (1... ·...

Documents