Nematology 0 (2018) 1-14 brill.com/nemy

Analysis of nematode-endosymbiont coevolution in the Xiphinemaamericanum species complex using molecular markers of

variable evolutionary rates

Dana K. HOWE 1, McKinley SMITH 1, Danielle M. TOM 1, Amanda M.V. BROWN 2,Amy B. PEETZ 3, Inga A. ZASADA 3 and Dee R. DENVER 1,∗

1 Department of Integrative Biology, Oregon State University, Corvallis, OR, USA2 Department of Biological Sciences, Texas Tech University, Lubbock, TX, USA

3 USDA-ARS Horticultural Crops Research Laboratory, Corvallis, OR, USA

Received: 9 January 2018; revised: 6 November 2018Accepted for publication: 7 November 2018

Summary – Bacterial symbioses play important roles in shaping diverse biological processes in nematodes, and serve as targetsin nematode biocontrol strategies. Focusing on the Xiphinema americanum species complex, we expanded upon recent researchinvestigating patterns of coevolution between Xiphinema spp. and Xiphinematobacter spp., utilising two symbiont genetic markersof varying evolutionary rates. Phylogenetic analysis of nematode mitochondrial DNA (mtDNA) revealed five strongly supported majorclades. Analysis of slow-evolving 16S rDNA in bacterial symbionts resulted in a phylogenetic topology composed of four majorclades that grouped taxa highly congruent with the nematode mtDNA topology. A faster evolving protein-coding symbiont gene (nad)provided more phylogenetic resolution with seven well-supported clades, also congruent with the nematode mtDNA tree topology. Ourresults reinforce recent studies suggesting extensive coevolution between Xiphinema spp. and their vertically transmitted endosymbiontsXiphinematobacter spp. and illustrate the advantages of including genetic markers of varying evolutionary rates in coevolutionary andphylogenetic studies.

Keywords – bacterial symbiosis, mitochondrial DNA, nad gene, phylogenetics, ribosomal DNA, Xiphinematobacter.

Bacterial endosymbionts are found in many inver-tebrates, including several clades of the Phylum Ne-matoda. The entomopathogenic nematodes Steinernema(Clade 10; sensu Holterman et al., 2006) and Hetero-rhabditis (Clade 9) evolved mutualistic relationships withGammaproteobacteria Xenorhabdus and Photorhabdus,respectively (Forst et al., 1997; Stock & Burnell, 2000).Wolbachia are Alphaproteobacteria found in filarial ne-matodes, such as Brugia malayi (Clade 8) (Foster et al.,2005), and plant-parasitic nematodes, such as Radopholussimilis and Pratylenchus penetrans (Clade 12) (Haegemanet al., 2009; Brown et al., 2016). Other plant-parasitic ne-matodes with bacterial endosymbionts include Heterode-ra glycines (Clade 12) associated with the Gram-negativebacteria Candidatus Paenicardinium endonii (Noel & At-ibalentja, 2006) and the Xiphinema americanium speciescomplex (Clade 2) associated with the verrucomicrobialCandidatus Xiphinematobacter spp. (Vandekerckhove et

al., 2000; Brown et al., 2015). As genomic survey toolsand environmental metagenomics techniques continue toadvance, it is likely that more endosymbionts will be dis-covered and their interactions with their nematode hostswill be better understood (Murfin et al., 2012; Denver etal., 2016).

Members of the X. americanum species complex har-bour a bacterial endosymbiont, Candidatus Xiphinema-tobacter americanum (hereafter Xiphinematobacter), ag-gregating within the gut epithelium and ovary epithe-lia in mature female nematodes, as demonstrated withtransmission electron microscopy (Vandekerckhove etal., 2000). Xiphinematobacter is a rod-shaped, Gram-negative bacterium that is an obligate cytoplasmic en-dosymbiont of several members of the X. americanumspecies complex, possibly diverging from its free-livinglineage some 50-140 million years ago (Vandekerckhoveet al., 2002). Although the role of Xiphinematobacter

∗ Corresponding author, e-mail: denvedee@oregonstate.edu

© Koninklijke Brill NV, Leiden, 2018 DOI 10.1163/15685411-00003233

Downloaded from Brill.com02/12/2019 05:51:20PMvia US Department of Agriculture

D.K. Howe et al.

was originally hypothesised as a reproductive manip-ulator causing parthenogenesis (Vandekerckhove et al.,2000), recent work using fluorescence in situ hybridisa-tion (FISH), genome sequencing and comparative func-tional genomics suggests it might function as a nutritionalmutualist (Brown et al., 2015).

Recent efforts to understand further Xiphinematobac-ter biodiversity have focused on phylogenetic analysesof bacterial 16S rRNA gene sequences from numerousXiphinema spp. The 16S rRNA of Xiphinematobacterfrom 22 populations of nematodes in the X. america-num species complex was sequenced to identify nine en-dosymbiont phylotypes, and six of these phylotypes dis-played a geographic bias (Lazarova et al., 2016). The16S rRNA has also been used as a marker to inves-tigate the question of coevolution between Xiphinema-tobacter and Xiphinema spp. In another study, a FISHscreening of 124 nematode populations using a bacte-rial 16S rRNA gene probe found Xiphinematobacter inthe X. americanum species complex (Palomares-Rius etal., 2016). Their phylogenetic comparisons of the nema-tode 28S rRNA and bacterial 16S rRNA trees suggesteda high degree of coevolution between host and endosym-biont. In a third study, Orlando et al. (2016) sequenced theD2-D3 region of the nematode 28S rRNA gene and themitochondrial cytochrome c oxidase subunit I (COI) genefrom several Xiphinema spp. The resultant mitochondrialDNA (mtDNA) phylogeny was compared with the 16SrRNA phylogeny for Xiphinematobacter and revealed ahigh level of co-speciation events between host and en-dosymbiont. In all three of these studies, the Xiphinema-tobacter 16S rRNA gene was used for the identificationand the phylogenetic analysis of the endosymbiont. Al-though it has been used to discern between Xiphinemato-bacter symbionts across the genus Xiphinema, the extentto which this slow-evolving gene adequately differenti-ates among closely related Xiphinematobacter symbiontsfrom nematodes within a region or population remainedunclear.

Our study presents an mtDNA phylogeny of 93 ne-matodes from the X. americanum species complex col-lected across North America. Due to unresolved speciesboundaries within the X. americanum species complex asdemonstrated by paraphyly in the phylogeny by Holter-man et al. (2017), we chose to identify our nematodes asX. americanum s.l. The addition of 60 new mtDNA se-quences strengthens and expands the mtDNA clades pre-viously presented by our collaborative group (Zasada etal., 2014). We also present two new Xiphinematobacter

phylogenies, one using the 16S rDNA sequence and oneusing an intergenic segment of the nicotinamide adeninedinucleotide (nad) synthetase protein-coding gene. Withthis information, we examined the co-phylogeny betweennematode and endosymbiont trees and found a high levelof co-speciation events between the nematode mtDNAand the endosymbiont protein-coding gene.

Materials and methods

NEMATODE POPULATIONS

Populations of X. americanum species complex werecollected in 2014 from ten locations in the USA andCanada and incorporated with previously sampled loca-tions to give a total of 29 sites (Table 1). Nematode sam-ples were chosen to maximise diversity, to include a rangeof geographic locations, host plants and predicted mito-chondrial clades (Zasada et al., 2014). One to five nema-todes were isolated from soil from each population as pre-vious described in Zasada et al. (2014) and stored in dis-tilled water at −20°C until DNA extraction. Populationdesignations include two letters for the state/province-sitenumber-individual number (i.e., WA-2.1).

DNA EXTRACTION, PCR AND SEQUENCING

After thawing samples, DNA extraction was performedas previously described (Williams et al., 1992; Zasadaet al., 2014). Briefly, individual nematodes were placedin 10 μl of lysis buffer (10 mM Tris pH 8.2; 2.5 mMMgCl2; 50 mM KCl; 0.45% Tween 20; 0.05% gelatin;60 μg ml− 1 proteinase K (BioVision)) in separate wellsof a glass slide using a worm pick. Each nematode was cutinto at least three pieces, transferred to a 0.2 ml strip tubewith an additional 10 μl of lysis buffer. The samples werefreeze/thawed three times before incubating in a BioRad96-well thermal cycler.

PCR and sequencing used specific primers targetingthe mtDNA region from cytochrome c oxidase subunitI (coxI) to small-subunit ribosomal RNA (RrnS) withinthe X. americanum species complex and two loci withinthe endosybiont Xiphinematobacter: a slow-evolving seg-ment of the 16S rDNA gene and a faster-evolving seg-ment of the nad protein-coding gene (Supplementary Ta-ble S1). The PCR mixture contained 1 μl of extractedDNA, 18.7 μl of molecular grade water, 2.5 μl of Lu-cigen 10× Econo Taq® buffer, 1 μl of 10 μM forwardprimer, 1 μl of 10 μM reverse primer, 0.5 μl of 10mM

2 Nematology

Downloaded from Brill.com02/12/2019 05:51:20PMvia US Department of Agriculture

Nematode-endosymbiont coevolution in Xiphinema americanum

dNTPs, and 0.3 μl at 5 U μl−1 of Lucigen Econo Taq®

DNA polymerase. Thermal cycler conditions for the nadand 16S regions of Xiphinematobacter were an initial de-naturation at 95°C for 2 min; 36 cycles at 95°C for 30 s,52°C for 20 s, 72°C for 2 min, and a final extension at72°C for 10 min. For the mtDNA region of X. america-num, thermal conditions were an initial denaturation at95°C for 2 min, then 34 cycles at 95°C for 30 s, 52°Cfor 20 s, 72°C for 3 min, and a final extension at 72°Cfor 10 min. All products were visualised on 1.5% agarosegels with ethidium bromide.

Prior to sequencing, the PCR products were puri-fied using solid phase reversible immobilisation (Elkinet al., 2001). PCR primers were used in direct sequenc-ing reactions and DNA sequencing was carried out onan ABI3730 capillary sequencer at the Oregon StateUniversity Center for Genome Research and Biocom-puting (Corvallis, OR, USA). Xiphinema spp. mtDNAsequences were submitted to GenBank under acces-sion numbers MK202519-MK202578; Xiphinematobac-ter 16S sequences were submitted to GenBank under ac-cession numbers MK182651-MK182702; and Xiphine-matobacter nad sequences were submitted to GenBankunder accession numbers MK182605-MK182650.

DNA SEQUENCE AND PHYLOGENETIC ANALYSES

Phylogenetic analyses for all nematode and bacterialsamples were performed using MEGA7 (Kumar et al.,2016). For the phylogenetic analyses of the Xiphinemaspp. mtDNA, 60 newly sequenced samples were com-bined with 32 from Zasada et al. (2014) and the Gen-Bank sequence accession NC_005928 (He et al., 2005a),for a total of 393 bp. These 93 mtDNA RrnS sequenceswere aligned using MUSCLE (Edgar, 2004). For the phy-logenetic analyses of Xiphinematobacter 16S and nad se-quences, only sequenced samples that also had a corre-sponding Xiphinema spp. mtDNA RrnS sequence were in-cluded for a total of 51 and 46 sequences, respectively. Forthe analysis of 51 Xiphinematobacter 16S samples, 510bp of bacterial 16S and 506 bp of nematode mtDNA werealigned independently using MUSCLE. For the analysisof 46 Xiphinematobacter nad samples, 511 bp of bacterialnad and 503 bp of nematode mtDNA were aligned inde-pendently using MUSCLE. A maximum likelihood anal-ysis using the Tamura-Nei model Gamma distributed withInvariant sites (G + I) model (with 1000 bootstraps) wasperformed for all three data sets.

CO-PHYLOGENETIC ANALYSES

Congruence between nematode mtDNA and each bac-terial phylogeny was tested using Jane 4 (Conow et al.,2010) with the default event-cost scheme (co-speciation =0, duplication = 1, host switch = 1, loss = 1, failure todiverge = 1), number of generations = 100, populationsize = 100 and sample size = 50. The tree topologiesfrom the maximum likelihood analyses of samples withboth nematode mtDNA and at least one bacterial sequencewere used for the analysis.

Results

NEMATODE MITOCHONDRIAL DNA PHYLOGENY

We analysed 93 total Xiphinema spp. mtDNA (RrnS)sequences that included the original GenBank referencesequence (NC_005928; He et al., 2005a), 32 sequencesfrom Zasada et al. (2014) and 60 sequences newly gen-erated for this study. Maximum likelihood phylogeneticanalysis with bootstrap replication was performed andused to construct a phylogeny (Fig. 1). These sequenceswere generated from nematodes collected from 29 differ-ent sites across the USA and one Canadian province (Ta-ble 1). This phylogeny revealed five major, clearly definedmtDNA clades (with bootstrap values above 70%). Therewas no evidence for associations between plant host andthe nematode mtDNA phylogenic structure. Clades mtA,mtB and mtC from Zasada et al. (2014) were again sup-ported here, and each slightly expanded with the additionof a few new sequences. Previously, clade mtB containedonly the GenBank entry and samples from Pennsylvania;the present analysis added one sample from Arkansas andone from North Carolina to this clade. The new Pennsyl-vania samples in this study were placed in clade mtD,which also includes nematodes collected from locationsacross the USA (New York, Pennsylvania, Idaho, Col-orado and Washington). Although the nematode samplesin clades mtC and mtE were from sites restricted to the Pa-cific Northwest region (Oregon, Washington and BritishColumbia), there was otherwise no clear geographic struc-ture associated with the phylogeny. From the 29 sam-pling sites, the mtDNA sequences from each individ-ual nematode at 21 sites were highly similar and eachmapped to a single, location-specific clade. However, themtDNA sequences from different individual nematodes atseven locations (AR-1, NC-1, NY-1, OR-1, OR-6, OR-8and PA-1) revealed more within-location genetic diversitysuch that individuals mapped into two different clades.

Vol. 0(0), 2018 3

Downloaded from Brill.com02/12/2019 05:51:20PMvia US Department of Agriculture

D.K. Howe et al.

SYMBIONT PHYLOGENIES

Maximum likelihood analyses with 1000 bootstrapswere performed to reconstruct Xiphinematobacter phylo-genies. One phylogeny used 51 sequences from the 16SrDNA locus (510 bp) and the other used 46 sequencesfrom the nad synthetase locus (511 bp; SupplementaryFigs S1, S2). The 16S locus was able to broadly differenti-ate between mtDNA clades mtC, mtD and mtE. This phy-logeny, however, did not recover the same internal struc-ture for these clades, as found in the mtDNA phylogeny.The 16S locus grouped together the eight samples repre-senting clades mtA and mtB, all from sites in the east-ern USA (Arkansas, Ohio and North Carolina). The nadlocus amplified best in samples representing clades mtDand mtE, from locations in New York, Pennsylvania, Ore-gon, British Columbia and Washington. The samples fromclade mtE were split into three groups, and most closelymatched the structure from the mtDNA phylogeny. How-ever, no mtA clade samples successfully amplified for in-clusion in the nad phylogeny.

CO-PHYLOGENIC ANALYSES

To explore the question of co-phylogeny between thenematode and bacteria, the maximum likelihood phylo-genies from samples that had successful amplicons forboth the nematode mtDNA locus and either the bacte-rial 16S or nad locus were compared (Figs 2, 3, respec-tively). A total of 51 sequences were included in themaximum likelihood cladograms of the 16S rDNA lo-cus (510 bp) in Xiphinematobacter and the mtDNA lo-cus (506 bp) in X. americanum species complex nema-todes. This comparison revealed co-phylogeny betweenfour major congruent groups (with bootstrap values above70%). Visual inspection of these endosymbiont phyloge-nies alongside the host phylogenies revealed nearly com-plete congruence with the mtDNA clades described abovewith only one sample not associated within its corre-

Fig. 1. Maximum Likelihood phylogram of a segment of themtDNA small subunit rRNA locus (393 bp) in 93 samples ofXiphinema americanum species complex nematodes showingsupport from 1000 bootstrap replicates on nodes > 70%. Eachtwo letter name corresponds to a sample location (see Table 1),followed by a number to specify the site and a number forthe individual nematode. Samples included from Zasada et al.(2014) are labelled in grey. The five major clearly definedmtDNA clades are labelled mtA-mtE.

4 Nematology

Downloaded from Brill.com02/12/2019 05:51:20PMvia US Department of Agriculture

Nematode-endosymbiont coevolution in Xiphinema americanum

Table 1. Xiphinema americanum species complex nematode samples used in phylogenetic analyses of nematode mitochondrial(mtDNA) and Xiphinematobacter loci.

Location in USA Designation mtDNA sequences Bacterial sequences Host plant

Hope, Arkansas* AR-1 4 BlackberryHope, Arkansas AR-2 3 3/- GrapevinePalisade, Colorado* CO-1 1 CherryMesa, Colorado* CO-2 1 CherryGrand Junction, Colorado CO-3 4 3/4 CherryGrand Junction, Colorado CO-4 3 2/3 CherryParma, Idaho ID-1 2 2/2 GrapevineFletcher, North Carolina* NC-1 3 RaspberryFletcher, North Carolina NC-2 1 1/1 RaspberryGeneva, New York* NY-1 3 CherryGeneva, New York NY-2 3 3/3 CherryWooster, Ohio* OH-1 4 BlueberryWooster, Ohio OH-2 4 4/- BlueberryRogue Valley, Oregon* OR-1 3 GrapevineVeneta, Oregon* OR-2 2 GrapevineGaston, Oregon OR-3 4 2/1 GrapevineAlpine, Oregon OR-4 3 3/3 GrapevineSalem, Oregon OR-5 3 3/2 GrapevineBiglerville, Pennsylvania* PA-1 3 AppleBiglerville, Pennsylvania PA-2 4 4/4 AppleZillah, Washington* WA-1 3 GrapevinePaterson, Washington* WA-2 4 GrapevineWoodland, Washington* WA-3 1 BlueberryProsser, Washington WA-4 3 3/3 GrapevineMattawa, Washington WA-5 2 2/- GrapevinePaterson, Washington WA-6 2 2/2 GrapevineWoodland, Washington WA-7 4 4/3 BlueberryWoodland, Washington WA-8 5 -/5 BlueberryWashington WA-9 2 2/2 N/AWashington WA-10 1 1/1 N/AYakima, Washington WA-11 1 1/1 N/AAbbotsford, British Columbia BC-1 2 2/2 CherryAbbotsford, British Columbia BC-2 4 4/4 CherryTOTAL 92 51/46

The number of sites and the number of mtDNA sequences incorporate both new mtDNA and bacterial samples from this study withmtDNA data from Zasada et al. (2014), designated with an asterisk. The number of bacterial sequences is the number of nematodesamples that had a successful amplicon for either the 16S rDNA/nad synthetase locus, respectively.

sponding mtDNA clade. The 16S sequence from NC-2.1,whose mtDNA sequence placed it in the mtB clade withAR-2.4, was associated with sequences from the mtAclade.

We also compared the 46 samples with sequences fromboth the nad synthetase locus (511 bp) in Xiphinema-tobacter and the mtDNA locus (503 bp) in X. ameri-canum species complex nematodes. This comparison ofmaximum likelihood phylogenies revealed co-phylogeny

between seven major congruent groups (with bootstrapvalues above 70%). In the nad synthetase phylogeny,all samples remained associated within their mtDNAclades, mtB to mtE. Only one change was seen withinthis group, OR-3.1. The OR-3.1 Xiphinematobacter nadlocus showed a closer relationship to the WA-7.4, andWA-8 samples, while the nematode mtDNA locus re-vealed more divergence. The samples from clade mtDwere split into two groups and had less internal struc-

Vol. 0(0), 2018 5

Downloaded from Brill.com02/12/2019 05:51:20PMvia US Department of Agriculture

D.K. Howe et al.

Fig. 2. Maximum Likelihood cladogram of the 16S rDNA locus (510 bp) in Xiphinematobacter and the mitochondrial (mtDNA)locus (506 bp) in Xiphinema americanum species complex nematodes (1000 bootstrap replicates). Comparison of the 51 sequencesrevealed coevolution between four major congruent groups (support above 80%). The mtDNA clades from Figure 1 are noted on the X.americanum species complex tree.

ture compared to the mtDNA phylogeny. There was onesample, ID-1.3, with a shift in placement within one mtDgroup. While only three samples successfully sequencedfrom clades mtB and mtC with the nad locus, they werecompletely congruent, making up two distinct groups. Nosamples from mtA successful sequenced for the nad lo-cus.

The event-based analysis in Jane for co-phylogenybetween the mtDNA locus in Xiphinema spp. and the16S rDNA locus in Xiphinematobacter revealed highcongruency between the trees (Supplementary Fig. S3).

A total of 45 solutions was considered with a total cost of29 for reconstructions (cospeciation = 39, duplication =0, duplications and host switching = 12, host loss = 5,and failures to diverge = 0). The analysis in Jane alsoshowed high congruency between the trees of the mtDNAlocus in Xiphinema spp. and the nad synthetase locusin Xiphinematobacter (Supplementary Fig. S4). A totalof 101 solutions was considered with a total cost of 14for reconstructions (cospeciation = 40, duplication = 0,duplications and host switching = 5, host loss = 4, andfailures to diverge = 0).

6 Nematology

Downloaded from Brill.com02/12/2019 05:51:20PMvia US Department of Agriculture

Nematode-endosymbiont coevolution in Xiphinema americanum

Fig. 3. Maximum likelihood cladogram of the nad synthetase locus (511 bp) in Xiphinematobacter and the mitochondrial (mtDNA)locus (503 bp) in Xiphinema americanum species complex nematodes (1000 bootstrap replicates). Comparison of the 46 sequencesrevealed coevolution between seven major congruent groups (support above 80%). The mtDNA clades from Figure 1 are noted on theX. americanum species complex tree.

Discussion

The use of different genetic markers provides vary-ing strengths to infer phylogenetic relationships at differ-ent evolutionary scales. The bacterial 16S rRNA gene isa common marker for evolution studies. This gene hasbeen shown to be a good genetic tool because conservedprimer sequences can be used to identify samples acrossa wide range of bacteria, making its sequences commonlyavailable in the public sequence databases (Lane et al.,1985; Woese, 1987; Wang & Qian, 2009). The 16S rRNA

gene often works well to differentiate between speciesor operational taxonomic units (OTUs), but has limita-tions for studying coevolution because it is slow evolv-ing. It works well across broad groups but is not in-formative in closer relationships (Fraser et al., 2009).We were able to amplify Xiphinematobacter DNA fromsamples across all five of the mtDNA clades and re-solve four major groups for coevolution using 16S rRNAsequence. Within these Xiphinematobacter clades therewas very limited resolution, resulting in large polytomies(Fig. 2). The resolution was improved when we used

Vol. 0(0), 2018 7

Downloaded from Brill.com02/12/2019 05:51:20PMvia US Department of Agriculture

D.K. Howe et al.

the faster-evolving nad locus, resulting in fewer poly-tomies within the bacterial phylogeny and seven well-supported groups for coevolution (Fig. 3). This overallimprovement when using the sequence data of the nad lo-cus was also apparent in the Jane analysis, with a lowercost for the reconstruction with nad compared to 16SrRNA.

While using a protein-coding gene marker allowed usto resolve finer relationships within our closely relatedsamples, this type of marker is not likely to work as wellacross more diverse samples due to more expected vari-ability in the priming sites (e.g., silent codon positions).Using a protein-coding gene can also be less effectiveacross multiple species or OTUs because the gene tar-get may not occur (or be duplicated) in different sam-ples. In our nad phylogeny, we lost representation of themtA clade and had fewer samples for the mtB and mtCclades, as compared to the 16S rRNA phylogeny. Theprimers for the nad locus were designed from the pub-lished genome for Xiphinematobacter, which was gener-ated from a Washington sampling site (CP012665; Brownet al., 2016). The relatively low representation of Wash-ington samples in clades mtA and mtB, only 3 out of35, could suggest sequence differences within the primingsites of the nad region, thus negatively effecting amplifi-cation.

Previous work found signatures of a long-term evolu-tionary relationship between Xiphinema spp. and Xiphine-matobacter supporting their coevolution. Xiphinemato-bacter is vertically transmitted in this parthenogenicnematode species (Coomans & Claeys, 1998; Vandeker-ckhove et al., 2002), and its genome is greatly reduced(Brown et al., 2015). Our study adds further genetic sup-port to recent research showing there is strong evidencefor coevolution between Xiphinema spp. and Xiphine-matobacter. One recent coevolution study examined 11species of Xiphinema spp. and 15 bacterial species fromsix different countries. They found that each nematodespecies harboured a unique bacterial species, with strongpatterns of co-speciation between bacteria and host (Or-lando et al., 2016). Another study including nematodescollected from Spain, Greece and Japan also found sig-nificant co-speciation when comparing the phylogenies ofXiphinema spp. 28S rRNA and Xiphinematobacter 16SrRNA (Palomares-Rius et al., 2016). Our study comple-ments previous analyses by focusing on the closely relatednematodes within the X. americanum species complexfrom a larger number of samples across North America,

and by using a faster-evolving symbiont genetic markerthat revealed evidence for coevolution among closely-related nematode and symbiont lineages. Using primersspecifically designed to target known gene sequences inXiphinematobacter allowed us to focus only on this sym-biotic relationship.

Within this closely related group of X. americanumspecies complex in our study, we did not find any as-sociation between host plant and the nematode or sym-biont phylogenies. We also did not find support for strongpatterns of geographic structuring within the phylogenies.We sampled most extensively in Washington (seven popu-lations and 28 individual nematodes) resulting in 30% ofthe total mtDNA samples. These Washington sequenceswere included in four out of five mtDNA clades, suggest-ing that many genetically diverse X. americanum speciescomplex lineages occur in this state. Although cladesmtC and mtE only contained populations from the PacificNorthwest region, 55% of our total samples came fromthis region making it difficult to rule out possible effectsof sampling bias.

Taxonomic identification of species within the X. ame-ricanum species complex is problematic because of highmorphological variability, and even new genetic bar-coding techniques are insufficient to resolve taxonomywithin this group (He et al., 2005b; Zasada et al., 2014;Palomares-Rius et al., 2017). The consistent evidencesupporting coevolution between the bacteria and its nema-tode host with different markers suggests that Xiphinema-tobacter DNA might serve as an effective genetic markerfor the host. Congruent phylogenies between Mollitri-chosiphum aphid hosts and their Buchnera bacterial en-dosymbionts have provided significant support for co-speciation and the ability to use the endosymbiont tostudy the evolutionary history of the host (Clark et al.,2000; Funk et al., 2000; Liu et al., 2013). One unan-swered question is how prevalent verrucomicrobial sym-bionts are in nematodes. Previous work has used fluores-cent probes or PCR primers for detection, but these areof limited use across the diverse phylum (Lazarova et al.,2016; Orlando et al., 2016; Palomares-Rius et al., 2016).As more genome sequence resources become available,mining databases for new symbionts could increase ourunderstanding of the abundance and functionality of ne-matode symbioses (Murfin et al., 2012; Denver et al.,2016).

8 Nematology

Downloaded from Brill.com02/12/2019 05:51:20PMvia US Department of Agriculture

Nematode-endosymbiont coevolution in Xiphinema americanum

Acknowledgements

We would like to thank Caprice Rosato, Dacey Mercerand Jessica Nixon at the Center for Genome Researchand Bioinfomatics (CGRB) at Oregon State University forsequencing assistance. We also thank Terry Kirkpatrick,John Halbrendt, Andreas Westphal and Ramesh Pokaralfor assisting in nematode collection.

References

Brown, A.M.V., Howe, D.K., Wasala, S.K., Peetz, A.B., Zasada,I.A. & Denver, D.R. (2015). Comparative genomics of aplant-parasitic nematode endosymbiont suggest a role innutritional symbiosis. Genome Biology and Evolution 7,2727-2746. DOI: 10.1093/gbe/evv176

Brown, A.M.V., Wasala, S.K., Howe, D.K., Peetz, A.B., Zasada,I.A. & Denver, D.R. (2016). Genomic evidence for plant-parasitic nematodes as the earliest Wolbachia hosts. ScientificReports 6, 34955. DOI: 10.1038/srep34955

Clark, M.A., Moran, N.A., Baumann, P. & Wernegreen,J.J. (2000). Cospeciation between bacterial endosymbionts(Buchnera) and a recent radiation of aphids (Uroleucon) andpitfalls of testing for phylogenetic congruence. Evolution 54,517-525. DOI: 10.1111/j.0014-3820.2000.tb00054.x

Conow, C., Fielder, D., Ovadia, Y. & Libeskind-Hadas, R.(2010). Jane: a new tool for the cophylogeny reconstructionproblem. Algorithms for Molecular Biology 5, 16. DOI: 10.1186/1748-7188-5-16

Coomans, A. & Claeys, M. (1998). Structure of the femalereproductive system of Xiphinema americanum (Nematoda:Longidoridae). Fundamental and Applied Nematology 21,569-580.

Denver, D.R., Brown, A.M.V., Howe, D.K., Peetz, A.B. & Za-sada, I.A. (2016). Genome skimming: a rapid approach togaining diverse biological insights into multicellular patho-gens. PLoS Pathogens 12, e1005713. DOI: 10.1371/journal.ppat.1005713

Elkin, C.J., Richardson, P.M., Fourcade, H.M., Hammon, N.M.,Pollard, M.J., Predki, P.F., Glavina, T. & Hawkins, T.L.(2001). High-throughput plasmid purification for capillarysequencing. Genome Research 11, 1269-1274. DOI: 10.1101/gr.167801

Forst, S., Dowds, B., Boemare, N. & Stackebrandt, E. (1997).Xenorhabdus and Photorhabdus spp.: bugs that kill bugs.Annual Review of Microbiology 51, 47-72. DOI: 10.1146/annurev.micro.51.1.47

Foster, J., Ganatra, M., Kamal, I., Ware, J., Makarova, K.,Ivanova, N., Bhattacharyya, A., Kapatral, V., Kumar, S.,Posfai, J. et al. (2005). The Wolbachia genome of Brugiamalayi: endosymbiont evolution within a human pathogenic

nematode. PLoS Biology 3, 599-614. DOI: 10.1371/journal.pbio.0030121

Fraser, C., Alm, E.J., Polz, M.F., Spratt, B.G. & Hanage, W.P.(2009). The bacterial species challenge: making sense ofgenetic and ecological diversity. Science 323, 741-746. DOI:10.1126/science.1159388

Funk, D.J., Helbling, L., Wernegreen, J.J. & Moran, N.A.(2000). Intraspecific phylogenetic congruence among mul-tiple symbiont genomes. Proceedings of the Royal SocietyB: Biological Sciences 267, 2517-2521. DOI: 10.1098/rspb.2000.1314

Haegeman, A., Vanholme, B., Jacob, J., Vandekerckhove,T.T.M., Claeys, M., Borgonie, G. & Gheysen, G. (2009).An endosymbiotic bacterium in a plant-parasitic nematode:member of a new Wolbachia supergroup. International Jour-nal for Parasitology 39, 1045-1054. DOI: 10.1016/j.ijpara.2009.01.006

He, Y., Jones, J., Armstrong, M., Lamberti, F. & Moens, M.(2005a). The mitochondrial genome of Xiphinema america-num sensu stricto (Nematoda: Enoplea): considerable econ-omization in the length and structural features of encodedgenes. Journal of Molecular Evolution 61, 819-833. DOI: 10.1007/s00239-005-0102-7

He, Y., Subbotin, S.A., Rubtsova, T.V., Lamberti, F., Brown,D.J.F. & Moens, M. (2005b). A molecular phylogenetic ap-proach to Longidoridae (Nematoda: Dorylaimida). Nemato-logy 7, 111-124. DOI: 10.1163/15698541054192108

Holterman, M., van der Wurff, A., van den Elsen, S., van Megen,H., Bongers, T., Holovachov, O., Bakker, J. & Helder, J.(2006). Phylum-wide analysis of SSU rDNA reveals deepphylogenetic relationships among nematodes and acceleratedevolution toward crown clades. Molecular Biology and Evo-lution 23, 1792-1800. DOI: 10.1093/molbev/msl044

Kumar, S., Stecher, G., Tamura, K., Gerken, J., Pruesse, E.,Quast, C., Schweer, T., Peplies, J., Ludwig, W. & Glockner,F.O. (2016). MEGA7: molecular evolutionary genetics anal-ysis version 7.0 for bigger datasets. Molecular Biology andEvolution 33, 1870-1874. DOI: 10.1093/molbev/msw054

Lane, D.J., Pace, B., Olsen, G.J., Stahl, D.A., Sogin, M.L. &Pace, N.R. (1985). Rapid determination of 16S ribosomalRNA sequences for phylogenetic analyses. Proceedings of theNational Academy of Sciences of the United States of America82, 6955-6959.

Lazarova, S.S., Brown, D.J.F., Marcelo, C., Oliveira, G., Fenton,B., Mackenzie, K., Wright, F., Malloch, G. & Neilson, R.(2016). Diversity of endosymbiont bacteria associated with anon-filarial nematode group. Nematology 18, 615-623. DOI:10.1163/15685411-00002982

Liu, L., Huang, X., Zhang, R., Jiang, L. & Qiao, G. (2013).Phylogenetic congruence between Mollitrichosiphum (Aphi-didae: Greenideinae) and Buchnera indicates insect-bacteriaparallel evolution. Systematic Entomology 38, 81-92. DOI:10.1111/J.1365-3113.2012.00647.X

Vol. 0(0), 2018 9

Downloaded from Brill.com02/12/2019 05:51:20PMvia US Department of Agriculture

D.K. Howe et al.

Murfin, K.E., Dillman, A.R., Foster, J.M., Bulgheresi, S.,Slatko, B.E., Sternberg, P.W. & Goodrich-Blair, H. (2012).Nematode-bacterium symbioses – cooperation and conflictrevealed in the ‘omics’ age. The Biological Bulletin 223, 85-102. DOI: 10.1086/BBLv223n1p85

Noel, G.R. & Atibalentja, N. (2006). ‘Candidatus Paenicar-dinium endonii’, an endosymbiont of the plant-parasitic ne-matode Heterodera glycines (Nemata: Tylenchida), affiliatedto the phylum Bacteroidetes. International Journal of Syste-matic and Evolutionary Microbiology 56, 1697-1702. DOI:10.1099/ijs.0.64234-0

Orlando, V., Chitambar, J.J., Dong, K., Chizhov, V.N., Mollov,D., Bert, W. & Subbotin, S.A. (2016). Molecular and mor-phological characterisation of Xiphinema americanum-groupspecies (Nematoda: Dorylaimida) from California, USA, andother regions, and co-evolution of bacteria from the genusCandidatus Xiphinematobacter with nematodes. Nematology18, 1015-1043. DOI: 10.1163/15685411-00003012

Palomares-Rius, J.E., Archidona-Yuste, A., Cantalapiedra-Navarrete, C., Prieto, P. & Castillo, P. (2016). Molecular di-versity of bacterial endosymbionts associated with dagger ne-matodes of the genus Xiphinema (Nematoda: Longidoridae)reveals a high degree of phylogenetic congruence with theirhost. Molecular Ecology 25, 6225-6247. DOI: 10.1111/mec.13904

Palomares-Rius, J.E., Cantalapiedra-Navarrete, C., Archidona-Yuste, A., Subbotin, S.A. & Castillo, P. (2017). The utilityof mtDNA and rDNA for barcoding and phylogeny ofplant-parasitic nematodes from Longidoridae (Nematoda,Enoplea). Scientific Reports 7, 10905. DOI: 10.1038/s41598-017-11085-4

Stock, S.P. & Burnell, A. (2000). Heterorhabditis, Steinernemaand their bacterial symbionts – lethal pathogens of insects.Nematology 2, 31-42. DOI: 10.1163/156854100508872

Vandekerckhove, T.T.M., Willems, A., Gillis, M. & Coomans,

A. (2000). Occurrence of novel verrucomicrobial species,

endosymbiotic and associated with parthenogenesis in

Xiphinema americanum-group species (Nematoda, Longi-

doridae). International Journal of Systematic and Evolution-

ary Microbiology 50, 2197-2205. DOI: 10.1099/00207713-

50-6-2197

Vandekerckhove, T.T.M., Coomans, A., Cornelis, K., Baert, P. &

Gillis, M. (2002). Use of the Verrucomicrobia-specific probe

EUB338-III and fluorescent in situ hybridization for detection

of “Candidatus Xiphinematobacter” cells in nematode hosts.

Applied and Environmental Microbiology 68, 3121-3125.

DOI: 10.1128/AEM.68.6.3121-3125.2002

Wang, Y. & Qian, P.-Y. (2009). Conservative fragments in bac-

terial 16S rRNA genes and primer design for 16S riboso-

mal DNA amplicons in metagenomic studies. PLoS ONE 4,

e7401. DOI: 10.1371/journal.pone.0007401

Williams, B.D., Schrank, B., Huynh, C., Shownkeen, R. & Wa-

terston, R.H. (1992). A genetic mapping system in Caeno-

rhabditis elegans based on polymorphic sequence-tagged

sites. Genetics 131, 609-624.

Woese, C.R. (1987). Bacterial evolution. Microbiological Re-

views 51, 221-271.

Zasada, I.A., Peetz, A., Howe, D.K., Wilhelm, L.J., Cheam, D.,

Denver, D.R. & Smythe, A.B. (2014). Using mitogenomic

and nuclear ribosomal sequence data to investigate the phy-

logeny of the Xiphinema americanum species complex. PLoS

ONE 9, e90035. DOI: 10.1371/journal.pone.0090035

Supplementary Table S1. Primers designed in this study for PCR and sequencing of Xiphinema americanum species complexnematodes’ mitochondrial DNA (mtDNA) and Xiphinematobacter 16S and nad synthetase gene.

Primer name Sequence (5′ → 3′) Genome position

Xa_Cox1F GAGCACAYCAYATRTTTAGACT 9861Xa_12SR CGACAAGGATYAGATACCCTTTT 12 154Xiph_16S-F TGCCAGCAGCCGCGGTAATACA 18 096Xiph_16S-R GCAGCCTACAATCCGAACTGGGC 17 309xNAD-F CGGTCCCGAAGATCYTGRAA 24 095xNAD-R ACGCATTTCTTAAACCCRCAYTT 22 930XiphNAD1-F CCCACGATGGCGGGCTTCATTTA 24 037XiphNAD2-R TCCTCCACTAAGCCCTAGTACGC 22 930

Genome position is based on GenBank accessions NC_005928 for X. americanum mtDNA and CP012665 for Xiphinematobacter (Heet al., 2005a; Brown et al., 2016).

10 Nematology

Downloaded from Brill.com02/12/2019 05:51:20PMvia US Department of Agriculture

Nematode-endosymbiont coevolution in Xiphinema americanum

Supplementary Fig. S1. Maximum likelihood phylogram of the 16S rDNA locus (510 bp) in Xiphinematobacter (1000 bootstrapreplicates). For designations see Table 1.

Vol. 0(0), 2018 11

Downloaded from Brill.com02/12/2019 05:51:20PMvia US Department of Agriculture

D.K. Howe et al.

Supplementary Fig. S2. Maximum likelihood phylogram of the nad synthetase locus (511 bp) in Xiphinematobacter (1000 bootstrapreplicates). For designations see Table 1.

12 Nematology

Downloaded from Brill.com02/12/2019 05:51:20PMvia US Department of Agriculture

Nematode-endosymbiont coevolution in Xiphinema americanum

Supplementary Fig. S3. Jane analysis of co-phylogeny between Xiphinema americanum species complex nematodes’ mitochondrialDNA (mtDNA) and Xiphinematobacter 16S rDNA locus. A co-speciation is marked by a hollow coloured circle; a duplication is markedby a solid coloured circle; a host switch is marked by a duplication, with an arrowhead following the trajectory of the switching species;and a loss is marked by a dashed line. A yellow node indicates that there is another location of equal cost where the parasite node andits descendants may be mapped, and a red node means that all other locations it may be mapped are of higher cost. For designations seeTable 1.

Vol. 0(0), 2018 13

Downloaded from Brill.com02/12/2019 05:51:20PMvia US Department of Agriculture

D.K. Howe et al.

Supplementary Fig. S4. Jane analysis of co-phylogeny between Xiphinema americanum species complex nematodes’ mitochondrialDNA (mtDNA) and Xiphinematobacter nad synthetase locus. A co-speciation is marked by a hollow coloured circle; a duplication ismarked by a solid coloured circle; a host switch is marked by a duplication, with an arrowhead following the trajectory of the switchingspecies; and a loss is marked by a dashed line. A yellow node indicates that there is another location of equal cost where the parasitenode and its descendants may be mapped, and a red node means that all other locations it may be mapped are of higher cost. Fordesignations see Table 1.

14 Nematology

Downloaded from Brill.com02/12/2019 05:51:20PMvia US Department of Agriculture