of June 17, 2018.This information is current as Chain Locus

HeavyGenomic Organization of the Variable Variable Heavy Chain Gene Usage and theand Neonatal Piglets. XI. The Relationship of Antibody Repertoire Development in Fetal

Chardon, Gregory J. Tobin and John E. ButlerFrancois Puimi, Hirohide Uenishi, Kevin Wells, Patrick Tomoko Eguchi-Ogawa, Nancy Wertz, Xiu-Zhu Sun,

http://www.jimmunol.org/content/184/7/3734doi: 10.4049/jimmunol.0903616March 2010;

2010; 184:3734-3742; Prepublished online 5J Immunol 

MaterialSupplementary

6.DC1http://www.jimmunol.org/content/suppl/2010/03/05/jimmunol.090361

Referenceshttp://www.jimmunol.org/content/184/7/3734.full#ref-list-1

, 20 of which you can access for free at: cites 52 articlesThis article

        average*  

4 weeks from acceptance to publicationFast Publication! •    

Every submission reviewed by practicing scientistsNo Triage! •    

from submission to initial decisionRapid Reviews! 30 days* •    

Submit online. ?The JIWhy

Subscriptionhttp://jimmunol.org/subscription

is online at: The Journal of ImmunologyInformation about subscribing to

Permissionshttp://www.aai.org/About/Publications/JI/copyright.htmlSubmit copyright permission requests at:

Email Alertshttp://jimmunol.org/alertsReceive free email-alerts when new articles cite this article. Sign up at:

Errata

/content/190/3/1383.full.pdfor:

next pageAn erratum has been published regarding this article. Please see

Print ISSN: 0022-1767 Online ISSN: 1550-6606. Immunologists, Inc. All rights reserved.Copyright © 2010 by The American Association of1451 Rockville Pike, Suite 650, Rockville, MD 20852The American Association of Immunologists, Inc.,

is published twice each month byThe Journal of Immunology

by guest on June 17, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

by guest on June 17, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

by guest on June 17, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

The Journal of Immunology

Antibody Repertoire Development in Fetal and NeonatalPiglets. XI. The Relationship of Variable Heavy Chain GeneUsage and the Genomic Organization of the Variable HeavyChain Locus

Tomoko Eguchi-Ogawa,* Nancy Wertz,† Xiu-Zhu Sun,† Francois Puimi,‡

Hirohide Uenishi,* Kevin Wells,x Patrick Chardon,‡ Gregory J. Tobin,{ and

John E. Butler†

In this study, we havemapped the 39H chainV region (VH) genes and those in theH chain diversity, H chain joining, and 59 portion of

theHchain constant locus.We show that swinepossess only two functionalHchain diversity segments andonlyone functionalH chain

joining segment. These data help to explainmore than a decade of observations on the preimmune repertoire of this species and reveal

the vulnerability of swine to natural or designed mutational events. The results are consistent with earlier studies on the region

containing Enh, Cm, and Cd while revealing that the ancestral IgG3 is the most 59 Cg gene. We also observed a recent duplication

(∼1.6 million years ago) in the VH locus that contains six of the seven VH genes that comprise 75% of the preimmune repertoire.

Because there are no known transfers of immune regulators orAgs that cross the placenta as inmice and humans, fetal VHusagemust

be intrinsically regulated. Therefore, we quantified VH usage in fetal piglets and demonstrated that usage is independent of the

position of VH genes in the genome; themost 39 functional VH gene (IGHV2) is rarely used, whereas certain upstream genes (IGHV14

and IGHV15) arepredominately used early in fetal liver but seldom thereafter. Similar to previous studies, threeVHgenes account for

40% of the repertoire and six for ∼70%. This limited combinatorial diversity of the porcine VH repertoire further emphasizes the

dependence on CDR3 diversity for generating the preimmune Ab repertoire of this species. The Journal of Immunology, 2010, 184:

3734–3742.

The H chain Ig variable locus is organized similarly in allmammals that have been studied. As few as 12 to.1000 Hchain V region (VH) genes are thought to be arrayed 59 of

multiple H chain diversity (DH) segments that in turn are found 59 ofup to nine H chain joining (JH) segments (1, 2). VH genes charac-terized to date include many pseudogenes (3), such as those withnonconsensus signal sequences, stop codons, frameshift mutations,or the absence of functional leader sequences. In humans, for ex-ample, only 38–46 of the.100VH genes (haplotype dependent) are

functional,whereas 27DH segments canbe expressed, but only six ofthe nine JH segments are functional (2, 4). The VH genes of verte-brates belong to different families that have been grouped into threeclans based on sequence homologies (5). There are large differencesin the number of VH genes and VH gene families among species. Inswine,,30 genes have been described, all belonging to the ancestralVH3 family (6, 7) and have identical or nearly identical frameworkregions but differ in their CDR1 and CDR2 regions (8, 9). However,CDR regions are often shared among different porcine VH genes,suggesting they could be a consequence of gene duplication com-bined with a type of genomic gene conversion (10, 11).The distribution of VH gene segment usage in fetal and newborn

mice, humans, rabbits, and swine is nonrandom, and usage patternsvary during ontogeny. In the fetal liver of mice, members of the VH5and VH2 families (especially 7183 and Q52, respectively) arepreferentially used (12, 13), but after birth, splenic B cells use theVH1 family (J558) (14). TheVH2 andVH5 family genes are themost39 in the locus, whereas the J558 family is midway (more 59) in thelocus, suggesting that VH usage in the preimmune repertoire favors39 VH genes but that usage shifts upstream, presumably due to ex-posure to environmental Ag because this shift does not occur ingerm-free mice (14, 15). A preferential usage of the most JH prox-imal VH3 family genes has also been reported in humans (16, 17).Early VH usage in rabbits favors the most 39 VH gene (VH1) in 90%of VDJ rearrangements, but this preferential usage declines duringdevelopment and with exposure to environmental Ag (18). How-ever, developmental repertoire changes in rabbits are compoundedby somatic gene conversion, a phenomenon rarely seen inmice (19).The pattern of preferential usage of 39VH genes is not supported in

all studies. In humans,V3-23 andV3-30 are preferentially used in the

*National Institute of Agrobiological Sciences, Tsukuba, Ibaraki, Japan; †Departmentof Microbiology, University of Iowa, Iowa City, IA 52242; ‡National Institute for Agro-nomic Research, Institute of Molecular Biology, Jouy-en-Josas, France; xDivision ofAnimal Sciences, University of Missouri, Columbia, MO 65211; and {Biological Mim-etics, Frederick, MD 21702

Received for publication November 11, 2009. Accepted for publication February 1,2010.

This work was supported by National Science Foundation-Integrative OrganismalSystems Grant 15203800 and Grant 58-1265-5-053 from the National Pork Boardand subaward C080090-UI from Biological Mimetics.

The sequences presented in this article have been submitted to GenBank underaccession numbers AB513624 and AB513625.

Address correspondence and reprint requests to Dr. John E. Butler, InterdisciplinaryImmunology Program, Department of Microbiology, University of Iowa, 51 NewtonRoad, Iowa City, IA 52242. E-mail address: john-butler@uiowa.edu

The online version of this article contains supplemental material.

Abbreviations used in this paper: BAC, bacterial artificial chromosome; CH, H chainconstant; DG, day of gestation; DH, H chain diversity; FR, framework region; IMGT,ImMunoGeneTics; IPP, ileal Peyer’s patches; JH, H chain joining; LINE, long in-terspersed nucleotide element; RSS, recombination signal sequence; VH, H chain Vregion.

Copyright� 2010 by TheAmericanAssociation of Immunologists, Inc. 0022-1767/10/$16.00

www.jimmunol.org/cgi/doi/10.4049/jimmunol.0903616

by guest on June 17, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

preimmune repertoire, but these map to the middle of the locus (20).Alternatives to the locus position concept include: 1) negative se-lection for B cells utilizing VH genes that recognize certain self-Ags;2) positive selection for B cells by stromal ligands based on featuresof their BCR; and 3) the evolutionary conservation of BCRs bearingVH genes that encode binding sites that recognize bacteria thatthreaten the newborn.Thebasis for 2) and3) above could be the same.For example, human V3-23, mouse VH283 (a VH2 family gene), andshark VH genes share.80% sequence similarity at the protein level(7, 21) andencodeBCRs that are polyreactive and recognize bacterialpolysaccharides (22). In humans and mice, such Abs are often as-sociated with IgG3 (23, 24) and class switch that occurs in the ab-sence of environmental Ag (25, 26) and in CD40/CD40L-deficientmice (27). In swine, IgG3 expression accounts for.60% of the totalIgG expression in the ileal Peyer’s patches (IPP) of fetal piglets(28). The IPP of swine is the anatomical homolog of the IPP of sheep,in which Ab repertoire development is considered to be Ag-in-dependent (29). In both the human and mouse genome, IgG3 is themost Cd proximal functional Cg gene (reviewed in Refs. 30, 31).In contrast to rabbits, mice, and humans, fetal piglets present

a different patternof fetal/neonatal development that could affectVH

gene usages. In swine, there is no known protein transfer frommother to fetus including Igs (32–34). Because maternal Igs caninfluence fetal immune responses (35, 36) and presumably B cellselection and development, usage of certain VDJ rearrangements isindependent of this influence in fetal piglets. Although it is knownthat certain porcine viruses can cross the placenta, the mechanismremains unknown. In any case, our studies on VDJ usage in fetalpiglets were done in animals free of all detectable viral pathogens.Offspring of swine are precosial and routinely reared in isolatorsseparate from their mothers, allowing the experimenter to controlenvironmental factors that might influence the development ofadaptive immunity (37). In swine, VH, DH, and JH usage is highlyrestricted. In the expressed preimmune repertoire, four to seven VH

genes account for 75–95% of the repertoire (9, 38) (Table I). Al-though the mechanism is unknown, swine use only a single JH andtwo DH segments to generate their preimmune Ab repertoire (38–40). We believed these observations might be better understood bymapping the VH, DH, and JH loci of swine. We were especiallyinterested to know if the predominant use of a few VH genes in thepreimmune repertoire was confined to those at the 39 end of the VH

locus as reported in rabbit, mouse, and some human studies.We describe in this study the characterization of a 229-kb segment

of swine chromosome 7 containing the VH-DH-JH-Cm-Cd and 59 Cg

region of the H chain locus that includes 15 DH proximal VH genesand the 59 portion of the H chain constant (CH) genome. Our mapshows that swine possess only one functional JH gene segment, ap-parently two functional DH segments, and that preferential VH usagein primary B cell tissues of fetal animals cannot be explained asa stochastic process dependent on the location of VH genes in thelocus. In contrast, the dominant early expression of porcine IgG3 inlate-term fetuses in an organ believed to develop an Ag-independentrepertoire appears correlated with its position in the H chain C regionof the locus.

Materials and MethodsNomenclature

The porcine VH genes were originally named according to their order ofdiscovery and given vernacular names like VHA and VHB (Table I) (9).The intention was that once their location in the genome was known, thenomenclature would be changed to the familiar VH1, VH2, etc., system orthe ImMunoGeneTics (IMGT) system (IGHV1, IGHV2). In this report, wehave maintained the vernacular nomenclature in certain cases and used it inparenthesis in the text. Both the vernacular and IMGT system are used inTable II. Because the IMGT system contains an unfortunate redundancy(IGHD is used for both IgD and DH diversity segments), we have used theconventional Cm, Cd, and Cg for CH regions.

Screening of bacterial artificial chromosome clones andconstruction of bacterial artificial chromosome contigs

All bacterial artificial chromosome (BAC) clones were isolated froma genomic library constructed by using a Large White boar resulting fromintrafamilial matings at Institute Nationale Recherche Agronomique (Jouyen Josas, France) (42). BAC clones containing the porcine IGHV, IGHD,and IGHJ regions and 59 IGHC genes (Cm, Cd, Cg3, and Cg5) wereidentified by using a PCR-based screening system. Selected BAC cloneswere cultured overnight in Luria-Bertani broth containing 12.5 mMchloramphenicol. BAC clones 850A09 and 747A01 that hybridized withpolynucleotide probes specific for VH genes, JH, and Cm (Table I) wereselected for further study. DNA from relevant clones was extracted witha Qiagen Plasmid Midi Kit (Qiagen, Hilden, Germany).

Sequencing of BAC clones

BAC DNAs were extracted by using a Qiagen Large Construction Kit(Qiagen). TheDNAwere cleaved into 2- to 4-kb fragments by sonication andthen subcloned into the plasmid vector pUC118 (Takara, Otsu, Japan) at theHincII site to construct a shotgun library. The inserts obtained were se-quenced by an ABI 3730xl sequencer with a Big Dye Terminator version 3cycle sequencing kit (Applied Biosystems, Foster City, CA) using universalprimers annealing to vector sequences. Sequence data were processed withPhredbase caller and assembledwithPhrap (CodonCode,Dedham,MA) (43,44). Compiled sequences of the two BAC clones have been uploaded inGenBank (AB513624 and AB513625). Restriction enzyme digestion wasperformed to confirm the sequence assembly. BAC clones were digested

Table I. Probe sequences used to identify common porcine VH genes, JH, and Cm

VH Gene CDR1 CDR2

Probe Sequence for CDR1 Probe Sequence for CDR2

39 FR1 CDR1 59 F2 39 F2 CDR2

VHA A A CAGT AGTACCTACATTAAC T TGGCA GCTATTAGTACTAGTVHB B B GACAACGCTTTCAGC TGG GCCATTGCTAGTAGTGACVHG G E TTCAGT AGTTATAGCATGGAGC GGTATTGATAGTGGTAGTTAVHE E E TCAGT AGTTATGCAGTGAGC T GGTATTGATAGTGGTAGTTAVHF F F GT AGTTATGGCGTAGGC TGG TCTATTGGTAGTGGTAVHC C C GT AGTTATGAAATCAGC TG GGTATTTATAGTAGTGGTAGVHZ E C TCAGT AGTTATGCAGTGAGC T GGTATTTATAGTAGTGGTAGVHY C A GT AGTTATGAAATCAGC TG TGGCA GCTATTAGTACTAGTVHA* A A AGAGACAACTCCCAGAACACG FR3Pan CGCCAGGCTCCAGGGAAG FR2JH TGAGGACACGACGACTTCAA JHCm GCACATGCCGCTCGTGTA CH4

Columns labeled CDR1 and CDR2 list the vernacular designation used in the laboratory for the porcine VH genes (see also Table II). The upstream VHA (IGHV10) isdesignated as VHAp and requires a special probe that binds in the FR3 region for identification. Detection of VHN requires a combination of the probes described in Table I. Thismethod of recognition was confirmed by sequence analysis.

The Journal of Immunology 3735

by guest on June 17, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

with HindIII, PvuI, or FspI, and the fragment sizes were compared withthose predicted by a Genetyx sequence editor (Genetyx, Tokyo, Japan).

Thenumberof IGHVgenes contained in theBACcloneswas confirmedbyPCRmethodsusingeachBACcloneDNAasa template.EachIGHVgenewasamplified using a primer set annealing to sequences in 59 framework region(FR) 1 (59-GAGGAGAAGCTGGTGGAGT-39) and 39 FR3 (59-GCCGTG-TCTTCGGTTCTCA-39) that are common to all known porcine VH genesexcept VHB. To amplify the VHB, 59 FR1 (59-GAGGAGAAGCTGGTGG-AGT-39) and FR3R IGHVB (59-GCCGTGTCTTCGGTTCTGA-39) wereused. The products were cloned into the TOPO 2.1 vector (Invitrogen,Carlsbad, CA).More than 80 clones were selected at random from each PCRproduct for sequence analysis.

Analysis of mapping data

Sequence similarity was examined using the BLAST2 program (45) (www.ncbi.nlm.nih.gov/BLAST/bl2seq/wblast2.cgi), and interspersed repetitivesequences in the pig genomewere detected by using RepeatMasker (A. Smitand P. Green, unpublished observations; www.repeatmasker.org/) withRepbase (46) (www.girinst.org/repbase/index.html). Homologous regionsbetween genomic sequences were identified by using the PipMaker program(47). Sequence alignment and phylogenetic analysis were performed by theCLUSTALW (1.83) program (48). The detected IGHV genes were analyzedby the BLAST program with public nucleotide databases (DNA Data Bankof Japan, EMBL, and GenBank). Only sequences that showed .98%identity to previously identified porcine IGHV sequences were adopted.

Quantitation of VH gene usage in fetal liver and late-gestationbone marrow

DNA from fetal liver at 30 d of gestation (DG30) from four piglets eachfrom four unrelated gilts and RNA from the bone marrow of five fetuses atDG95 were used to recover VDJ rearrangement from DNA and cDNA,

respectively, as previously described (9, 39, 40). The VDJs recovered byPCR were cloned into pCRO4-TOPO (Invitrogen), and 632 clones fromfetal liver and 432 from bone marrow transcripts were then sequentiallyhybridized with polynucleotide probes specific for the CDR1 and CDR2regions of the most common porcine VH genes (9, 39) (Table I). Theseclones were also hybridized with a pan-specific FR2 probe to identify allclones with a plasmid containing a VDJ insert (Table I).

Statistical analysis

VH usage was complied in Excel spreadsheets (Microsoft, Redmond, WA)and displayed as proportional usage (mean and SD) in GraphPad Prism(GraphPad, San Diego, CA). Mean differences were compared by Student ttest routines embedded in the Prism program (GraphPad).

ResultsGenomic structure of the region containing porcine IGHD,IGHJ, and the 39 IGHV genes

WescreenedseveralBACclonescontainingIGHDandIGHJsegmentsbyPCRtoidentifyclones thatencompass the full locus.Clone851A09contained 118,088 bp with sequences from the IGHD3 segment toIGHV15. Clone747A01 overlapped 851A09 by ∼29.6 kbp and en-compassed IGHG2 through IGHV1P (Fig. 1). Together the twoclones represent 229,148 bp of genomic sequence. The two BACclones were subjected to shotgun sequencing as described in Mate-rials and Methods. The sequence overlap between 747A01 and851A09 was 100% homologous, indicating that they were derivedfrom the same allele. By analyzing open reading frames and usingBLASTagainstGenBank sequences,we identified15 IGHV,4 IGHD,

FIGURE 1. Genomic structure of the porcine Ig H chain region encompassing Cg5 to IGHV15. SP6 and T7 denote primer sites located in the vector that

flank the cloning site and assist in determining the orientation of the BAC clones. The putative coding sequence (CDS) and the switch region of IgM (Sm) are

indicated by black boxes and a gray oval, respectively. Genes in which exon 1 was collapsed or contained stop codon(s) in the V segment are regarded as

pseudogenes and are indicated by P. The enhancer region is indicated by awhite circle, the position of whichwas estimated in a previous study (49). Restriction

sites of HindIII, PvuI, and FspI are shown in the lower part of the figure. Numbers indicate the sizes of the BAC clone fragments generated by digestion with

each enzyme. Bars below the gene map indicate the region of gene duplication. Both the IMGT and vernacular nomenclatures for VH genes are given. The

familiar names of isotypes have been used because the IMGT does not distinguish between IGHD (IgD) and IGHD (diversity segment).

3736 VH USAGE AND GENOME ORGANIZATION

by guest on June 17, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

and5 IGHJgene segments aswell as the constant regions of IgM(Cm)and IgD (Cd) and the two most 59 IgG genes (Cg3 and Cg5) (Fig. 1,Tables II–IV). The sequence of the switch region andC region of IgMhad been reported previously (49); this sequence had a high level ofidentity to the sequence determined in this study, showing that thesesequences were derived from the same region in the locus.Previous studies showed that functionally rearranged VDJs used

only two IGHD segments and a single IGHJ segment (38, 40).Although only transcripts carrying IGHD1, IGHD2, and IGHJ5 arein the public databases, we identified four IGHD segments and fiveIGHJ segments. The porcine genomic locus carrying the IGHD andIGHJ genes was much shorter than its human counterpart (9 IGHJand 27 IGHD are detected in the corresponding region of the human

genome: NT_026437.11, 86930000 to 87630000). In the case of JH,

only reading frame III of IGHJ5 translates to the sequence of the

only expressed JH region of swine (38); IGHJ1, IGHJ2, and IGHJ4

have noncanonical heptamer sequences (Table IV). A sequence

encoded by IGHJ3 has yet to be found in a rearranged or expressed

VDJ, although its recombination signal sequence (RSS) seems

functional, and no stop codons are present.Analysis of the DH shows that IGHD1 (DHA) and IGHD2 (DHB)

have canonical RSSs, whereas both the heptamer and nonamer of

IGHD3 are noncanonical (Table III). The RSS of IGHD4 should

be functional, but if expressed, the tiny segment it encodes (3 aas)

could be easily overlooked in a region where TdT-dependent

nucleotide additions are common and exonucleases are active.The 15 IGHV genes found in the sequence had very homologous

sequences. Because of this, reads could be misassembled following

shotgun sequencing. Thus, we cloned the PCR fragments generated

from clones 851A09 and 747A01 using the primer commonly used to

amplify the pig IGHV segments. The fragments obtained from ge-

nomic DNAwere identical to VH genes previously reported for this

species (9, 40). This, along with our restriction analysis (Fig. 1), in-

dicates that the assembly process had been performed correctly.

Among the VH segments detected, exon 1 and a part of exon 2 were

collapsed in 4 of the 15 IGHV genes (IGHV3, IGHV7, IGHV9, and

IGHV13), suggesting they are pseudogenes. The IGHV gene located

on the 39-most side (IGHV1) had a stop codon in exon 2, indicating

that it was also a pseudogene, confirming a previous observation (40).

VHA and VHB were highly expressed in newborn piglets andwere duplicated in the porcine genome sequence

We found a large degree of duplication in the porcine genomic se-quencecarryingIGHV9PtoIGHV14with thatcontainingIGHV3PtoIGHV8 (Supplemental Fig. 1). Repetitive sequences interspersedaround IGHV4 to IGHV6 were also highly conserved with thosearound IGHV10 to IGHV12 (Fig. 2). We analyzed the duplicationevent in the IGHV region by using repetitive sequences. As shown inFig. 2B, the repetitive units include long interspersed nucleotide el-ement (LINE) sequences such as L1_Art and L1_BT. We used theexcised sequences of the respective LINEs (commonly conservedamong the sequences) to demonstrate that L1_Art and L1_BT arehighly conserved between the two repetitive IGHV units in com-parison with the others (Fig. 2C). The excised L1_BT sequencesderived from the two repetitive units [L1_BT (a) and L1_BT (c)](135 bp) were completely identical, which implied that the two re-petitive units were established recently.We estimated the divergencetime of the repetitive units by using L1_Art because the length ofconserved regionswasmuch longer (.800 bp) than that of L1_BT. Itrevealed that L1_Art (b) and L1_Art (d) in Fig. 2B were diverged

Table II. IgH genes identified from the genome sequence determined in this study

IMGT Vernaculara No. of Exons Start End CDS Length (bp) Comment

IGHV15 VHN 2 3032 3473 353IGHV14 VHY 2 9306 9747 353IGHV13P 1 12,154 12,366 213 Exon 1 and part of exon 2 were collapsedIGHV12 VHB* 2 15,678 16,126 359IGHV11 VHF 2 27,618 28,065 359IGHV10 VHA* 2 34,235 34,676 353IGHV9P 1 37,094 37,306 213 Exon 1 and part of exon 2 were collapsedIGHV8 VHE 2 42,141 42,589 359IGHV7P 1 45,002 45,214 213 Exon 1 and part of exon 2 were collapsedIGHV6 VHB 2 48,526 48,974 359IGHV5 VHT 2 60,198 60,645 359IGHV4 VHA 2 66,808 67,249 353IGHV3P 1 69,661 69,873 213 Exon 1 and part of exon 2 were collapsedIGHV2 VHG 2 76,020 76,470 359IGHV1P Psg 2 2 90,845 91,288 352 Stop codon in exon 2IGHD1 DHA 1 108,609 108,646 38IGHD2 DHB 1 109,219 109,246 28IGHD3 1 113,937 113,973 37IGHD4 1 131,317 131,327 11IGHJ1 1 132,104 132,157 54IGHJ2 1 132,277 132,329 53IGHJ3 1 132,587 132,634 48IGHJ4 1 132,979 133,029 51IGHJ5 JH5 1 133,523 133,576 54Smb 135,726 139,170 3445IGHM IgM (Cm) 4 139,705 141,406 1216IGHD IgD (Cd) 5 147,270 152,588 1060IGHG1 IgG3c (Cg3) 4 188,628 190,144 1001IGHG2 IgG5bd (Cg5) 4 209,664 211,155 974

aVH gene names were classified according to CDR1 and CDR2 sequence specificities (9). The vernacular terminology is based on order of discovery,whereas the IMGT system is based on the position in the genome as shown in Fig. 1.

bSwitch region for IgMcIgG nomenclature based on recent studies of Butler et al. (41).dIgG5b is an allele of IgG5 (41).Psg, pseudogenes discovered in genomic DNA prior to mapping studies (see Ref. 9).

The Journal of Immunology 3737

by guest on June 17, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

from each other ∼1.6 million y ago. This calculation is based on theestimated mutation rate in pseudogenes: 4.63 1029 (50).Evidence for recent duplication of the IGHV region is further

supported by the observation of conserved HindIII and PvuI re-

striction fragments in Fig. 1. This duplication unit contained theduplicated VHA and VHB genes, which, along with VHC and VHE,

comprise .75% of the preimmune repertoire in piglets (39). Theexon-intron structures of the detected VHA and VHB genes were

also conserved, perhaps a clue that these genes are important in

generating the Ab repertoire.

VH gene usage in primary lymphoid tissues at DG30 and DG95

Fig. 3 summarizes VH usage in VDJ rearrangement in 632 clonesfrom DG30 fetal liver and 432 cloned transcripts from DG95 bonemarrow. VH genes are ordered on the x-axis according to theirposition in the locus, 39 to 59 (Fig. 1, Table II). The results confirmearlier findings that IGHV4, IGHV6, IGHV10, and IGHV12dominate the early repertoire (∼30%) but also show that IGHV14(VHY) and IGHV15 (VHN) play an equally dominant role atDG30. Noteworthy is that the first functional VH gene IGHV2(VHG) (Fig. 1) is seldom used. Thus, early usage in a primarylymphoid tissue cannot be ascribed to the position of the VH genesin the locus. In older fetuses (i.e., DG95), usage of IGHV14 andIGHV15 nearly disappears, whereas VHC and both IGHV4 (VHA)and IGHV10 (VHA*) are significantly increased. VH usage atDG95 DNA rearrangements or transcripts from bone marrow, IPP,and spleen does not significantly differ (J. E. Butler, X. Z. Sun, N.Wertz, K. M. Lager, and G. Tobin, unpublished observations).These data reject the notion that VH usage during developmentfollows a continuous progression of VH usage from 39 to 59. Inboth DG30 liver and DG95 bone marrow, usage of unidentified VH

genes (UNK) does not change. Previous studies (9) indicate thatmany VDJ clones identified as UNK in conventionally rearedyoung pigs use the same common genes that account for 70% ofthe preimmune repertoire (Fig. 3) but have mutated CDRs so theyno longer hybridize with gene-specific probes (Table I). This lowfrequency of somatic hypermutation occurs in utero in the com-plete absence of environmental Ag stimulation, although there isno accumulation of mutations in CDR regions as is the case in Ag-stimulated piglets (S. Bratsch, N. Wertz, T. Kunz, and J.E. Butler,unpublished observations).As indicated above, Enh, Cm, and Cd map to the same region as

previously described (40, 51). Among the six Cg subclasses andeleven allotypes (41), Cg3 and Cg5 are the most Cd proximal Cregion genes.

DiscussionWe present the first partial map of the porcine H chain locus thatcovers the 59 portion of the CH region, JH region, DH region, and thefirst 15 of the most 39VH genes. These results confirm previous dataon Cm and Cd (51) and Sm and Cm (49). Data presented in this studyalso explain.15 y of observations that swine express only two DH

segments, IGHD1, formally called DHA, and IGHD2, formallycalled DHB (40). Our mapping data also explain why swine onlyexpress a single JH sequence (38). Evidence that only IGHJ5 (JH5) isfunctional has recently been confirmed in studies in which thissegment was mutated, resulting in B cell knockout piglets (M.Mendicino, J. Ramsoondar, C. Phelps, T. Vaught, S. Ball, T. LeR-oith, J.Moonahan, S. Chen, A. Dandro, J. Boone, P. Jobst, A. Vance,N. Wertz, Z. Bergman, X-Z Sun, I. Polejaeva, J. Butler, Y. Dai, D.Ayares, and K. Wells, personal communication). Collectively, themap and sequence data we provide for DH, JH, Sm, Cm, and Cd areconsistent with earlier partial mapping studies (49, 51) and explainwhy swine express only two DH segments and a single JH (38, 40).T

able

III.

IGHD

genes

detectedin

thisstudy

Gene

9-m

er12-m

er7-m

erReadingFrame

Sequence

andDeducedAminoAcidSequence

7-m

er12-m

er9-m

er

IGHD1

GGTTTGAGA

ACGGGCCTGTGG

CACTGTG

GAATTGCTATAGCTATGGTGCTAGTTGCTATGATGACC

CACAGCA

TCACAGCGCCCT

ACAAAAACC

IELL*LW

C*LL**

IIN

CY

SY

GA

SCY

DD

III

IA

IA

MV

LVA

MM

TTGACTATAGCGGTTGCTATAGCGGTTAC

CACAGTG

ACAGACCCGGTG

GCAAAAACC

I*L*R

LL*RL

IID

YSG

CY

SG

YIII

TIAVA

IAV

IGHD2

GCTTTTTGC

CAAGGCCTTTCC

CACTGTG

CGGCTGAGCGCACAGCCCTGAGGCCCCAGCTGGCTGG

CACAGTG

ACAGACCCGGTG

GCAAAAACC

IR

LSAQ

P*G

PSW

LII

G*A

HSPEA

PA

GW

III

AERTA

LRPQ

LA

IGHD3

CGGCCGACC

TGAAGCCTCCGT

GCCTGTG

CTCACCGGGAC

CACAGCA

GGGCCTTGGAAC

TGCAGAAAC

ILTG

IISPG

III

HRD

IGHD4

GCTTGGGC

CGAGCCAGGAAC

CACAGTG

CTCACCGGGAC

CACAGTG

ACTGACCAAACT

CCCGGCCAG

ILTG

IISPG

III

HRD

Canonical

heptamersandnonam

ersareunderlined.

*Stopcodon.

3738 VH USAGE AND GENOME ORGANIZATION

by guest on June 17, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

The partial map of the VH locus identified the same major VH

genes that our previous studies had identified (9, 39, 40) (Table II).When the location of particular genes in the locus (e.g., IGHV4,IGHV15, and IGHV2) is compared with their proportional usage,there is no positive correlation between position and usage (Fig. 3).This sharply differs from the situation in rabbits, in which the most39VHgene is used in∼90%of early rearrangements (18), or inmice,in which 7183 and Q52 dominate early VH usage (12, 13), andIGHV5 and IGHV6 are dominant in humans (17). In fact, IGHV2 isseldom used in swine at any time in development (Fig. 3) (J. E.Butler, X. Z. Sun, N.Wertz, L.M. Lager, andG. Tobin, unpublishedobservations). Our findings are more consistent with the studies bythe Milner group that selective usage is seen at all stages of de-velopment (20).The much higher level of control of factors that might influence

Ab repertoire development during fetal life in piglets argues thatthe pattern of VH usage that we observed is intrinsic and thereforemay differ from earlier studies in mouse and human fetuses. Themapping studies provided in this paper eliminate gene position asan explanation for VH, DH, and JH expression. Although it isa mistake to extrapolate data from one mammal to another, ourfindings and the controversy in the literature make us skeptical ofany arguments that VH usage in early development is exclusivelypositionally dependent. The studies of Pospisil et al. (33) usingthe Alicia rabbit would support our skepticism.Our study does offer several insights that may be related. First is

the evidence for recent duplication within the porcine VH locus.IGHV4 (VHA) and IGHV10 (VHA*) share identical CDR1 andCDR2 regions (Table I) and differ only in one nucleotide in FR3.The latter difference allowed us to prepare a probe that coulddistinguish the expression of these two genes by probe hybrid-ization (Fig. 3, Table I). Likewise, IGHV6 (VHB) and IGHV12(VHBp) differ by only one nucleotide in CDR1. For this reason,gene-specific probes for VHB do not distinguish between IGHV6and IGHV12 so that usage of both is included in VHB usage (Fig.3). Other similarities suggest that IGHV9P to IGHV14 andIGHV3P to IGHV8 (Fig. 1) may be recent duplicons. Similar du-plicons have been reported in the human VH genome (52). Thus,whatever factors control VH usage would be likely to affect all ofthe genes in each of these duplicon cassettes. Although overall VH

usage is not positional, proportional usage for VH genes withineach cassette may be the case (e.g., IGHV3P to IGHV8 in the firstcassette and IGHV9P to IGHV14 in the second cassette).Swine genetics, especially the fine genetics of lymphocyte

receptors, are still in infancy compared with mouse genetics. Mostof the nearly 30 VH genes described for swine were mostly re-covered from outbred farm pigs so that the number very likelycontains numerous alleles (9). The BAC library used in this studywas made from the Large White breed that was interbred at In-stitute Nationale Recherche Agronomique, whereas the data pre-sented in Fig. 3 were derived from United States animals, largelyLandrace, Yorkshires, and their crosses that are preferred overinbred animals for fecundity, health, and absence of viral disease,all of which are also important criteria for their use in fetal andneonatal isolator studies. We know from studies on Ig genetics thateven randomly inbred swine can be homozygous in the IGHC locus(53). This backgroundmight therefore explain one of two troublingobservations made in this study. The first concerns our failure tolocalize VHC within the region of the VH locus that was mapped,despite its prominent expression (Fig. 3) (9, 39, 40). IGHV14(VHY) (Fig. 1, Table II) shares CDR1 with VHC and CDR2 withIGHV4 (VHA) and IGHV10 (VHA*); all porcine VH genes haveessentially identical framework sequences. It is altogether possiblethat IGHV14 (VHY) and VHC are alleles and the BAC library cameT

able

IV.

IGHJgenes

detectedin

thisstudy

Gene

9-m

er23-m

er7-m

erIG

HJ(bp)

ReadingFrame

Sequence

andDeducedAminoAcidSequence

IGHJ1

GGTTCTGTG

TGCCAGGGCCTGGGTGGGCACAT

TGGTGTG

54

GCCATGGCTACTTAGATTCGTGGGGCCAGGGCATCCTGGTCACCGTCTCCTCAG

IA

MAT*IR

GA

RA

SW

SPSPQ

IIPW

LLR

FV

GPG

HPG

HR

LL

III

HG

YLD

SW

GQ

GILV

TV

SS

IGHJ2

GTGTATTTG

TCAAGGAGGGGCAACAGGGTGCA

GACTGTG

53

CCCCTGGAAACTTGACCACTGGGGCAGGGGCGTCCTGGTCACCGTCTCCTCAG

IPLET*PLG

QG

RPG

HR

LL

IIPW

KLD

HW

GR

GV

LV

TV

SS

III

PG

NLTTG

AG

ASW

SPSPQ

IGHJ3

GGTTTTTGGa

ACACCCCCTAATGGGGGCCACAG

CACTGTGa

48

ACCATCTTCACAGCTGGGGCCGAGGAGTCGAGGTCACCGTCTCCTCAG

ITIFTA

GA

EESR

SPSPQ

IIPSSQ

LG

PR

SR

GH

RLL

III

HLH

SW

GR

GV

EV

TV

SS

IGHJ4

CTTTCTTAAa

CTGGGATCCGGGCTTAGTTGTCG

CAATGTG

51

ACAACGGGCTCGAAAGCTGGGGCCAGGGGACCCTAGTCTACGACGCCTCGG

ITTG

SK

AG

AR

GP*STTPR

IIQ

RA

RK

LG

PG

DPSLRRL

III

NG

LESW

GQ

GTLV

YD

AS

IGHJ5

AGGTTTTTGa

TGGGGCGAGCCTGGAGATTGCAC

CACTGTGa

54

ATTACTATGCTATGGATCTCTGGGGCCCAGGCGTTGAAGTCGTCGTGTCCTCAG

IITM

LW

ISG

AQ

ALK

SSC

PQ

IILLCY

GSLG

PRR*SRRV

L

III

YYA

MD

LW

GPG

VEV

VV

SS

Boldface

textindicates

only

expressed

Jregion.

aCanonical

heptamersandnonam

ers.

pStopcodon.

The Journal of Immunology 3739

by guest on June 17, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

A

B

C

FIGURE 2. A, Phylogenetic tree of porcine IGHV genes detected in this study. Human b2-microglobulin (huB2M: NM_004048.2) was used as an

unrelated reference. Exon 2 sequences (or sequences corresponding to exon 2 of functional IGHV segments) were used for the alignment. Because all

porcine VH genes belong to the VH3 family of clan III, we designated the various subgroups as VH3-1, -2, and -3, respectively. Bootstrap values for 1000

replicates are indicated beside the branches. B, Genomic structure in the vicinity of the region coding IGHV. Repetitive sequences such as LINE/L1 and

PRE1 are indicated by black boxes. IGHV genes are indicated by white boxes. Areas surrounded by dashed lines are highly conserved regions. C,

Phylogenetic tree estimating the divergence of the two major duplicons within the mapped locus. Line, long interspersed nucleotide element; Pre, porcine

repeat element family belonging to short interspersed nucleotide elements.

3740 VH USAGE AND GENOME ORGANIZATION

by guest on June 17, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

from a swine homozygous for IGHV14. The second observationconcerns IGHV5 (VHT) that is expressed in low frequency in out-bred North American swine (9). However, based on its position inthe first duplicon (Fig. 1), high expression might be expected.IGHV5 (VHT) shares CDR1 with IGHV8 (VHE) and CDR2 withIGHV11 (VHF), respectively. Because all three (IGHV5, IGHV8,and IGHV11) map to separate loci, IGHV5 cannot be an allele ofeither IGHV8 or IGHV11. Recent progress with the porcine ge-nome project might resolve these issues.Although the gene mapping studies we present can explain the

expression of only two DH segments and one JH, they fail to ex-plain the basis of selection for VH gene usage and expression.Clearly, it is not position in the locus. At DG30 in liver, there isvery little transcription and no BCR expression as determined byflow cytometry and immunohistochemistry (54). Because this isnot true at DG95, the changes in VH usage in fetal BCRs at DG95could be due to selection by intrinsic ligands for B cells that usecertain VH genes to form their BCRs.Theories to explain positive selection of B cells expressing

certain surface receptors date to the pre-B selection hypothesis ofMelchers (55) and the work of Pospisil et al. (56). The latterstudies used Alicia rabbits that carry a deficient VH1. These rab-bits show increased expression of a VH1-like gene that was gen-erated by gene conversion following gut colonization. Asindicated above, the authentic VH1 gene is normally used in.90% of rearrangements in newborn rabbits (18). These ob-servations by Melchers (55) and the Pospisil team (56) can beinterpreted to mean that B cells at certain stages of developmentdisplay BCRs that are recognized by stromal receptors that pro-mote their survival and proliferation.The dominant role of CDR3 in determining Ab specificity is well

acceptedandwasexperimentallyshowninstudiesbyPadlan(57)andXu and Davis (58). The latter group showed that mice with a singleVH gene could make Abs to nearly all of the same Ags as controllittermates with a full germline VH repertoire as long as the DH andJH region was intact. Because of limited VH, DH, and JH usage inswine, we estimated that .95% of the repertoire is determined byCDR3 (59). In the case of TCR,CDR1andCDR2 are purported to bemainly responsible for MHC recognition, whereas CDR3 is re-sponsible for peptide (Ag) recognition. Because TCR and BCR arestructural and genetic homologs, what is true for the goose may alsobe true for the gander. Perhaps VH usage by surviving B cells in

swine is a result of their recognition by certain stromal receptors thatrecognize epitopes expressed in FRs due to the conformation im-posed by theVHgenes theyuse. Perhaps this also explains the data ofPospisil et al. (56) in rabbits with a mutated VH1 gens.Finally, our data reveal that porcine IgG3, regarded as the an-

cestral IgG of swine (41) and which comprise 60% of all IgG ex-pression in the fetal IPP (25), is most 39 proximal to Cd. Becausespeciation preceded subclass diversification, IgG3 in swine, human,and mouse are not homologous genes (1, 41). Coincidentally, theCg gene called IgG3 in all three species is the most 59 Cg gene andappears to be involved in early natural Ab responses to bacteriasuch as those expressed by marginal zone B cells. In swine, thedominant expression of IgG3 in the fetal IPP of piglets would beconsistent with this concept because the IPP is considered the site ofAg-independent repertoire development (29).Our data argue that there is a practical reason to understand how

the IgH locus is organized and how the Ab repertoire is developed,and, in this case, to expose the Achilles’ heel of a species thatsupplies 60% of the world’s meat supply. Although a mutation ofVH1 in the Alicia still allows rabbits a second chance, probably bygene conversion, a mutation of JH5 in pigs destroys the entire Absystem of this species, as has been experimentally demonstrated(M. Mendicino et al., personal communication). Thus, JH5 of swinerepresents a deleterious genetic target of spontaneous or designedmutation.

DisclosuresThe authors have no financial conflicts of interest.

References1. Butler, J. E. 2006. Preface: why I agreed to do this.Dev. Comp. Immunol. 30: 1–17.2. Schroeder, H. W., Jr. 2006. Similarity and divergence in the development and

expression of the mouse and human antibody repertoires. Dev. Comp. Immunol.30: 119–135.

3. Das, S., M. Nozawa, J. Klein, and M. Nei. 2008. Evolutionary dynamics of theimmunoglobulin heavy chain variable region genes in vertebrates. Immunoge-netics 60: 47–55.

4. Lefranc, M.-P., and G. Lefranc. 2001. The Immunoglobulin Facts Book. Aca-demic Press, New York.

5. Brodeur, P. H., and R. Riblet. 1984. The immunoglobulin heavy chain variableregion (Igh-V) locus in the mouse. I. One hundred Igh-V genes comprise sevenfamilies of homologous genes. Eur. J. Immunol. 14: 922–930.

6. Schroeder, H. W., Jr., J. L. Hillson, and R. M. Perlmutter. 1990. Structure andevolution of mammalian VH families. Int. Immunol. 2: 41–50.

7. Marchalonis, J. J., M. K. Adelman, S. F. Schluter, and P. A. Ramsland. 2006. Theantibody repertoire in evolution: chance, selection, and continuity. Dev. Comp.Immunol. 30: 223–247.

8. Sun, J., I. Kacskovics, W. R. Brown, and J. E. Butler. 1994. Expressed swine VH

genes belong to a small VH gene family homologous to human VHIII. J. Im-munol. 153: 5618–5627.

9. Butler, J. E., P. Weber, and N. Wertz. 2006. Antibody repertoire development infetal and neonatal piglets. XIII. Hybrid VH genes and the preimmune repertoirerevisited. J. Immunol. 177: 5459–5470.

10. Meselson, M. S., and C. M. Radding. 1975. A general model for genetic re-combination. Proc. Natl. Acad. Sci. USA 72: 358–361.

11. Szostak, J. W., T. L. Orr-Weaver, R. J. Rothstein, and F. W. Stahl. 1983. Thedouble-strand-break repair model for recombination. Cell 33: 25–35.

12. Yancopoulos, G. D., S. V. Desiderio, M. Paskind, J. F. Kearney, D. Baltimore,and F. W. Alt. 1984. Preferential utilization of the most JH-proximal VH genesegments in pre-B-cell lines. Nature 311: 727–733.

13. Perlmutter, R. M., J. F. Kearney, S. P. Chang, and L. E. Hood. 1985. De-velopmentally controlled expression of immunoglobulin VH genes. Science 227:1597–1601.

14. Malynn, B. A., G. D. Yancopoulos, J. E. Barth, C. A. Bona, and F. W. Alt. 1990.Biased expression of JH-proximal VH genes occurs in the newly generatedrepertoire of neonatal and adult mice. J. Exp. Med. 171: 843–859.

15. Freitas, A. A., A.-C. Viale, A. Sundblad, C. Heusser, and A. A. Coutinho. 1991.Normal serum immunoglobulins participate in the selection of peripheral B-cellrepertoires. Proc. Natl. Acad. Sci. USA 88: 5640–5644.

16. Varade, W. S., E. Marin, A. M. Kittelberger, and R. A. Insel. 1993. Use of themost JH-proximal human Ig H chain V region gene, VH6, in the expressedimmune repertoire. J. Immunol. 150: 4985–4995.

17. Cuisinier, A. M., V. Guigou, L. Boubli, M. Fougereau, and C. Tonnelle. 1989.Preferential expression of VH5 and VH6 immunoglobulin genes in early humanB-cell ontogeny. Scand. J. Immunol. 30: 493–497.

FIGURE 3. Proportional usage of major porcine VH genes in VDJ re-

arrangement in fetal liver DNA at DG30 and in cDNA from bone marrow

at DG95. The x-axis provides both the vernacular names of the VH genes

and the position in the locus as defined in Fig. 1 (see Table II). Significant

differences between proportional usage at DG30 and DG95 are indicated

together with p values. Data are based on 632 cloned VDJs from fetal

spleen DNA and 432 from DG95 bone marrow RNA. IGHV6 (VHB) and

IGHV12 (VHB*) cannot be distinguished by hybridization using the gene-

specific probes shown in Table I.

The Journal of Immunology 3741

by guest on June 17, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

18. Knight, K. L., and R. S. Becker. 1990. Molecular basis of the allelic inheritanceof rabbit immunoglobulin VH allotypes: implications for the generation of an-tibody diversity. Cell 60: 963–970.

19. Becker, R. S., and K. L. Knight. 1990. Somatic diversification of immuno-globulin heavy chain VDJ genes: evidence for somatic gene conversion in rab-bits. Cell 63: 987–997.

20. Kraj, P., S. P. Rao, A. M. Glas, R. R. Hardy, E. C. Milner, and L. E. Silberstein.1997. The human heavy chain Ig V region gene repertoire is biased at all stagesof B cell ontogeny, including early pre-B cells. J. Immunol. 158: 5824–5832.

21. Ollo, R., J.-L. Sikorav, and F. Rougeon. 1983. Structural relationships amongmouse and human immunoglobulin VH genes in the subgroup III. Nucleic AcidsRes. 11: 7887–7897.

22. Adderson, E. E., P. G. Shackelford, A. Quinn, and W. L. Carroll. 1991. Re-stricted Ig H chain V gene usage in the human antibody response to Haemo-philus influenzae type b capsular polysaccharide. J. Immunol. 147: 1667–1674.

23. Fulton, R. J., M. H. Nahm, and J. M. Davie. 1983. Monoclonal antibodies tostreptococcal group A carbohydrate. II. The VK1GAC light chain is preferen-tially associated with serum IgG3. J. Immunol. 131: 1326–1331.

24. Oliver, A. M., F. Martin, G. L. Gartland, R. H. Carter, and J. F. Kearney. 1997.Marginal zone B cells exhibit unique activation, proliferative and immuno-globulin secretory responses. Eur. J. Immunol. 27: 2366–2374.

25. Milili, M., M. Fougereau, P. Guglielmi, and C. Schiff. 1991. Early occurrence ofimmunoglobulin isotype switching in human fetal liver. Mol. Immunol. 28: 753–761.

26. Fagarasan, S., and T. Honjo. 2000. T-independent immune responses: new as-pects of B cell biology. Science 290: 89–92.

27. Manis, J. P., M. Tian, and F. W. Alt. 2002. Mechanism and control of class-switch recombination. Trends Immunol. 23: 31–39.

28. Butler, J. E., and N. Wertz. 2006. Antibody repertoire development in fetal andneonatal piglets. XVII. IgG subclass transcription revisited with emphasis onnew IgG3. J. Immunol. 177: 5480–5489.

29. Reynaud, C. A., C. Garcia, W. R. Hein, and J. C. Weill. 1995. Hypermutationgenerating the sheep immunoglobulin repertoire is an antigen-independentprocess. Cell 80: 115–125.

30. Zhang, J., F. W. Alt, and T. Honjo. 1995. Regulation of class switch re-combination of the immunoglobulin heavy chain genes. In ImmunoglobulinGenes. T. Honjo, and F. W. Alt, eds. Academic Press, New York. p. 235–265.

31. Honjo, T., and F. Matsuda. 1995. Immunoglobulin heavy chain locus of mouseand humans. In Immunoglobulin Genes. T. Honjo, and F. W. Alt, eds. AcademicPress, New York. p. 145–171.

32. Brambell, F. W. R. 1970. The Transmission of Passive Immunity from Mother toYoung. North-Holland Publishers, Amsterdam.

33. Butler, J. E. 1974. Immunoglobulins of the mammary secretions. In Lactation, AComprehensive Treatise, Vol. III. B. L. Larson, and V. Smith, eds. AcademicPress, New York, p. 217–255.

34. Butler, J. E. 1998. Immunoglobulins and immune cells in animal milks. InMucosal Immunology, P. L. Ogra, J. Mestecky, M. E. Lamm, W. Strober, J. R.McGhee, and J. Bienenstock, eds. Academic Press, New York, p. 1531–1554.

35. Yamaguchi, N., S. Shimizu, A. Hara, and T. Saito. 1983. The effect of maternalantigenic stimulation upon the active immune responsiveness of their offspring.Immunology 50: 229–238.

36. Wikler, M., C. Demeur, G. Dewasme, and J. Urbain. 1980. Immunoregulatoryrole of maternal idiotypes. Ontogeny of immune networks. J. Exp. Med. 152:1024–1035.

37. Butler, J. E., and M. Sinkora. 2007. The isolator piglet: a model for studying thedevelopment of adaptive immunity. Immunol. Res. 39: 33–51.

38. Butler, J. E., J. Sun, and P. Navarro. 1996. The swine Ig heavy chain locus hasa single JH and no identifiable IgD. Int. Immunol. 8: 1897–1904.

39. Sun, J., C. Hayward, R. Shinde, R. Christenson, S. P. Ford, and J. E. Butler. 1998.Antibody repertoire development in fetal and neonatal piglets. I. Four VH genesaccount for 80 percent of VH usage during 84 days of fetal life. J. Immunol. 161:5070–5078.

40. Sun, J., and J. E. Butler. 1996. Molecular characteristics of VDJ transcripts froma newborn piglet. Immunology 88: 331–339.

41. Butler, J. E., N. Wertz, N. Deschacht, and I. Kacskovics. 2009. Porcine IgG:structure, genetics, and evolution. Immunogenetics 61: 209–230.

42. Rogel-Galliard, C., N. Bourgeaux, A. Billault, M. Vaiman, and P. Chardon. 1999.Construction of a swine BAC library: application to the characterization andmapping of porcine type C endoviral elements. Cytogenet. Cell Genet. 85: 205–211.

43. Ewing, B., and P. Green. 1998. Base-calling of automated sequencer traces usingphred. II. Error probabilities. Genome Res. 8: 186–194.

44. Ewing, B., L. Hillier, M. C. Wendl, and P. Green. 1998. Base-calling of auto-mated sequencer traces using phred. I. Accuracy assessment. Genome Res. 8:175–185.

45. Tatusova, T. A., and T. L. Madden. 1999. BLAST 2 Sequences, a new tool forcomparing protein and nucleotide sequences.FEMSMicrobiol. Lett. 174: 247–250.

46. Jurka, J. 2000. Repbase update: a database and an electronic journal of repetitiveelements. Trends Genet. 16: 418–420.

47. Schwartz, S., Z. Zhang, K. A. Frazer, A. Smit, C. Riemer, J. Bouck, R. Gibbs,R. Hardison, and W. Miller. 2000. PipMaker—a web server for aligning twogenomic DNA sequences. Genome Res. 10: 577–586.

48. Thompson, J.D., T. J.Gibson, F. Plewniak, F. Jeanmougin, andD.G.Higgins. 1997.The CLUSTAL_X windows interface: flexible strategies for multiple sequencealignment aided by quality analysis tools. Nucleic Acids Res. 25: 4876–4882.

49. Sun, J., and J. E. Butler. 1997. Sequence analysis of pig switch m, C m, and C mm. Immunogenetics 46: 452–460.

50. Li, W. H., T. Gojobori, and M. Nei. 1981. Pseudogenes as a paradigm of neutralevolution. Nature 292: 237–239.

51. Zhao, Y., Q. Pan-Hammarstrom, I. Kacskovics, and L. Hammarstrom. 2003. Theporcine Ig delta gene: unique chimeric splicing of the first constant region do-main in its heavy chain transcripts. J. Immunol. 171: 1312–1318.

52. Sasso, E. H., K. Willems van Dijk, A. Bull, S. M. van der Maarel, and E. C.B. Milner. 1992. VH genes in tandem array comprise a repeated germline motif.J. Immunol. 149: 1230–1236.

53. Navarro, P., R. K. Christenson, G. Ekhardt, B. Bosworth, J. K. Lunney,M. Rothschild, J. Lemke, and J. E. Butler. 2000. Genetic differences in thefrequency of the hinge variants of porcine IgA is breed dependent. Vet. Immunol.Immunopathol. 73: 287–295.

54. Sinkora, M., and J. E. Butler. 2009. The ontogeny of the porcine immune system.Dev. Comp. Immunol. 33: 273–283.

55. Melchers, F. 1995. The role of B cell and pre-B cell receptors in developmentand growth control of the B-lymphocyte cell lineage. In Immunoglobulin Genes.T. Honjo, and F. W. Alt, eds. Academic Press, New York, p. 33–56.

56. Pospisil, R., G. O. Young-Cooper, and R. G. Mage. 1995. Preferential expansionand survival of B lymphocytes based on VH framework 1 and framework 3expression: “positive” selection in appendix of normal and VH-mutant rabbits.Proc. Natl. Acad. Sci. USA 92: 6961–6965.

57. Padlan, E. A. 1994. Anatomy of the antibody molecule. Mol. Immunol. 31: 169–217.

58. Xu, J. L., and M. M. Davis. 2000. Diversity in the CDR3 region of V(H) issufficient for most antibody specificities. Immunity 13: 37–45.

59. Butler, J. E., P. Weber, M. Sinkora, J. Sun, S. J. Ford, and R. Christenson. 2000.Antibody repertoire development in fetal and neonatal piglets. II. Character-ization of heavy chain complimentarity-determining region 3 diversity in thedeveloping fetus. J. Immunol. 165: 6999–7011.

3742 VH USAGE AND GENOME ORGANIZATION

by guest on June 17, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

Corrections

Eguchi-Ogawa, T., N. Wertz, X.-Z. Sun, F. Puimi, H. Uenishi, K. Wells, P. Chardon, G. J. Tobin, and J. E. Butler. 2010. Antibody repertoiredevelopment in fetal and neonatal piglets. XI. The relationship of variable heavy chain gene usage and the genomic organization of thevariable heavy chain locus. J. Immunol. 184: 3734–3742.

The fourth author’s name was published incorrectly. The correct spelling is Francois Piumi.

www.jimmunol.org/cgi/doi/10.4049/jimmunol.1290085

Copyright � 2013 by The American Association of Immunologists, Inc. 0022-1767/13/$16.00

The Journal of Immunology