antiviral activity of salmonid gamma interferon against...

JOURNAL OF VIROLOGY, Sept. 2011, p. 9188–9198 Vol. 85, No. 170022-538X/11/$12.00 doi:10.1128/JVI.00319-11Copyright © 2011, American Society for Microbiology. All Rights Reserved.

Antiviral Activity of Salmonid Gamma Interferon against InfectiousPancreatic Necrosis Virus and Salmonid Alphavirus and Its

Dependency on Type I Interferon�

Baojian Sun,1 Ingrid Skjæveland,1 Tina Svingerud,1 Jun Zou,2Jorunn Jørgensen,1 and Børre Robertsen1*

Norwegian College of Fishery Science, University of Tromsø, Tromsø, Norway,1 and Scottish Fish Immunology Research Center,School of Biological Sciences, University of Aberdeen, Aberdeen, United Kingdom2

Received 16 February 2011/Accepted 6 June 2011

We investigated the antiviral activity and gene induction properties of interferon gamma (IFN-�) comparedto type I IFN (IFNa1) in Atlantic salmon. IFN-� protected salmon cells against infectious pancreatic necrosisvirus (IPNV)-induced cytopathic effect (CPE), reduced virus titers, and inhibited the synthesis of the viralstructural protein VP3. Moreover, IFN-� showed potent antiviral activity against salmonid alphavirus 3(SAV3) measured as a reduction in virus nsP1 transcripts. IFN-� (a type II IFN) had less specific antiviralactivity against IPNV than IFNa1, showing a half-maximal effective concentration of 1.6 ng/ml versus 31 pg/mldetermined in the CPE reduction assay. Compared to IFNa1, IFN-� was a more effective inducer of theantiviral protein GBP, several interferon regulatory transcription factors (IRFs), and the chemokine IP-10.The antiviral activity of IFN-� may also in part be ascribed to upregulation of Mx, ISG15, and viperin. Theseare typical type I IFN-induced genes in mammals and were also more strongly induced by IFNa1 than by IFN-�in salmon cells. Fish and mammalian IFN-� thus show strikingly similar gene induction properties. Interest-ingly, the antiviral activity of IFN-� against IPNV and SAV3 and its ability to induce Mx and ISG15 markedlydecreased in the presence of neutralizing antiserum against IFNa1. In contrast, antiIFNa1 had no effect on theinduction of IRF-1 and IP-10 by IFN-�. This suggests that the antiviral activity of IFN-� is partially dependenton IFNa induction. However, because antiIFNa1 could not abolish the IFN-�-mediated induction of Mx andISG15 completely, IFN-� may possibly also induce such genes directly.

Interferons (IFNs) were originally identified as proteins thatinduce an antiviral state in cells, but they also have importantregulatory functions in the immune system (51). Type I IFN(predominantly IFN-� and IFN-�) and type II IFN (IFN-�)play critical roles in innate and adaptive immune responseagainst viral infection in mammals (30, 32). IFN-�/� are pro-duced by most cells upon virus infection. In contrast, IFN-� isproduced primarily by natural killer (NK) cells during innateresponses, and by CD4� T helper 1 (Th1) cells and CD8�

cytotoxic T cells during adaptive immune responses (44).IFN-� is regarded as the typical Th1 cytokine because it directsdifferentiation of naive CD4� cells toward a Th1 phenotypeand is a major product of Th1 cells (45).

IFN-�/� and IFN-� bind to distinct receptors, which mediatesignaling through distinct, but overlapping JAK-STAT path-ways resulting in transcriptional activation of IFN-stimulatedgenes (ISGs) (51). The major transcription factor formedafter IFN-�/� stimulation is ISGF3, which is a hetero-trimercomposed of phosphorylated STAT1 and STAT2, and inter-feron regulatory factor 9 (IRF-9) (36). ISGF3 binds to theIFN-stimulated response element (ISRE), a promoter ele-ment found in IFN-stimulated genes such as Mx and ISG15(18). In contrast, the transcription factor formed after IFN-�stimulation is a STAT1 homodimer, which activates ISGs con-

taining gamma activation site promoter elements found in gua-nylate-binding protein (GBP) and IRF-1 (9).

The IFN systems in fish and mammals are similar but do alsodisplay important differences. Most striking is the difference intype I IFN, which during evolution appeared first in fish asintron-containing genes but was apparently reintroduced intothe genomes of amniotes by a retrotransposition event anddeveloped into a new multigene family lacking introns (26).The Atlantic salmon genome contains a cluster of at least 11type I IFN genes encoding three subtypes of IFNs named IFNa,IFNb, and IFNc (54). IFNa is the predominant IFN produced bymost cells and induces Mx and ISG15 and antiviral activity againstinfectious pancreatic necrosis virus (IPNV) (3, 24, 39, 42).

IFN-� has been identified from several fish species, includ-ing rainbow trout and Atlantic salmon (19, 28, 38, 53, 61, 62).In contrast to the type I IFNs, fish and mammalian IFN-� aresimilar in exon/intron structure and display gene synteny. How-ever, some fish species also possess a second IFN-� subtypenamed IFN gamma rel, which is quite different from the clas-sical IFN-� (14). Rainbow trout and carp IFN-� have severalfunctional properties in common with mammalian IFN-� in-cluding the ability to enhance respiratory burst activity, nitricoxide production, and phagocytosis of bacteria in macrophages(2, 14, 61). Moreover, like mammalian IFN-�, trout IFN-�induces the expression of IFN-� inducible protein 10 (IP-10),major histocompatibility complex class II �-chain, and STAT1and signals through STAT1 (50, 61).

Far less is known about the antiviral properties of fishIFN-�, although similar to mammals, IFN-� was shown to

* Corresponding author. Mailing address: Norwegian College ofFishery Science, University of Tromsø, 9037 Tromsø, Norway. Phone:47 77644487. Fax: 47 77646020. E-mail: [email protected].

� Published ahead of print on 22 June 2011.

9188

on July 6, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

http://jvi.asm.org/

induce the antiviral gene GBP in trout (41). In the presentstudy we have studied the antiviral activity of IFN-� againstIPNV and salmonid alphaviruses (SAV), both of which causehigh losses in Norwegian aquaculture of Atlantic salmon.IPNV is a naked double-stranded RNA virus, which belongs tothe Birnaviridae family and is closely related to infectious bur-sal disease virus, which is a major problem in chicken farming(34). IPNV kills salmon fry in freshwater and smolts shortlyafter release into seawater (46). SAV are enveloped positive-sense single-stranded RNA viruses, which are pathogens ofsalmonids. At present, SAV encompass six subtypes, of whichSAV3 is the cause of pancreas disease of Atlantic salmon inNorwegian seawater farms (22). SAV belong to the genusAlphavirus within the family Togaviridae and are phylogeneti-cally related to arthropod-borne alphavirus groups such as theSemliki Forest virus group and the Sindbis virus group (35).

We show here that IFN-� induces antiviral activity againstboth IPNV and SAV3 in salmon. This is in contrast to a recentreport, which stated that salmon IFN-� had no ability to inhibitreplication of SAV3 (57). Gene induction studies demon-strated that IFN-� is a less potent inducer of the typical anti-viral genes Mx, ISG15, viperin, and PKR compared to IFNa1but is a more effective inducer of GBP and several IRFs thanIFNa1. Interestingly, the antiviral activity of IFN-� againstIPNV and its ability to induce Mx and ISG15 was found to bepartially mediated by the induction of IFNa.

MATERIALS AND METHODS

Cells. Atlantic salmon TO cells were kindly provided by Heidrun Wergeland,University of Bergen (56). TO and Chinook salmon embryo cells (CHSE-214)were maintained at 20°C and 5% CO2 in Eagle minimal essential medium(EMEM; Invitrogen Life Technologies) supplemented with 100 �g of strepto-mycin/ml, 100 U of penicillin, 4 mM L-glutamine, and 5 or 8% fetal bovine serum,respectively. Atlantic salmon ASK-2 cells (11) were kindly provided by BirgitDannevig, Norwegian Veterinary Institute, and were maintained in L-15 medium(Invitrogen) supplemented with 100 �g of streptomycin/ml, 100 U of penicillin,and MEM nonessential amino acids with 5% FBS at 16°C.

IFNs. Recombinant Atlantic salmon IFNa1 and rainbow trout IFN-� wereproduced by modification of a protocol described previously (61). Briefly, thecoding sequences of the mature salmon IFNa1 (39) and rainbow trout IFN-� (61)were synthesized in the bacterial genetic code by GenScript USA, Inc. Thesequences were amplified by PCR using primers with BamHI and HindIII cuttingsites (Table 1). The PCR conditions were 94°C for 2 min and then 30 cycles of94°C for 30 s, 69°C for 30 s, and 72°C for 45 s, followed by 72°C for 7 min. ThePCR products were separated on a 1.2% agarose gel, purified using a Qiagen gelextraction kit (Qiagen), and digested with restriction enzymes BamHI andHindIII. The digested fragments were ligated into the pQE30 expression vector(Qiagen) and transformed into Escherichia coli M15 cells (Qiagen). To get themaximum soluble proteins, 0.2 mM IPTG (isopropyl-�-D-thiogalactopyranoside)was used in the induction, and the temperature for the induction stage waslowered to 28°C. The bacteria were harvested and sonicated on ice in lysis buffer(50 mM NaH2PO4, 300 mM NaCl, 10% glycerol [pH 8.0]), and the recombinantproteins were purified using the Ni-NTA resin column (Qiagen) with TritonX-114 in the first phase of washing. The purity of the recombinant IFNs waschecked on a 4 to 12% precast SDS-PAGE gel (Invitrogen Life Technologies)stained with SimpleBlue (Invitrogen). Protein concentrations were measuredwith a QuickStart Bradford protein assay kit (Bio-Rad) with bovine serumalbumin as a standard.

Viruses. IPNV serotype Sp N1 (7) was propagated in TO and CHSE-214 cells.Virus was harvested from the medium and titrated in CHSE-214 cells using the50% tissue culture infective dose (TCID50) method (37). SAV3 was obtainedfrom Birgit Dannevig at Norwegian Veterinary Institute, Oslo, Norway. SAV3was propagated by inoculating 80% confluent CHSE-214 cells maintained withgrowth medium supplemented with 2% FBS. The virus stock contained 43,200copies of virus nsP1 per �l, as determined by absolute quantitative real-timereverse transcription-PCR (RT-PCR) (see below). Infections were carried out by

absorbing the virus suspension to the cells in serum-free medium for 2 to 3 h,after which the cells were rinsed once with phosphate-buffered saline (PBS)and incubated for the indicated periods in medium containing supplementsand 2% FBS.

Virus titration. IPNV titers were determined by endpoint titration on CHSE-214 cells and calculated by the TCID50 method (37).

Antibodies. A monoclonal antibody against the VP3 protein of IPNV(antiVP3) was kindly provided by K. E. Christie, Intervet Norbio, Bergen, Nor-way. Polyclonal antibodies against salmon IFNa1 (antiIFNa1) and salmon ISG15were obtained as described previously (3, 42). Polyclonal rabbit antibody wasprepared against Atlantic salmon Mx1 (40) expressed in E. coli by Hilde Hansen,Norwegian College of Fishery Science, University of Tromsø. The polyclonalantibody against actin was from Sigma.

RNA isolation, cDNA synthesis, and real-time PCR. Total RNA was isolatedwith TRIzol (Invitrogen) from TO cells stimulated for 24 h with the indicatedconcentrations of IFNa1 and IFN-� with or without 1% antiIFNa1 antiserum.Then, 1 �g of RNA was reverse transcribed in a 40-�l reaction volume using acDNA synthesis kit according to the manufacturer’s instructions (Fermentas LifeSciences). Primers for real-time PCR were designed by Applied Biosystemsprotocols and are listed in Table 1. The primers for salmon IFNb and IFNc wereas described previously (54).

Quantitative PCR was performed by using a ABI Prism 7000 sequence detec-tion system (Applied Biosystems). For each gene, 2 �l of cDNA was used as atemplate in a mixture of specific primers (final concentration, 500 nM) and 10 �lof SYBR green PCR Master Mix (Applied Biosystems) in a final volume of 20 �l.The mixtures were first incubated at 95°C for 10 min, followed by 40 amplifica-tion cycles of 10 s at 95°C and 60 s at 60°C. The specificity of the PCR productsfrom each primer pair was confirmed by the melting-curve analysis andsubsequent agarose gel electrophoresis. Relative quantifications of gene tran-scripts were performed by the 2��CT method (33). All quantifications werenormalized to the housekeeping gene GAPDH (glyceraldehyde-3-phosphatedehydrogenase).

TABLE 1. Primers for protein expression and real-time PCR

Primer Sequence (5�–3�) Application

nsP1F CCGGCCCTGAACCAGTT qPCRnsP1R GTAGCCAAGTGGGAGAAAGCTviperinF TCCTTGATGTTGGCGTGGAA qPCRviperinR GCATGTCAGCTTTGCTCCACAIP10F TGGTCAAGTTGGAGACGGTCA qPCRIP10R TGGAACGCATGGACACATTGGBPF TGAACATGCACCGACTGGACT qPCRGBPR TCTTCAGACGGCTTTCCTGGTAISG15F ACAGTTCAGCCACACACCACTG qPCRISG15R GCTCCCATTGACACCTAACAGCIRF9F ACCCATCCAGCAAACTCATCAT qPCRIRF9R ATGTCGCGGAGGTAGGTCATTIRF8F AAGGTTCCTCCAAGCTCTCCAG qPCRIRF8R TTTGCTCTTGGCTGTGCTGAGIRF1F AGGCTAATTTCCGCTGTGCA qPCRIRF1R TTTTGTAGACGCGCACTGCTIRF3F TGGACCAATCAGGAGCGAAC qPCRIRF3R AGCCCACGCCTTGAAAATAAIRF7F GTCGTCAAGGTGGTTCCCCT qPCRIRF7R TGGGAGATCTGCAGGCTGATGADPHF GAAGGGAATCAAAGTCGTTGC qPCRGADPHR CCATGCTCACCTCACCCTTGTMxF TGCAACCACAGAGGCTTTGAA qPCRMxR GGCTTGGTCAGGATGCCTAATIFNaF TGCAGTATGCAGAGCGTGTG qPCRIFNaR TCTCCTCCCATCTGGTCCAGomIFNgF GGGATCCGCTCAGTTCACATCA

ATTAACProtein

expressionomIFNgR CAAGCTTCTACATGATGTGTGA

TTTGAGssIFNaF GCGGATCCTGTGACTGGATCC

GACACCACTProtein

expressionssIFNaR GCAAGCTTTCATCAGTACATCT

GTGCTGCAAG

VOL. 85, 2011 ANTIVIRAL ACTIVITY OF SALMONID FISH IFN-� 9189


.org/D

ownloaded from

http://jvi.asm.org/

Western blot analysis. TO cells in 24-well plates were stimulated with 100 ngof recombinant trout IFN-�/ml for the indicated time periods. The cells wererinsed with PBS before the lysates were harvested in SDS sample buffer (160 mMTris-HCl [pH 6.8], 10% �-mercaptoethanol, 2% SDS, 20% glycerol, 0.1% bro-mophenol blue). Inhibition of IPNV replication was studied by immunoblottingof VP3 as follows. TO cells were stimulated with 100 ng of IFN-�/ml with orwithout 1% antiIFNa1 antiserum for 24 h preinfection with IPNV at a multi-plicity of infection (MOI) of 0.1. For samples containing antiIFNa1 antiserum,1% antiIFNa1 antiserum was also added to the medium after adsorption of thevirus and left until harvesting. Supernatants and lysates were harvested at theindicated time points postinfection. Lysates were boiled for 10 min and subjectedto Western blotting by applying the NuPAGE system (Invitrogen). Blottingand incubation with antiVP3 (1:1,000), Mx1 (1:3,000), and actin antibody(1:1,000) was performed according to the manufacturer’s instructions. Blotswere stripped in 0.2 M NaOH for 10 min and incubated with primary ISG15antibody (1:20,000). Secondary antibody was goat anti-rabbit- or anti-mousehorseradish peroxidase-antibody (Santa Cruz Biotechnology) diluted 1:25,000.Detection was performed by using the SuperSignal West Pico chemiluminescentsubstrate and a molecular imaging system from Carestream Health, Inc., Roch-ester, NY. Quantification of blots was done utilizing the Carestream MI softwareaccording to the manufacturer’s instructions.

Anti-IPNV assay by the CPE reduction method. IFN activity in cell superna-tants was determined by their ability to induce protection against IPNV-inducedcytopathic effect (CPE) (3). Recombinant IFNs were 2-fold serially diluted inEMEM with 5% FBS (salmon IFNa1 from 2 ng/ml to 7.8 pg/ml and trout IFN-�from 50 to 0.1 ng/ml), and 100 �l of each dilution was added to quadruplicatewells of subconfluent TO cells or ASK cells in 96-well plates. To determinewhether IFNa was involved in the antiviral activity of IFN-�, a neutralizinganti-IFNa antibody was used as previously described (3). Briefly, antiIFNa1antiserum or preserum control at a dilution of 1:100 was added and present inthe medium during IFN-� stimulation and during the whole virus infectionprocedure.

After 24 h, the culture medium was removed and the cells were infected withIPNV (MOI of 0.1) in 100 �l of EMEM without FBS. Virus was absorbed for 2 hbefore 100 �l of medium with 4% serum was added. When complete destructionof unstimulated infected cells occurred after approximately 4 days, all of the cellswere washed with PBS and fixed and stained by incubation with 1% (wt/vol)crystal violet in 20% ethanol for 10 min. The cells were then washed three timeswith distilled water and air dried before the stain was dissolved by the additionof 100 �l of 50% ethanol containing 0.05 M sodium citrate and 0.05 M citric acid.The absorbance was then determined at 550 nm.

Anti-SAV3 assay by measuring nsP1 transcripts. TO cells were seeded in24-well plates (64,000 cells/well) and grown at 16°C. Cells in triplicate wells werekept unstimulated or stimulated with IFN-� from 25 to 0.03 ng/ml with orwithout 1% anti-IFNa antiserum or stimulated with 1 ng of IFNa1/ml. After 24 h,the culture medium was removed, and the cells were infected with SAV3(216,000 nsP1 transcripts) in 500 �l of L-15 medium without FBS. Two hourslater, another 500 �l of L-15 medium with 4% FBS was added, and the cells wereincubated at 16°C. SAV3 replication was analyzed 1, 8, and 14 days after infec-tion by absolute quantification of virus nsP1 transcripts using real-time RT-PCRas described in the manual supplied by Applied Biosystems. The primers arelisted in Table 1. Briefly, the nsP1 fragment (107 bp) was cloned into the pCRT4TOPO TA vector (Invitrogen), and the concentration of purified plasmid wasmeasured by using a NanoDrop 1000 spectrophotometer (Thermo Scientific).The plasmid copy numbers was calculated according to 1 �g of 1,000-bp DNAcontaining 9.1 � 1011 molecules, and serial dilutions of plasmid (102 to 108

copies) were used as standards in each real-time PCR run. For comparison ofnsP1 copy numbers between different time points postinfection, the number ofnsP1 transcripts in non-IFN-treated, virus-infected cells at day 1 was taken as 1.

Statistical analysis. Statistical analysis was performed on log transformedTCID50 values and quantified Western blot signal values. The GraphPad Prism4software (GraphPad Software, Inc., San Diego, CA) was used to run one-wayanalysis of variance for the different treatment groups within each time point,followed by a Bonferroni post test. A P value of 0.05 was considered significant.

RESULTS

Antiviral activity against IPNV of IFN-� compared toIFNa1. In the initial experiments, the salmon IFN-� gene(GenBank accession number AAW21707) was cloned and ex-pressed in E. coli using the pQE-30 vector according to the

protocol described for rainbow trout IFN-� (61). However,because salmon IFN-� hardly expressed as a soluble protein,rainbow trout IFN-� was used in the following experiments dueto its high sequence homology to salmon IFN-�. For compar-ison, Atlantic salmon IFNa1, a type I IFN, was also expressedin E. coli using the same protocol as that used for trout IFN-�.Figure 1 shows SDS-PAGE results for the purified recombi-nant rainbow trout IFN-� and salmon IFNa1.

Antiviral activity of IFN-� and IFNa1 against IPNV weretested in TO and ASK cells using the CPE reduction method(Fig. 2). IFN-� showed potent antiviral activity in TO cellswhere the effective concentration that induced 50% protectionof the cells (EC50) was determined to be 1.6 ng/ml (Fig. 2A).An even better protective effect of IFN-� was observed in ASKcells with an EC50 of 0.1 ng/ml (Fig. 2B). As expected for atype I IFN, IFNa1 showed stronger antiviral activity thanIFN-�, with an EC50 of 31 pg of IFNa1/ml (Fig. 2C and D).The virus titers and synthesis of the IPNV structural proteinVP3 were also compared in IFN-� treated and nontreated TOcells after infection with IPNV. Treatment of TO cells with 100ng of IFN-�/ml resulted in an approximately 50- to 100-foldreduction in IPNV titers at 48 and 72 h postinfection (p.i.)compared to the control, with differences that were significant(P 0.05) (Fig. 3A). Moreover, virus protein expression wasalso inhibited by IFN-� treatment (Fig. 3B), since a significant(P 0.05) reduction in VP3 levels was detected in IFN-�-stimulated cells at 48 h p.i. compared to nontreated, infectedcells. The VP3/actin ratio was 150-fold higher in the controlcompared to IFN-�-treated cells (Fig. 3C). The antiviral activ-ity of the IFN-� preparation is not due to impurities in thelipopolysaccharide or nucleic acids, because heat-inacti-vated IFN-� lost its ability to induce antiviral activity againstIPNV (data not shown).

Finally, IFN-� and IFNa1 were found to act synergistically inantiviral activity against IPNV (Fig. 4). Combination of IFN-�

FIG. 1. SDS-PAGE of recombinant Atlantic salmon IFNa1 andrainbow trout IFN-�. Recombinant proteins were produced in E. coliand purified by Ni-NTA affinity chromatography. IFNa1 (100 ng) andIFN-� (100 ng) were subjected to SDS-PAGE, along with proteinstandards. Gels were stained with SimpleBlue.

9190 SUN ET AL. J. VIROL.


.org/D

ownloaded from

http://jvi.asm.org/

(0.4 to 1.6 ng/ml) and IFNa1 (7.5 to 30 pg/ml) induced agreater protection of cells against IPNV-induced CPE than dideach IFN alone.

The anti-IPNV activity of IFN-� is partially dependent onIFNa. A priori, the antiviral activity of IFN-� could be due toinduction of type I IFN (8). To test this hypothesis in thesalmon model, TO cells were stimulated with IFN-� in the pres-ence or absence of neutralizing antiserum generated againstIFNa1 (antiIFNa1) (3). AntiIFNa1 reduced the antiviral activ-ity of IFN-� substantially (Fig. 2A and B). In the presence ofantiIFNa1, the minimum doses of IFN-� resulting in 50%survivals of IPNV-infected TO cells and ASK cells were 50 and12.5 ng/ml, respectively (Fig. 2A and B, white bars). This is 30to 125 times greater than the concentration of IFN-� giving50% protection of cells in the absence of antiIFNa1. Anti-IFNa1 also had a significant (P 0.05) negative impact on theability of IFN-� to reduce IPNV titers (Fig. 3A). Furthermore,the reduction in antiviral activity of IFN-� by anti-IFNa wasalso evident from the effect on viral protein expression (Fig. 3Band C). Thus, while VP3 expression was almost abolished inIFN-�-treated cells at 48 h p.i., cells treated with IFN-� in thepresence of antiIFNa1 showed a VP3 expression 15-foldhigher than the IFN-�-treated cells (Fig. 3C).

Antiviral activity of IFN-� against SAV3. During the 14 daysof SAV3 infection of TO cells, no clear CPE was observed.SAV3 replication was thus tracked by measuring nsP1 tran-scripts by quantitative PCR (qPCR). In the nonstimulated vi-rus-infected cells, the nsP1 transcripts increased 4-fold be-

tween days 1 and 8 and 104-fold by day 14 (Fig. 5). SAV3replication was effectively inhibited by both IFN-� (1.6 ng/ml)and IFNa1 (1 ng/ml), resulting in a complete elimination ofnsP1 transcripts or a reduction in transcripts to 10% of theday 1 levels in infected control cells. Interestingly, the presenceof antiIFNa1 during infection of cells caused a marked in-crease in virus replication. In the presence of antiIFNa1, nsP1transcripts were 7.6, 105, and 102 times higher than in infectedcontrol cells at days 1, 8, and 14 p.i., respectively. This suggeststhat infection with SAV3 induces IFNa in the cells, which thenslows down replication of the virus in support of previous work(58). IFN-� abolished SAV3 transcription at concentrationsfrom 0.25 to 25 ng/ml (Fig. 5). AntiIFNa1 reduced the antiviralactivity against SAV3 of IFN-� at 1 ng/ml and lower concen-trations. In the case of SAV3, the dependency on IFNa forantiviral activity of IFN-� is, however, less certain since thevirus itself induces IFNa (58).

IFN-� and IFNa1 show different profiles in the induction ofantiviral genes, IFN regulatory factors, and the chemokineIP-10. To compare gene induction by IFNa1 and IFN-�, wechose antiviral genes that in mammals are typically induced bytype I IFN (Mx, ISG15, viperin, and PKR) and type II IFN(GBP). We also studied the expression of other IFN regulatoryfactors—IRF-1, IRF-3, IRF-7, IRF-8, and IRF-9—since theyare involved in the regulation of type I IFN and IFN-inducedantiviral genes. The chemokine IP-10 (also named CXCL10)was included because it is strongly induced by IFN-� in mam-mals (25). Moreover, since antiIFNa1 reduced the antiviral

FIG. 2. Antiviral activity of trout IFN-� and salmon IFNa1 against IPNV measured as protection against the development of virus-inducedCPE. Quadruplicate wells of TO cells (A and C) and ASK cells (B and D) were stimulated with different concentrations of recombinant IFN-�(A and B) or IFNa1 (C and D) for 24 h at 17°C (f). Cells were also stimulated with IFN-� in the presence of 1% antiIFNa1 antiserum (�). Thecells were then infected with IPNV at an MOI of 0.1. When full CPE was observed in infected nontreated cells, cell survival was estimated by crystalviolet staining (optical density at 550 nm). Nontreated noninfected cells served as the positive control (100% survival).



.org/D

ownloaded from

http://jvi.asm.org/

activity of IFN-� against IPNV, we wanted to find out whetherIFN-� induced the expression of IFNa1 and the other two typeI IFNs, IFNb and IFNc. Gene expression was measured byqPCR. Although both IFN-� and IFNa1 upregulated the ex-pression of all of the tested genes, most of the genes showeddifferent expression characteristics in response to the two IFNs(Fig. 6 and 7). IFN-� showed a dose-dependent effect on thetranscription of most genes from 1 to 1,000 ng/ml, while IFNa1showed a dose-dependent effect at much lower concentrations

(0.01 to 10 ng/ml). Mx protein was upregulated 850-fold by 10ng of IFNa1/ml but only 20-fold by 10 ng of IFN-�/ml. Even ata concentration of 0.1 ng/ml, Mx was upregulated 500-fold byIFNa1 but was still only 50-fold upregulated by IFN-� at 1�g/ml. The difference in transcriptional response was evenmore pronounced for viperin, which increased 7,000 times bytreatment with IFNa1 (10 ng/ml). In contrast, viperin tran-scripts only increased 8-fold after stimulation with 1 �g ofIFN-�/ml. ISG15 was upregulated 1,500- to 4,000-fold with 0.1to 10 ng of IFNa1/ml, whereas ISG15 was upregulated only 15-to 71-fold with 1 to 1,000 ng of IFN-�/ml (Fig. 6). PKR wasconstitutively expressed in TO cells (CT of 29) but showed adose-dependent response to IFNa1 being upregulated 26 timesafter treatment with 10 ng of IFNa1/ml. PKR transcripts in-creased 7-fold after treatment with 1 to 1,000 ng of IFN-�/ml.Similar to mammals, GBP was more strongly upregulated byIFN-� than by type I IFN. Thus, GBP transcripts increased 45-to 60-fold by stimulation of TO cells with 1 to 1,000 ng ofIFN-�/ml. In contrast, GBP increased only 4-fold with 10 ng ofIFNa1/ml. Interestingly, both IFN-� and IFNa1 were able toupregulate expression of IFNa 6- to 7-fold at 10 ng/ml. The factthat IFN-� is able to induce IFNa1 thus supports the hypoth-esis that the antiviral effects of IFN-� are in part due to theinduction of IFNa1. In contrast, IFN-� did not induce IFNband IFNc (data not shown).

Interestingly, several of the IRFs showed a higher increasein transcripts upon stimulation with IFN-� than with IFNa1.IRF-1 transcription was most highly induced by IFN-�, increas-ing more than 300 times in response to 1 and 10 ng of IFN-�/ml. In contrast, IFNa1 induced IRF-1 90-fold at 10 ng/ml and36-fold at 1 ng/ml. Also, IRF-7, IRF-8, and IRF-9 were morestrongly induced by IFN-� than by IFNa1. On the other hand,there was no clear difference between IFN-� and IFNa1 in theinduction of IRF-3 at 10 ng/ml, but IFNa1 was the more ef-fective inducer at lower concentrations. Finally, the chemokineIP-10 was rather specifically induced by IFN-� compared toIFNa1, at least at the 24-h time point. At 10 ng/ml, IFN-�

FIG. 3. Antiviral activity of IFN-� measured as the reduction invirus titers and the expression of viral VP3 protein. (A) TO cells werepretreated for 24 h with 100 ng of IFN-�/ml with or without antiIFNa1,before infection with IPNV (MOI of 0.1). Supernatants were harvested48 and 72 h p.i. and titrated on CHSE cells. The results show the meanTCID50/ml values of three replicate wells from the same setup. Controlwas untreated, infected cells. (B) TO cells were pretreated for 24 hwith 100 ng of IFN-�/ml with or without antiIFNa1, before infectionwith IPNV (MOI of 0.1). Lysates were harvested 48 h p.i. and subjectedto Western blot analysis. The figure shows results from one representativeparallel from the same setup as in panel A. (C) The actin and VP3 bandsfrom the Western blot analysis in panel B were quantified, and the resultsshow the mean VP3/actin ratio of three replicate wells from the samesetup. The control was untreated, infected cells.

FIG. 4. Synergistic activity of IFN-� and IFNa1 against IPNV inTO cells. TO cells were stimulated with recombinant IFNa (7.5 to 30pg/ml), IFN-� (400 to 1,600 pg/ml), or a combination of IFNa andIFN-� (f, IFNa; �, IFN-�; u, IFN-� and IFNa). Antiviral analysiswas performed as previously described. After 24 h of stimulation, theculture medium was removed, and the cells were infected with IPNVat an MOI of 0.1. At 4 days after IPNV infection, cell survival wasestimated by crystal violet staining (optical density at 550 nm).



.org/D

ownloaded from

http://jvi.asm.org/

induced IP-10 expression 3,500-fold, while IFNa1 only inducedexpression 24-fold (Fig. 7).

AntiIFNa1 reduced IFN-� induction of Mx and ISG15 butnot the induction of IRF-1 or IP-10. To test the influence ofantiIFNa1 on the expression of IFN-�-induced genes, we stud-ied the expression of IRF-1, IP-10, Mx, and ISG15 transcriptsin IFN-�-treated TO cells in the presence or absence of anti-IFNa1 (Fig. 8). Adding antiIFNa1 caused ca. 50 and 78%reductions in the transcript levels of Mx and ISG15, respec-tively, upon stimulation with 100 ng of IFN-�/ml (Fig. 8). Incontrast, the expression of IRF-1 and IP-10 in response toIFN-� was not affected by the presence of antiIFNa1. Theseresults show that while the induction of Mx and ISG15 appar-ently is partially dependent on the induction of IFNa, IFN-�induction of IRF-1 and IP-10 is independent of IFNa.

Effect of antiIFNa1 on the IFN-�-induced expression of Mxand ISG15 proteins. We also studied the effect of IFN-� on theexpression of Mx and ISG15 at the protein level and whetherantiIFNa1 had an influence on protein expression. As shown inFig. 9, IFN-� increased the expression of Mx protein and freeISG15 and ISG15 conjugates between 24 and 96 h. Mx andISG15 protein levels were markedly diminished at 72 and 96 hin cells stimulated in the presence of antiIFNa1 compared to

cells stimulated with IFN-� alone (Fig. 9), which further sup-ports that the induction of these genes by IFN-� is partiallydependent on IFNa.

DISCUSSION

Little is previously known about the antiviral properties offish IFN-�. The present study demonstrates that IFN-� hasstrong antiviral activity against the naked double-strandedRNA virus IPNV and the enveloped single-stranded RNAvirus SAV3 in Atlantic salmon cells. Both viruses cause highlosses of farmed salmon. IFN-� protected salmon cells againstIPNV-induced CPE, reduced virus titers, and inhibited synthe-sis of the viral structural protein VP3. Moreover, IFN-�showed potent antiviral activity against SAV3 measured asreduction in virus nsP1 transcripts. IFN-� had 50-fold lessspecific antiviral activity against IPNV compared to IFNa1 inTO cells, showing an EC50 of 1.6 ng/ml versus 31 pg/ml in theCPE reduction assay. Differences in antiviral activity of IFN-�and type I IFNs is likely due to differential induction of genessince these IFN utilize different receptors and thus activatedifferent JAK/STAT pathways. IFN-� and IFNa1 were indeedshown to induce distinct expression profiles of selected genesin Atlantic salmon. IFNa1 induced the highest transcript levelsof the antiviral proteins Mx, ISG15, and viperin, which aremuch more strongly induced by type I IFNs than by IFN-� alsoin mammals (6, 15, 17). Mx is a GTPase with broad antiviralactivity in mammals and does also display antiviral activityagainst IPNV in salmonid cells (16, 24). ISG15 is an ubiquitinhomolog, which conjugates to various host proteins both inmammals and fish, although its exact antiviral mechanism isstill unknown (17, 42). Viperin was first identified in rainbowtrout as a virus-induced gene (vig1) and was later shown toinhibit virus release or replication by binding to lipid dropletsin mammals (5, 12). Viperin and ISG15 were identified asinhibitors of the alphavirus Sindbis virus and may thus play arole in the IFN inhibition of SAV3 (58).

IFN-� also upregulated Mx, ISG15, and viperin transcriptsin salmon, but at much lower levels compared to IFNa1 24 hafter stimulation. On the other hand, IFN-� treatment ofsalmon cells resulted in a marked increase in Mx and ISG15proteins 48 to 96 h after stimulation, which indicates a laterresponse time compared to IFNa1. Induction of ISG15 by IFN-�resulted in conjugation of ISG15 to multiple cellular proteinssimilar to that shown for salmon IFNa1 previously (42).

The double-stranded RNA activated kinase PKR was con-stitutively expressed in salmon cells and was upregulated bystimulation with both IFN-� and IFNa1, which is similar toexpression properties of PKR in mammals (10). PKR inhibitsviral replication by phosphorylating the initiation factor eIF2�chain, which leads to the inhibition of protein synthesis (43).Antiviral activity of PKR was recently demonstrated in fish(60).

GBP was confirmed here to be a typical IFN-�-induced genealso in fish, with transcript levels in TO cells increased morethan 45-fold by stimulation with IFN-� compared to 4-fold bystimulation with IFNa1. GBP is a GTPase that is recognized asan IFN-�-induced antiviral protein in mammals and is inducedby IFN-� in rainbow trout (1, 41).

Taken together, the antiviral activity induced by IFN-� in

FIG. 5. Inhibition of SAV3 replication by IFN-� and IFNa1.(A) TO cells were infected with SAV3 in the absence (f) or presence(�) of antiIFNa1 antibody or 24 h after stimulation with IFNa1 (1ng/ml). (B) TO cells were infected with SAV3 after stimulating withIFN-� (24 h) with or without antiIFNa1 and sampled 14 days p.i. Barsshow the fold increase in virus nsP1 transcripts measured by qPCRrelated to non-IFN-treated cells at day 1 p.i. Treatments and timepoints for sampling are indicated underneath bars (n � 3).



.org/D

ownloaded from

http://jvi.asm.org/

salmon is likely due to upregulation of PKR, GBP, and severalgenes that are normally induced by type I IFN such as Mx,ISG15, and viperin. The lower antiviral activity of IFN-� com-pared to IFNa1 may be attributed to lower and later inductionof the latter group of antiviral genes. Even in mammals, thereis little information about typical IFN-�-induced antiviralgenes other than GBP (45).

The fact that IFN-� induced an increase in IFNa1 transcriptsraised the question of whether the antiviral activity of IFN-�is due to the induction of IFNa. To explore this possibility,the antiviral activity of IFN-� was measured in the presenceor absence of an antiserum which effectively neutralizes theantiviral activity of IFNa1 (3). Indeed, in the presence ofantiIFNa1, IFN-� showed not only reduced antiviral activityagainst IPNV but also induced lower amounts of Mx andISG15 at the transcript and protein level. IPNV itself does notinduce IFN or Mx in TO or CHSE cells (20, 21, 42). In fact,proteins encoded by IPNV inhibit both activation of theIFNa1 promoter (unpublished results) and inhibit IFNa1-mediated signaling (49). Anti-IFNa1 also seemed to reduce

the antiviral activity of IFN-� against SAV3, but here themechanism is less clear since the virus itself is known to induceIFN. Altogether, the antiviral activity of IFN-� in salmonid fishis at least partially dependent on IFNa1, potentially due to theinduction of IFNa, which subsequently induces Mx and otherantiviral genes. On the other hand, IFN-� may induce some Mxtranscription independent of IFNa1 since it was impossible toabolish Mx transcription completely by adding antiIFNa1 toIFN-�. Since IFN-� neither induces IFNb nor IFNc in TOcells, it is possible that IFN-� activates ISGF3 to some extentin salmon, as has been shown for mice (27). Salmon cellsdeficient in IFNa receptor would be required to settle thesequestions, but this receptor has thus far not been identified insalmonid fish.

In human cells, the antiviral activity of IFN-� appears to beindependent of autocrine or paracrine type I IFN induction ofantiviral genes (8, 29). The induction of antiviral genes byhuman IFN-� was instead found to be dependent on theformation of ISGF3II, which contains nonphosphorylatedSTAT2. Whether this mechanism is important in fish has to be

FIG. 6. Effect of IFN-� and IFNa1 on the expression of antiviral genes in TO cells 24 h after stimulation. Values are the fold increase intranscripts compared to nonstimulated cells (n � 3).



.org/D

ownloaded from

http://jvi.asm.org/

examined in future studies. The antiviral activity of IFN-� inmice is partially dependent on the constitutive expression oftype I IFN but not on the induction of type I IFN (55). Anefficient IFN-� response has been suggested to be dependenton the association of the IFN-� receptor with the type I IFNreceptor bound to type I IFN (55) or to be dependent onupregulation of STAT1 by low-level constitutively expressedtype I IFN (13). Upregulation of STAT1 by IFNa1 also occursin salmon (23, 50). We reasoned that if the lowering of antiviralactivity of IFN-� by antiIFNa1 in salmon is due to suboptimalassembly of the IFN-� receptor complex or to lowering ofSTAT1 levels, then the antiIFNa1 antibody should also lowerinduction of typical IFN-� induced genes such as IRF-1 andIP-10. However, although IFN-� in the presence of antiIFNa1induced lower levels of Mx and ISG15 transcripts compared toIFN-� alone, there was no change in the induction of IRF-1and IP-10 (Fig. 8). This suggests that in salmon, constitutivelyexpressed IFNa1 is neither important for the function of the

IFN-� receptor nor for the maintenance of sufficient STAT1levels. Taken together, the dependency of type I IFN for theantiviral activity of IFN-� seems different in Atlantic salmon,humans, and mice.

We confirmed that in salmon the transcription factor IRF-1and the chemokine IP-10 (CXCL10) were much more stronglyinduced by IFN-� than by IFNa1 and thus represent signaturegenes for the IFN-� response also in fish. Compared to IFNa1,IFN-� also induced higher levels of IRF-7, IRF-8, and IRF-9,while IFN-� and IFNa1 induced similar levels of IRF-3. IRF-1,IRF-3, and IRF-7 are involved in the transcriptional activationof IFN-� in mammals (31). In salmon, IRF-1, IRF-3, andIRF-7b activate the IFNa1 promoter (4). In mammals, IRF-1has recently been shown to directly activate the transcription ofviperin and to mediate the induction of viperin after IFN-�stimulation (52). The interaction between IRF-8 and TRAF6modulates TLR signaling in mammals and may contribute tothe cross talk between IFN-� and TLR signal pathways (59).

FIG. 7. Effect of IFN-� and IFNa1 on expression of IRFs and IP-10 in TO cells 24 h after stimulation. Values are the fold increase in transcriptscompared to nonstimulated cells (n � 3).



.org/D

ownloaded from

http://jvi.asm.org/

IRF-9 is an important component of the ISGF3 complexwhich mediates the transcription of type I IFN-inducedgenes. Previous work has demonstrated the upregulation ofSTAT1 by IFN-� (50). Taken together, IFN-� induction of

IRFs and STAT1 may prime cells for a more swift response toviral infections. Previous research showed that IFN-� also up-regulated the transcription of TLR8 and TLR9 homologs insalmon, which should further contribute to the priming of cellsfor an enhanced antiviral response (47, 48).

A recent report claimed that salmon IFN-� has no antiviralactivity against SAV3, which is in disagreement with the pres-ent results (57). However, the reason for the difference inresults is probably that recombinant salmon IFN-� produced inE. coli from inclusion bodies is inactive. Salmon IFN-� pre-pared this way induced only 30- and 12-fold increases in IP-10at 1.65 �g/ml and 330 ng/ml, respectively (57). We obtainedsimilar results with salmon IFN-� produced from inclusionbodies in E. coli (data not shown). In contrast, trout IFN-�produced as a soluble protein induced a 2,000-fold increase inIP-10 transcripts at a concentration of 1 ng/ml. Unfortunately,the yield of soluble salmon IFN-� produced by the same pro-tocol as for trout IFN-� was very small and not suitable forpurification (data not shown). It is highly unlikely that Atlanticsalmon possesses an inactive IFN-�. Our interpretation is thusthat the sequence difference between trout and salmon IFN-�may explain the difficulty in producing a recombinant bioactivepreparation of the latter.

It has been shown that SAV3 induces IFNa in salmon cells,which may be limiting for replication of this virus (57). This isindeed confirmed by the present study, which showed that theaddition of antiIFNa1 to SAV3 culture strongly promoted rep-lication of the virus.

In summary, we demonstrate here that IFN-� has antiviralactivity against IPNV and SAV3 in Atlantic salmon. The an-tiviral activity of IFN-� in salmon appears to be partially de-

FIG. 8. Effects of antiIFNa1 antibody on IFN-� induction of Mx, ISG15, IP-10, and IRF-1 transcripts. TO cells were stimulated with 100, 10,and 1 ng of IFN-�/ml, respectively, with 1% antiIFNa1 serum (f) or control serum (�) and sampled at 10 h after stimulation. Values are the foldincrease in transcripts compared to nonstimulated cells (n � 3).

FIG. 9. Time course study of Mx and ISG15 protein expression wasconducted in TO cells stimulated with 100 ng of IFN-�/ml with orwithout 1% antiIFNa1 anti-serum. Lysates were harvested at the in-dicated time points ranging from 24 to 96 h and subjected to Westernblot analysis. The blot was incubated with antibodies against Mx (1:3,000) and actin (1:1,000) and developed before stripping and reincu-bation with antibody against ISG15 (1:20,000). The asterisk indicatesthe remnants of actin antibody, which was not completely removedduring the stripping procedure.



.org/D

ownloaded from

http://jvi.asm.org/

pendent on genes, which in mammals are induced by type IIFNs through the activation of ISGF3. In mammals, IFN-� canalso to some extent induce such genes by the activation ofISGF3 or ISGF3II. Although this may occur in salmon as well,we found that the antiviral activity of IFN-� and its ability toinduce Mx and ISG15 is at least in part dependent on IFNa,possibly through induction.

ACKNOWLEDGMENTS

We thank Hilde Hansen, Norwegian College of Fishery Science,University of Tromsø, for making the polyclonal antibody against At-lantic salmon Mx1.

This study was supported by the Aquaculture Program of the Re-search Council of Norway (grant 1726619).

REFERENCES

1. Anderson, S. L., J. M. Carton, J. Lou, L. Xing, and B. Y. Rubin. 1999.Interferon-induced guanylate binding protein-1 (GBP-1) mediates an anti-viral effect against vesicular stomatitis virus and encephalomyocarditis virus.Virology 256:8–14.

2. Arts, J. A., E. J. Tijhaar, M. Chadzinska, H. F. Savelkoul, and B. M.Verburg-van Kemenade. 2010. Functional analysis of carp interferon-gam-ma: evolutionary conservation of classical phagocyte activation. Fish Shell-fish Immunol. 29:793–802.

3. Berg, K., T. Svingerud, B. Sun, and B. Robertsen. 2009. An antiserumagainst Atlantic salmon IFNa1 detects IFN and neutralizes antiviral activityproduced by poly I:C stimulated cells. Dev. Comp. Immunol. 33:638–645.

4. Bergan, V., O. Kileng, B. Sun, and B. Robertsen. 2010. Regulation andfunction of interferon regulatory factors of Atlantic salmon. Mol. Immunol.47:2005–2014.

5. Boudinot, P., P. Massin, M. Blanco, S. Riffault, and A. Benmansour. 1999.Vig-1, a new fish gene induced by the rhabdovirus glycoprotein, has a virus-induced homologue in humans and shares conserved motifs with the MoaAfamily. J. Virol. 73:1846–1852.

6. Chin, K. C., and P. Cresswell. 2001. Viperin (cig5), an IFN-inducible anti-viral protein directly induced by human cytomegalovirus. Proc. Natl. Acad.Sci. U. S. A. 98:15125–15130.

7. Christie, K. E., L. S. Havarstein, H. O. Djupvik, S. Ness, and C. Endresen.1988. Characterization of a new serotype of infectious pancreatic necrosisvirus isolated from Atlantic salmon. Arch. Virol. 103:167–177.

8. Costa-Pereira, A. P., et al. 2002. The antiviral response to gamma interferon.J. Virol. 76:9060–9068.

9. Decker, T., P. Kovarik, and A. Meinke. 1997. GAS elements: a few nucleo-tides with a major impact on cytokine-induced gene expression. J. InterferonCytokine Res. 17:121–134.

10. Der, S. D., and A. S. Lau. 1995. Involvement of the double-stranded-RNA-dependent kinase PKR in interferon expression and interferon-mediatedantiviral activity. Proc. Natl. Acad. Sci. U. S. A. 92:8841–8845.

11. Devold, M., B. Krossoy, V. Aspehaug, and A. Nylund. 2000. Use of RT-PCRfor diagnosis of infectious salmon anaemia virus (ISAV) in carrier sea troutSalmo trutta after experimental infection. Dis. Aquat. Org. 40:9–18.

12. Fitzgerald, K. A. 2011. The interferon-inducible gene: viperin. J. InterferonCytokine Res. 31:131–135.

13. Gough, D. J., et al. 2010. Functional crosstalk between type I and II inter-feron through the regulated expression of STAT1. PLoS Biol. 8:e1000361.

14. Grayfer, L., E. G. Garcia, and M. Belosevic. 2010. Comparison of macro-phage antimicrobial responses induced by type II interferons of the goldfish(Carassius auratus L.). J. Biol. Chem. 285:23537–23547.

15. Haller, O., M. Frese, and G. Kochs. 1998. Mx proteins: mediators of innateresistance to RNA viruses. Rev. Sci. Technol. 17:220–230.

16. Haller, O., and G. Kochs. 2002. Interferon-induced mx proteins: dynamin-like GTPases with antiviral activity. Traffic 3:710–717.

17. Harty, R. N., P. M. Pitha, and A. Okumura. 2009. Antiviral activity of innateimmune protein ISG15. J. Innate Immun. 1:397–404.

18. Hug, H., M. Costas, P. Staeheli, M. Aebi, and C. Weissmann. 1988. Orga-nization of the murine Mx gene and characterization of its interferon- andvirus-inducible promoter. Mol. Cell. Biol. 8:3065–3079.

19. Igawa, D., M. Sakai, and R. Savan. 2006. An unexpected discovery of twointerferon gamma-like genes along with interleukin (IL)-22 and -26 fromteleost: IL-22 and -26 genes have been described for the first time outsidemammals. Mol. Immunol. 43:999–1009.

20. Jensen, I., and B. Robertsen. 2002. Effect of double-stranded RNA andinterferon on the antiviral activity of Atlantic salmon cells against infectioussalmon anemia virus and infectious pancreatic necrosis virus. Fish ShellfishImmunol. 13:221–241.

21. Jorgensen, J. B., et al. 2007. A recombinant CHSE-214 cell line expressingan Mx1 promoter-reporter system responds to both interferon type I and

type II from salmonids and represents a versatile tool to study the IFN-system in teleost fish. Fish Shellfish Immunol. 23:1294–1303.

22. Karlsen, M., S. Villoing, E. Rimstad, and A. Nylund. 2009. Characterizationof untranslated regions of the salmonid alphavirus 3 (SAV3) genome andconstruction of a SAV3 based replicon. Virol. J. 6:173.

23. Kileng, O., V. Bergan, S. T. Workenhe, and B. Robertsen. 2009. Structuraland functional studies of an IRF-7-like gene from Atlantic salmon. Dev.Comp. Immunol. 33:18–27.

24. Larsen, R., T. P. Røkenes, and B. Robertsen. 2004. Inhibition of infectiouspancreatic necrosis virus replication by Atlantic salmon Mx1 protein. J. Vi-rol. 78:7938–7944.

25. Luster, A. D., and J. V. Ravetch. 1987. Biochemical characterization of agamma interferon-inducible cytokine (IP-10). J. Exp. Med. 166:1084–1097.

26. Lutfalla, G., et al. 2003. Comparative genomic analysis reveals independentexpansion of a lineage-specific gene family in vertebrates: the class II cyto-kine receptors and their ligands in mammals and fish. BMC Genomics 4:29.

27. Matsumoto, M., et al. 1999. Activation of the transcription factor ISGF3 byinterferon-gamma. Biol. Chem. 380:699–703.

28. Milev-Milovanovic, I., et al. 2006. Identification and expression analysis ofinterferon gamma genes in channel catfish. Immunogenetics 58:70–80.

29. Morrow, A. N., H. Schmeisser, T. Tsuno, and K. C. Zoon. 2011. A novel rolefor IFN-stimulated gene factor 3II in IFN-gamma signaling and induction ofantiviral activity in human cells. J. Immunol. 186:1685–1693.

30. Muller, U., et al. 1994. Functional role of type I and type II interferons inantiviral defense. Science 264:1918–1921.

31. Paun, A., and P. M. Pitha. 2007. The IRF family, revisited. Biochimie89:744–753.

32. Pestka, S., C. D. Krause, and M. R. Walter. 2004. Interferons, interferon-likecytokines, and their receptors. Immunol. Rev. 202:8–32.

33. Pfaffl, M. W. 2001. A new mathematical model for relative quantification inreal-time RT-PCR. Nucleic Acids Res. 29:e45.

34. Pous, J., et al. 2005. Structure of birnavirus-like particles determined bycombined electron cryomicroscopy and X-ray crystallography. J. Gen. Virol.86:2339–2346.

35. Powers, A. M., et al. 2001. Evolutionary relationships and systematics of thealphaviruses. J. Virol. 75:10118–10131.

36. Qureshi, S. A., M. Salditt-Georgieff, and J. E. Darnell, Jr. 1995. Tyrosine-phosphorylated Stat1 and Stat2 plus a 48-kDa protein all contact DNA informing interferon-stimulated-gene factor 3. Proc. Natl. Acad. Sci. U. S. A.92:3829–3833.

37. Reed, L., and H. Muench. 1938. A simple method of estimating fifty percentendpoints. Am. J. Hyg. 27:493–497.

38. Robertsen, B. 2006. The interferon system of teleost fish. Fish ShellfishImmunol. 20:172–191.

39. Robertsen, B., V. Bergan, T. Rokenes, R. Larsen, and A. Albuquerque. 2003.Atlantic salmon interferon genes: cloning, sequence analysis, expression, andbiological activity. J. Interferon Cytokine Res. 23:601–612.

40. Robertsen, B., G. Trobridge, and J. C. Leong. 1997. Molecular cloning ofdouble-stranded RNA inducible Mx genes from Atlantic salmon (Salmosalar L.). Dev. Comp. Immunol. 21:397–412.

41. Robertsen, B., J. Zou, C. Secombes, and J. A. Leong. 2006. Molecular andexpression analysis of an interferon-gamma-inducible guanylate-binding pro-tein from rainbow trout (Oncorhynchus mykiss). Dev. Comp. Immunol. 30:1023–1033.

42. Rokenes, T. P., R. Larsen, and B. Robertsen. 2007. Atlantic salmon ISG15:expression and conjugation to cellular proteins in response to interferon,double-stranded RNA and virus infections. Mol. Immunol. 44:950–959.

43. Samuel, C. E. 2001. Antiviral actions of interferons. Clin. Microbiol. Rev.14:778–809.

44. Schoenborn, J. R., and C. B. Wilson. 2007. Regulation of interferon-gammaduring innate and adaptive immune responses. Adv. Immunol. 96:41–101.

45. Schroder, K., P. J. Hertzog, T. Ravasi, and D. A. Hume. 2004. Interferon-gamma: an overview of signals, mechanisms and functions. J. Leukoc. Biol.75:163–189.

46. Shivappa, R. B., et al. 2004. Molecular characterization of Sp serotypestrains of infectious pancreatic necrosis virus exhibiting differences in viru-lence. Dis. Aquat. Org. 61:23–32.

47. Skjaeveland, I., D. B. Iliev, G. Strandskog, and J. B. Jorgensen. 2009.Identification and characterization of TLR8 and MyD88 homologs in Atlan-tic salmon (Salmo salar). Dev. Comp. Immunol. 33:1011–1017.

48. Skjaeveland, I., D. B. Iliev, J. Zou, T. Jorgensen, and J. B. Jorgensen. 2008.A TLR9 homolog that is up-regulated by IFN-gamma in Atlantic salmon(Salmo salar). Dev. Comp. Immunol. 32:603–607.

49. Skjesol, A., T. Aamo, M. N. Hegseth, B. Robertsen, and J. B. Jorgensen.2009. The interplay between infectious pancreatic necrosis virus (IPNV) andthe IFN system: IFN signaling is inhibited by IPNV infection. Virus Res.143:53–60.

50. Skjesol, A., T. Hansen, C. Y. Shi, H. L. Thim, and J. B. Jorgensen. 2010.Structural and functional studies of STAT1 from Atlantic salmon (Salmosalar). BMC Immunol. 11:17.

51. Stark, G. R., I. M. Kerr, B. R. Williams, R. H. Silverman, and R. D.



.org/D

ownloaded from

http://jvi.asm.org/

Schreiber. 1998. How cells respond to interferons. Annu. Rev. Biochem.67:227–264.

52. Stirnweiss, A., et al. 2010. IFN regulatory factor-1 bypasses IFN-medi-ated antiviral effects through viperin gene induction. J. Immunol. 184:5179–5185.

53. Stolte, E. H., H. F. Savelkoul, G. Wiegertjes, G. Flik, and B. M. LidyVerburg-van Kemenade. 2008. Differential expression of two interferon-gamma genes in common carp (Cyprinus carpio L.). Dev. Comp. Immunol.32:1467–1481.

54. Sun, B., B. Robertsen, Z. Wang, and B. Liu. 2009. Identification of anAtlantic salmon IFN multigene cluster encoding three IFN subtypes withvery different expression properties. Dev. Comp. Immunol. 33:547–558.

55. Takaoka, A., et al. 2000. Cross talk between interferon-gamma and -alpha/beta signaling components in caveolar membrane domains. Science 288:2357–2360.

56. Wergeland, H. I., and R. Aakre Johansen. 2001. A salmonid cell line (TO)for production of infectious salmon anaemia virus (ISAV). Dis. Aquat. Org.44:183–190.

57. Xu, C., et al. 2010. Alpha interferon and not gamma interferon inhib-its salmonid alphavirus subtype 3 replication in vitro. J. Virol. 84:8903–8912.

58. Zhang, Y., C. W. Burke, K. D. Ryman, and W. B. Klimstra. 2007. Identifi-cation and characterization of interferon-induced proteins that inhibit al-phavirus replication. J. Virol. 81:11246–11255.

59. Zhao, J., et al. 2006. IRF-8/interferon (IFN) consensus sequence-bindingprotein is involved in Toll-like receptor (TLR) signaling and contributes tothe cross-talk between TLR and IFN-gamma signaling pathways. J. Biol.Chem. 281:10073–10080.

60. Zhu, R., Y. B. Zhang, Q. Y. Zhang, and J. F. Gui. 2008. Functional domainsand the antiviral effect of the double-stranded RNA-dependent proteinkinase PKR from Paralichthys olivaceus. J. Virol. 82:6889–6901.

61. Zou, J., et al. 2005. Identification and bioactivities of IFN-gamma in rainbowtrout Oncorhynchus mykiss: the first Th1-type cytokine characterized func-tionally in fish. J. Immunol. 175:2484–2494.

62. Zou, J., et al. 2004. Identification of an interferon gamma homologue inFugu, Takifugu rubripes. Fish Shellfish Immunol. 17:403–409.



.org/D

ownloaded from

http://jvi.asm.org/

antiviral activity of salmonid gamma interferon against...

Documents