ars.els-cdn.com · web viewstate key laboratory for mechanical behavior of materials, xi׳an...
TRANSCRIPT
Biomimetic Elastomeric, Conductive and Biodegradable Polycitrate-based Nanocomposites for
Guiding Myogenic Differentiation and Skeletal Muscle Regeneration
Yuzhang Du a, #, Juan Ge a, #, Yannan Li a, Peter X. Ma d, e, f, Bo Lei a, b, c,*
a Frontier Institute of Science and Technology, Xi׳an Jiaotong University, Xi׳an 710054, China
b State Key Laboratory for Mechanical Behavior of Materials, Xi׳an Jiaotong University, Xi׳an 710054, China
c State Key Laboratory for Manufacturing Systems Engineering, Xi׳an Jiaotong University, Xi׳an 710054, China
d Department of Biomedical Engineering, University of Michigan, Ann Arbor, MI 48109-2009, USA
e Macromolecular Science and Engineering Center, University of Michigan, Ann Arbor, MI 48109-1055,USA
f Department of Materials Science and Engineering, University of Michigan, Ann Arbor, MI 48109-1078,USA
*Corresponding author:
B Lei, [email protected] and [email protected], Tel. +86-29-83395361,
1. Materials and methods
1.1. Preparation and characterization of reduced graphene oxide (RGO)
RGO was obtained through the reduction of GO using vitamin C as the reductant. Briefly, 20 mL of
GO solution (0.1 mg/mL) was treated by ultrasonic for 1 h at room temperature, followed by adding 120
mg vitamin C and adjusting the pH to 9-10 by ammonia solution (25%). After reaction for 30 min at 95
with stirring, the resulted dispersions were centrifuged at 10000 rpm for 20 min and washed by℃
ethyl alcohol for three times. Finally, the precipitation was dispersed in DMSO to form 2.0 mg/mL solution
by ultrasonic for further use. The UV-Vis absorption spectra between the wavelength range of 200-700nm
for GO and RGO in water were obtained from a UV-Vis spectrophotometer (Lambda 35, PerkinElmer). The
morphology of GO and RGO were observed on the transmission electron microscopy (TEM, F20, FEI) and
atomic force microscopy (AFM, Cypher, Asylum Research). The samples for AFM analysis were prepared
by depositing a DMSO dispersion of GO or RGO on a clean silicon substrate.
Table S1. The primers used in qRT-PCR measurement
Gene Forward(5’-3’) Reverse(5’-3’)
GAPDH AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA
MyoD CGGCTACCCAAGGTGGAGAT ACCTTCGATGTAGCGGATGG
Myogenin CTGACCCTACAGACGCCCAC TGTCCACGATGGACGTAAGG
Troponin T TCAATGTGCTCTACAACCGCA ACCCTCCC AGCCCCC
Figure S1. Physiochemical structure and morphology of RGO. (A) UV-vis spectra showing the typical
absorption peaks of RGO at 264nm; (B) FTIR spectra indicating the decreased oxygenous groups of
RGO; (C) TEM image exhibiting the ultrathin 2D nanostructure of RGO; (D) AFM picture
demonstrating the thickness of 2.2 nm for RGO nanosheet. In the UV-Vis spectra (Figure S1A), two
absorption peaks at 229 nm and 293 nm observed in pure GO spectrum were presumably due to the π→π*
transition of aromatic C═C bonds and the n→π* transition of the C═O bonds, respectively [1]. The peak at
229 nm was shifted to 264 nm and the peak at 293 disappeared in RGO spectrum after reduction by vitamin
C, suggesting the successful reduction of GO [1]. The RGO was further identified by ATR-FTIR spectra
(Figure S2B). Compared with GO, the intensities of peaks associated with the oxygen functional groups of
RGO (carboxyl and hydroxyl and epoxy groups) were dramatically decreased. These decreased absorption
bands demonstrated that most of oxygen functional groups in GO were reduced by vitamin C. TEM showed
the representative two-dimensional (2D) nanostructure of RGO (Figure S2C). A number of wrinkles on the
surface of RGO indicated the increased Van der Waals' force between the sheets due to the decrease of
oxygen-containing groups. Moreover, AFM analysis showed the single layer nanostructure of RGO with a
thickness about 2.2 nm (Figure S2D).
[1] J. Gao, F. Liu, Y. Liu, N. Ma, Z. Wang, X. Zhang. Environment-friendly method to produce graphene
that employs vitamin C and amino acid, Chem. Mater., 22(7) (2015) 2213-2218.
Figure S2. SEM images of PCEG nanocomposites.
Figure S3. Swelling behavior of PCEG nanocomposites in PBS. The swelling ratio was expressed as
the water uptake percentage after soaking samples for 1, 2, 3 days.
Figure S4. Elongation at break of PC, PCE and PCEG nanocomposites elastomers.
0
50
100
150
200
250
300
350
400
PCEG(2.0)
PCEG(1.0)PCEG(0)
Elo
ngat
ion
(%)
Before soaking After soaking**
Figure S5. Elongation at break of PCEG nanocomposites after soaking in PBS for 24 h.
Figure S6. Electroactivity evaluation of PCEG nanocomposites. (A) Cyclic voltammogram curves
showing the electrochemical properties of nanocomposites solution and films; (B) Conductivity
analysis indicating the current transport ability of nanocomposites with different RGO content.
Significant enhanced electroactivity for PCEG nanocomposites was observed after adding RGO into
PCE polymer matrix.
Figure S7. Myotube formation morphology on PCE elastomers after culture for 5 days, as well as
TCP, PLGA, PCEG (0), PCEG (1.0) on day 1. The myotube formation was showed through MHC
protein immunofluorescence staining.