articulo lactobacillus

ORIGINAL PAPER

Effects of Lactobacillus rhamnosus on zebrafishoocyte maturation: an FTIR imagingand biochemical analysis

Elisabetta Giorgini & Carla Conti & Paolo Ferraris &Simona Sabbatini & Giorgio Tosi & Corrado Rubini &Lisa Vaccari & Giorgia Gioacchini & Oliana Carnevali

Received: 7 June 2010 /Revised: 16 September 2010 /Accepted: 21 September 2010 /Published online: 9 October 2010# Springer-Verlag 2010

Abstract The aim of this study was to verify the effects ofprobiotic Lactobacillus rhamnosus on zebrafish oocytematuration using FPA (focal plane array) FTIR imagingtogether with specific biochemical assays (SDSPAGE,real-time PCR and enzymatic assay). Oocyte growth isprevalently due to a vitellogenic process which consists ofthe hepatic synthesis of vitellogenin and its selective uptakeduring maturation. The administration of L. rhamnosusIMC 501 for 10 days induced chemical changes to oocytecomposition, promoting the maturation process. Someinteresting biochemical features, linked to protein secondarystructure (amide I band) and to phospholipidic and glucidicpatterns, were detailed by vibrational analysis. The spectro-scopic results were supported by the early increase of thelysosomal enzyme involved in the final oocyte maturation,the cathepsin L. This enzyme increases during folliclematuration, with the highest levels in class IV oocytes. In

treated females, class III oocytes showed higher cathepsinL gene expression and enzymatic activity, with levelscomparable to class IV oocytes isolated from controls; thiscan be related to the proteolytic cleavage of the highermolecular mass yolk protein components, as evidenced bySDSPAGE.

Keywords FPA FTIR imaging . Vibrational analysis . Fishoocytes . Probiotic . Ovary .Danio rerio

Introduction

In recent years, probiotics have attracted considerableattention not only as feed additives but also for theirpositive effects in a great number of diseases [18]. Upuntil now, their role in reproduction and mechanisms ofaction have been poorly studied. However, it is noteworthyto evidence a recent study on the positive role ofLactobacillus rhamnosus on zebrafish oocyte growth andgametes quality [9]. The zebrafish and human genomeshave been shown to share extensive conserved syntheticfragments and are therefore increasingly seen as a powerfuland highly amenable model system for many human andanimal diseases with complete genome available. Inaddition, many zebrafish genes and their human homologuedisplay structural and functional similarities [10]. For thisreason, zebrafish have been considered a good model toelucidate molecular mechanisms involved in several differ-ent physiological processes, including reproduction.

Zebrafish oocytes, due to their number, size, relativeflatness and distinctive maturation states, are ideal subjectsfor vibrational microspectroscopy experiments. A zebrafishovary is asynchronous, composed by oocytes at different

E. Giorgini (*) : C. Conti : P. Ferraris : S. Sabbatini :G. TosiDipartimento di Idraulica, Strade, Ambiente e Chimica,Universit Politecnica delle Marche,60121 Ancona, Italye-mail: [email protected]

C. RubiniDipartimento di Neuroscienze,Universit Politecnica delle Marche,60121 Ancona, Italy

L. VaccariBeamline SISSI, Sincrotrone Elettra,34102 Trieste, Italy

G. Gioacchini :O. CarnevaliDipartimento di Scienze del Mare,Universit Politecnica delle Marche,60121 Ancona, Italy

Anal Bioanal Chem (2010) 398:30633072DOI 10.1007/s00216-010-4234-2

size, whose maturation process causes relevant modifica-tions in protein components [11]. In teleosts, vitellogenin(VTG), the yolk precursor protein synthesized in the femaleliver, is incorporated by the oocyte from the bloodstream byreceptor-mediated endocytosis; once inside the oocyte,VTG is processed into smaller yolk proteins consisting oflipovitellins, phosvitins, phosvettes and -components,which are stored in the oocyte during the growth periodand will be the source of nutrients and energy for thedeveloping embryo [1214].

Fourier Transform Infrared (FTIR) microspectroscopy isa powerful technique to study the composition and themacromolecular chemistry of cells and tissues, providing abiochemical fingerprint of the samples under investigation.Infrared mapping and imaging techniques generate chemicalcartograms based on peak height, integrated areas underspecific bands or band ratios, giving a semi-quantitativeevaluation of sample biocomponents. The identification andcorrelation of spectral groups (clusters), directly evidencedon the images, can be achieved by means of multivariateprocedures [1517].

A recent study analysed mice oocytes by using Synchro-tron Radiation IR Microspectroscopy (SR-IRMS), providedthe overall biochemical composition of samples duringmaturation: in fact, differences between immature oocytes atthe germinal vesicle and mature metaphase II stage werenicely evidenced [18].

Since 1990s, our group is involved in applying infraredspectroscopy to study biological modifications [1922]. Aprevious study on zebrafish oocytes, carried out in ourlaboratories, provided the characterization of specific spectralmarkers ongoing from class III to IV oocytes, allowing todefine a new method for classifying the different maturationstates [23]. As a further extent, we decided to evaluate at mol-ecular level the effects of probiotic L. rhamnosus on zebrafishfollicle composition, by IR imaging using a bidimensionalfocal plane array (FPA) detector, Q-polymerase chain reaction(PCR), enzymatic assay and sodium dodecyl sulphatepolyacrylamide gel electrophoresis (SDSPAGE).

Experimental

Sample preparation

Adult Danio rerio (zebrafish) females, purchased from acommercial dealer (Acquario di Bologna, BO, Italy), were

kept in aquaria at 28 C and oxygenated water. Fishes werefed twice daily with commercial food (Vipagran, Sera,Germany) and two times with Artemia salina. Eggs laid byparental fish were kept and grown. Six-month-old adultzebrafish were used for testing the effects of probiotic onreproductive process. Two experimental groups wereperformed: a control group (C), fed on commercial dietonly, and a treated group (P), fed on commercial diet mixedwith lyophilized probiotic for 10 days. The probiotic strainused was L. rhamnosus IMC 501, provided by SynbiotecS.r.l. (Camerino, MC, Italy) and supplied in the water tanksin a final concentration of 106 CFU ml1, as suggested bythe producer. The count of egg-spawned output wasperformed every day at 9.00 a.m. within 1 h after light.

At the end of the treatment, 30 ovaries were frozen inliquid nitrogen, fixed on corky supports with OCT cryostatembedding medium (Tissue-Tek) and cryosectioned at apredefined thickness of 57 m by using a KRYOSTAT1720 DIGITAL instrument; adjacent slices were deposedon silicon supports for vibrational analysis and on conven-tional glass slides for morphological examination (haema-toxylin and eosyn stained) [23]. These procedures wereperformed in accordance with the Guidelines on the Handlingand Training of Laboratory Animals by the UniversitiesFederation for Animal Welfare and with the Italian animalwelfare legislation (D.L. 116/92).

FTIR measurements and data analysis

FTIR measurements were carried out at the FTIR beam-line SISSI, ELETTRA synchrotron [24], by using aBruker VERTEX 70 interferometer coupled with a Hyper-ion 3000 Vis-IR microscope and equipped with a liquidnitrogen cooled FPA detector (detector area size 6464pixels). For every ovary section, images were acquired intransmission mode using a 15 condenser/objective (pixelresolution of about 2.6 m); specific zones, correspondingto oocytes of classes III, III and IV, were selected for IRmapping. Each IR image (OPUS 6.5, Bruker softwarepackage), obtained by acquiring simultaneously groups of4,096 spectra, was collected averaging 128 scans for eachdetector pixel with a spectral resolution of 4 cm1,rationing the background single-channel image againstthe sample single-channel one. Bigger images were doneby defining a grid of images, until a maximum of 36,864spectra. All the samples were compared with independenttrials.

Gene For primer Rev primer

CatL TGCAACAGAGGAAGGGTGGAG TCCAGCTTGTTTGGGACCTCA

-actin GGTACCCATCTCCTGCTCCAA GAGCGTGGCTACTCCTTCACC

Table 1 Primers list andsequences

3064 E. Giorgini et al.

By using OPUS 6.5, total absorbance cartograms,representing the total intensity of the infrared absorption,were generated for each sample by integrating areasbetween 1,800 and 1,000 cm1. For a deeper analysis, thecorresponding spectral data were run with CytoSpec 1.4.02to obtain chemical maps of the integrated areas under CHstretching region (3,1002,800 cm1), amide I mode(1,7201,580 cm1) and phosphate and carbohydrate zones(1,300900 cm1).

Average spectra were extracted from IR images, select-ing an area from the inner zone of each oocyte, in order toavoid the influence of phospholipidic membrane (OPUS

6.5); depending on oocyte size, the number of selectedspectra was in the range 1,36012,550. All the averagespectra were two points baseline linear fitted in the spectralrange 4,000900 cm1 and vector-normalized [25].

At the occurrence, second-derivative (nine-point smooth-ing) and peak fitting (Gaussian algorithm) procedures wereadopted to determine the right position and absorbanceintensity of bands. By using GRAMS/AI 7.02 (GalacticIndustries, Inc., Salem, NH) software package, peak fittingwas performed on average spectra (interpolated in the range1,7201,580 cm1 and two points baseline linear fitted); toidentify the underlying component bands, the number of

400 m 400 m

a bFig. 1 Photomicrograph of(a) C and (b) P zebrafish ovarysections (haematoxylin-and-eosin-stained)

100 m

PO2 CH AI100 m

a b

c d e

Fig. 2 Total absorbance cartogram of IIIC oocyte, reconstructed byintegrating the area between 1,800 and 1,000 cm1 (a), together withthe corresponding photomicrograph (b); chemical maps of the

integrated areas under the CH2 and CH3 stretching regions (3,1002,800 cm1) (c), the amide I band (1,7201,580 cm1) (d) and thephosphate and carbohydrate zones (1,300900 cm1) (e)

Effects of Lactobacillus rhamnosus on zebrafish oocyte maturation 3065

peaks together with their centre values was carefullyindividuated according to second-derivative results andfixed before running the iterative process, to obtain thebest reconstructed curve (residual near to zero). Meanvalues of area and wavelength were purchased for eachcomponent peak. Attribution of the bands was doneaccording to literature [16, 2530].

Cathepsin L enzymatic assay

The cathepsin L (Cat L) enzymatic assays were optimizedand performed from each experimental group (C and P) onthe three oocyte stages: III, III and IV. The crude extractfor the enzymatic assays was made by homogenizing thetissue with distilled water (1:2, w/v). The homogenate wascentrifuged at 14,000g for 10 min at 4 C. The supernatantwas carefully separated from the lipid layer. The totalprotein level in the supernatant was determined by themethod of Bradford [31] with bovine serum albumin(Sigma) as the standard. Supernatants were used forenzymatic assays.

The Cat L enzymatic activity was routinely assayed againstthe synthetic substrate Z-Phe-Arg-NNapOMe (-N-benzy-loxycarbonyl-L-Phe-L-Arg-4-methoxy--naphthylamide)(5-mM final concentration) by a selective colourimetric assay[32]. For the quantitative analysis, we used a standard curvebased on 4-methoxy-2-naphtylamine (0.535 M), in orderto convert absorbance in molar concentration. The colouri-metric assay was performed as follows: 2.55 l of oocytes atIII, III and IV stages crude extract were added to 376 l ofactivator buffer (0.1 M NaAc, 1.33 mM ethylenediaminetetra-acetic acid, EDTA, 6.66 mM cysteine, 5.33 M urea; pH 5).The mixture was incubated for 5 min at 40 C in order toactivate the enzyme and then added to 6.25 l of substrate Z-Phe-Arg-NNapOMe (6 mg/ml in DMSO) and water until afinal volume of 500 l. After 20 min of incubation at 45 C,the reaction was stopped with 500 l of colour reagent,containing Fast Garnet Salt (1 mg/ml) with pCMB (10 mM)and EDTA (50 mM), in a ratio of 1:1, pH 6.0. After additionof 1 ml of But-OH, the tube was centrifuged for 5 min at14,000g, in order to separate the reaction product (4-Me-2-NA). The supernatant was read at 520 nm [32]. The assay

100 m

AI PO2 CH 100 m

a b

c d e

Fig. 3 Total absorbance cartogram of IIIP oocyte, reconstructed byintegrating the area between 1,800 and 1,000 cm1 (a), together withthe corresponding photomicrograph (b); chemical maps of the



activity is expressed as micromole per minute per milli-gramme per microlitre of 4-methoxy-2-naphthylamine re-leased. The crude extract amount, temperature, pH and timeof incubations were optimized and utilized for cathepsin Lassay in all classes of isolated oocytes. The inhibition studieswere performed by using both leupeptin and N-(benzylox-ycarbonyl)-L-phenylalanyl-L-tyrosinal [3335].

SDSPAGE

Five oocytes from selected stage (III, III and IV) of eachexperimental group (C and P) were homogenized in 10 lof lysis buffer and then centrifugated at 14,000g for 15 minto separate the dissolved yolk from the insoluble cellulardebris. The supernatant was run on SDSPAGE underdenaturing conditions according to basic procedures using10% acrylamide mini-gels (710 cm) [12]. Molecularweight standards were placed in wells and electrophoresedat constant current (50 mA). Protein bands were visualizedby fixing gels in 12% trichloroacetic acid for 1 h, overnightstaining in 0.2% Coomassie Blue R-350 (Amersham-Pharmacia Biotech Uppsala, SE-75184, Sweden) in 30%

methanol plus 10% acetic acid and final distaining in 25%methanol and 7% acetic acid.

Gene expression

Total RNA was extracted from samples using mini kitRNeasy (Qiagen) extraction kit following the manufac-turers protocol. Total RNA extracted was eluted in 25 l ofRNase-free water. Final RNA concentrations were deter-mined by spectrophotometer, and the RNA integrity wasverified by ethidium bromide staining of 28S and 18Sribosomal RNA bands on 1% agarose gel. RNA was storedat 80 C until use. Total RNAwas treated with DNase (10UI at 37 C for 10 min, MBI Fermentas); a total amount of1 g of RNA was used for cDNA synthesis, employingiScript cDNA Synthesis Kit (Bio-Rad).

Real-time PCR

PCRs were performed with SYBR green method in an iQ5iCycler thermal cycler (Bio-Rad). For each sample, tripli-cate PCR reactions were carried out. The reactions were set

100 m

PO2 AI CH 100 m

a b

c d e

Fig. 4 Total absorbance cartogram of IVC oocyte, reconstructed byintegrating the area between 1,800 and 1,000 cm1 (a), together withthe corresponding photomicrograph (b); chemical maps of the



on a 96-well plate by mixing, for each sample, 1 l ofdiluted (1/20) cDNA, 5 l of 2 concentrated iQ SYBRGreen Supermix (Bio-Rad), containing SYBR Green as afluorescent intercalating agent, 0.3 M forward primer and

0.3 M of reverse primer. The thermal profile for allreactions was 3 min at 95 C and then 45 cycles of 20 s at95 C, 20 s at 60 C and 20 s at 72 C. Fluorescencemonitoring occurred at the end of each cycle. Additional

100 m

PO2 AI CH

100 m

a b

c d e

Fig. 5 Total absorbance cartogram of IVP oocyte, reconstructed byintegrating the area between 1,800 and 1,000 cm1 (a), together withthe corresponding photomicrograph (b); chemical maps of the

integrated areas under the CH2 and CH3 stretching region (3,1002,800 cm1) (c), the amide I band (1,7201,580 cm1) (d) and thephosphate and carbohydrate zones (1,300900 cm1) (e)

3998,2 3600 3200 2800 2400 2000 1800 1600 1400 1200 1000 899,9

III

IV

I-II

Wavenumbers / cm-1

Abs

orba

nce

/ a.u

.

Fig. 6 Average spectra of clas-ses III, III and IV oocytes(control C, red; probiotic-treatedP, blue) in the range 4,000900 cm1 (classes III and IVspectra were shifted along they-axis). Grey rectanglesindicate the analysed spectralwindows


dissociation curve analysis was performed and showed inall cases one single peak. The -actin was used as referencegenes in each sample in order to standardize the results byeliminating variation in mRNA and cDNA quantity andquality. The primer sequences were reported in Table 1. Noamplification product was observed in negative control andno primerdimer formation was observed in the controltemplates. The data obtained were analysed using the iQ5optical system software version 2.0 (Bio-Rad). Modifica-tion of gene expression is represented with respect to thecontrol sampled at the same time of the treatment.

Wavenumber/ cm-1

Abs

orba

nce/

a.u

.

III C IV C

III P IV P

R

structures helical structures random coil structuresR

R

Fig. 7 Peak fitting in the region1,7201,580 cm1 of IIIC, IVC,IIIP and IVP oocytes

1200 1180 1160 1140 1120

1169

1159

III

IV

Wavenumbers / cm-1

Abs

orba

nce

/ a.u

.

Fig. 9 Average spectra of classes III and IV oocytes (control C, red;probiotic-treated P, blue) in the range 1,1851,130 cm1 (class IVspectra were shifted along the y-axis)

Fig. 8 Representative SDSPAGE electrophoretic pattern from classIIIC, IIIP, IIIC, IIIP, IVC and IVP oocytes. Positions of MWstandards (in kilodalton) are indicated. This panel is a composite ofthree gels


Statistical analysis

Regarding the statistical analyses of enzymatic activity andgene expression, the presented data are meanSD for thenumber of experiments. Students t test was used forcomparison between the two experimental groups. P

the same, while differences were found in classes III andIV, between control (C) and probiotic-treated (P) oocytes,above all in amide I band shape (protein secondarystructure), in CH lipid stretching modes and in glucidicand phosphate moieties (1,300900 cm1).

Peak fitting procedure was performed on amide I band toevaluate helical (-helix, 1,657 and 1,649 cm1, and three-turn helix, 1,665 cm1), random coil (1,641 cm1), -turn(1,693 cm1) and -sheet (1,682, 1,638 and 1,614 cm1)secondary structures (Fig. 7) [29]. The following resultswere obtained: (1) on follicle maturation, the value of helix/ structures absorbance ratio remained approximatelyconstant in C, while an increase was observed in P; (2)random coil structures were detectable only in C samples,with a threefold increase from III to IVoocytes; (3) in bothgroups, a new band at 1,665 cm1, attributable to three-turnhelix secondary structure, was found in class IV oocytes,indicating a differentiation of the proteic pattern onmaturation.

Changes in cytoplasmic proteins were also shown by theSDSPAGE test (Fig. 8). The electrophoretic patternevidenced that vitellogenin incorporation occurred in classIII oocytes, even if class IIIP oocytes showed an amount ofcytoplasmic proteins similar to that of class IVC. Aspreviously described, during oocyte maturation, compo-nents at lower molecular mass appeared, too [34]; thesealterations could be due to proteolytic events, controlled byCatL activity, occurring on yolk proteins [34, 38]: suchprocesses generate small peptides and free amino acids thatproduce the osmotic driving force for water uptake into theoocyte [3941]. To evaluate oocyte hydration, the bands at1,159 cm1 (CO-H) and 1,169 cm

1 (CO-P) were investi-gated (Fig. 9) [19]: in group P, hydration is already wellevident in class III oocytes, while in group C it is observedonly in class IV. In addition, in class IVP oocytes, a clearphosphorylation process is registered, as indicated by theincrease of the band at 1,169 cm1.

The cleavage of proteins side chains is also confirmed bythe increase of band ratios 2,959/2,926 cm1 (asym CH3/CH2) and 2,873/2,854 cm

1 (sym CH3/CH2), more evidentin class IIIP oocytes with respect to IIIC [18, 23].

To confirm the spectral data, cathepsin L, the lysosomalenzyme involved in yolk processing during the last phase offollicle maturation, was analysed. In both class III and IVoocytes, a significant increase of CatL gene expression(Fig. 10a) and enzymatic activity (Fig. 10b) occurred afterthe probiotic treatment (P

17. Tosi G, Burattini E, Malvezzi-Campeggi F, Chilosi M, Conti C,Ferraris P, Monti F, Sabbatini S, Zam A (2007) J Mol Struct834836:170175

18. Diem M, Wood BR, Chernenko T, Matthus C, Chong C, BernhardU, Jene C, Brandli AA, McNaughton D, Tobin MJ, Trounson A,Lacham-Kaplan O (2008) Anal Chem 80:90659072

19. Tosi G, Conti C, Ferraris P, Garavaglia M, Giorgini E, Rubini C,Sabbatini S (2009) Microsc Res Tech 72:6775

20. Anastassopoulou J, Boukaki E, Conti C, Ferraris P, Giorgini E,Rubini C, Sabbatini S, Theophanides T, Tosi G (2009) VibSpectrosc 51:270275

21. Tosi G, Balercia P, Conti C, Ferraris P, Garavaglia M, Giorgini E,Lo Muzio L, Sabbatini S, Stramazzotti D, Rubini C (2010) AnalQuant Cytol (in press)

22. Conti C, Ferraris P, Giorgini E, Pieramici T, Possati L, RocchettiR, Rubini C, Sabbatini S, Tosi G, Mariggi A (2007) Lo Muzio L.J Mol Struct 834836:8694

23. Carnevali O, Conti C, Ferraris P, Garavaglia MG, Gioacchini G,Giorgini E, Rubini C, Sabbatini S, Tosi G (2009) J Mol Struct938:207213

24. Lupi S, Nucara A, Perucchi A, Calvani P, Ortolani M, Quaroni L,Kiskinova M (2007) J Opt Soc Am B 24:959964

25. Wood BR, Chiriboga L, Yee H, Quinn MA, Mc Naughton D,Diem M (2004) Gynecol Oncol 93:5968

26. Jackson M, Mantsh HH (1993) Spectrochim Acta Rev 15:536927. Gazi E, Dwyer J, Lockyer NP, Mijan J, Gardner P, Hart CA,

Brown MD, Clarke NW (2005) Vib Spectrosc 38:193201

28. Liu KZ, Shi MH, Mantsh HH (2005) Blood Cell Mol Diseases35:404412

29. Stuart B (2004) Infrared spectroscopy. Wiley, Chichester30. Pacifico A, Chiriboga LA, Lasch P, Diem M (2003) Vib Spectrosc

32:10711531. Bradford MM (1976) Anal Biochem 72:24825432. Kamboj RC, Pal S, Raghav N, Singh H (1993) Biochimie 75:873

87833. Margiotta-Casaluci L, Carnevali O (2009) Chem Ecol 25:496034. Carnevali O, Cionna C, Tosti L, Lubzens E, Maradonna F (2006)

Gen Comp Endocrinol 146(3):19520335. Carnevali O, Cionna C, Tosti L, Cerd J, Gioacchini G (2008)

Mol Reprod Dev 75:9710436. Burattini E, Malvezzi-Campeggi F, Chilosi M, Conti C, Ferraris P,

Monti F, Sabbatini S, Tosi G, Zam A (2007) J Mol Struct 834836:170175

37. Carr GL (2001) Rev Sci Instrum 72(3):1738. Carnevali O, Carletta R, Cambi A, Vita A, Bromage N (1999)

Biol Reprod 60(1):14014639. Matsubara T, Ohkubo N, Andoh T, Sullivan CV, Hara A (1999)

Dev Biol 213:183240. LaFleur GJ, Ralda D, Fabra M, Carnevali O, Denslow N,

Wallace RA, Cerd J (2005) Biol Reprod 73:81582441. Fabra M, Ralda D, Bozzo MG, Deen PMT, Lubzens E, Cerd J

(2006) Dev Biol 295:25026242. Lasch P, Boese M, Pacifico A, Diem M (2002) Vib Spectrosc

28:147157


Effects of Lactobacillus rhamnosus on zebrafish oocyte maturation: an FTIR imaging and biochemical analysisAbstractIntroductionExperimentalSample preparationFTIR measurements and data analysisCathepsin L enzymatic assaySDSPAGEGene expressionReal-time PCRStatistical analysis

Results and discussionConclusionReferences

/ColorImageDict > /JPEG2000ColorACSImageDict > /JPEG2000ColorImageDict > /AntiAliasGrayImages false /CropGrayImages true /GrayImageMinResolution 150 /GrayImageMinResolutionPolicy /Warning /DownsampleGrayImages true /GrayImageDownsampleType /Bicubic /GrayImageResolution 150 /GrayImageDepth -1 /GrayImageMinDownsampleDepth 2 /GrayImageDownsampleThreshold 1.50000 /EncodeGrayImages true /GrayImageFilter /DCTEncode /AutoFilterGrayImages true /GrayImageAutoFilterStrategy /JPEG /GrayACSImageDict > /GrayImageDict > /JPEG2000GrayACSImageDict > /JPEG2000GrayImageDict > /AntiAliasMonoImages false /CropMonoImages true /MonoImageMinResolution 600 /MonoImageMinResolutionPolicy /Warning /DownsampleMonoImages true /MonoImageDownsampleType /Bicubic /MonoImageResolution 600 /MonoImageDepth -1 /MonoImageDownsampleThreshold 1.50000 /EncodeMonoImages true /MonoImageFilter /CCITTFaxEncode /MonoImageDict > /AllowPSXObjects false /CheckCompliance [ /None ] /PDFX1aCheck false /PDFX3Check false /PDFXCompliantPDFOnly false /PDFXNoTrimBoxError true /PDFXTrimBoxToMediaBoxOffset [ 0.00000 0.00000 0.00000 0.00000 ] /PDFXSetBleedBoxToMediaBox true /PDFXBleedBoxToTrimBoxOffset [ 0.00000 0.00000 0.00000 0.00000 ] /PDFXOutputIntentProfile (None) /PDFXOutputConditionIdentifier () /PDFXOutputCondition () /PDFXRegistryName () /PDFXTrapped /False

/Description > /Namespace [ (Adobe) (Common) (1.0) ] /OtherNamespaces [ > /FormElements false /GenerateStructure false /IncludeBookmarks false /IncludeHyperlinks false /IncludeInteractive false /IncludeLayers false /IncludeProfiles true /MultimediaHandling /UseObjectSettings /Namespace [ (Adobe) (CreativeSuite) (2.0) ] /PDFXOutputIntentProfileSelector /NA /PreserveEditing false /UntaggedCMYKHandling /UseDocumentProfile /UntaggedRGBHandling /UseDocumentProfile /UseDocumentBleed false >> ]>> setdistillerparams> setpagedevice