avi1-1

8/6/2019 avi1-1

1/8

In vivo antitumor efcacy of interleukin-21 in combination with chemotherapeutics

Kresten Skak a, * , Henrik Sndergaard a , Klaus Stensgaard Frederiksen b , Eva Ehrnrooth ca Immunopharmacology, Building F6.2.30, Novo Nordisk A/S, Novo Nordisk Park, 2760 Ml v, Denmarkb Molecular Genetics, Novo Nordisk A/S, Novo Nordisk Park, 2760 Ml v, Denmarkc Clinical Research Oncology, Novo Alle, Novo Nordisk A/S, 2880 Bagsv rd, Denmark

a r t i c l e i n f o

Article history:Received 16 January 2009Received in revised form 27 May 2009Accepted 27 July 2009

Keywords:ImmunotherapyCytokinesChemotherapyIn vivo models

a b s t r a c t

Interleukin-21 (IL-21) is a class I cytokine with antitumor properties due to enhanced proliferation andeffector function of CD8 + T cells and natural killer (NK) cells. Here we have explored the magnitudeand time-course of cytostatics-induced lymphopenia in mice and investigated whether treatment withcytostatics inuences the antitumor effect of IL-21 in mouse tumor models. We show that pegylated lipo-somal doxorubicin (PLD), irinotecan and oxaliplatin induced transient lymphopenia, whereas 5-uoro-uracil (5-FU) transiently increased lymphocyte counts. B cells were more sensitive than T cells towardsirinotecan and oxaliplatin. Additive antitumor effects were observed after combining IL-21 withPLD, oxa-liplatin and to less extent 5-FU but not irinotecan, and larger effect was observed when IL-21 administra-tion was postponed relative to chemotherapy, suggesting that these agents may transiently impairimmune function. However, the chemotherapies did not signicantly alter the levels of circulating regu-latory T cells and only marginally affected the ability of CD8 + T cells to respond to IL-21 measured asincreased granzyme B mRNA. Our results show that IL-21 therapy can be successfully combined withagents from different chemotherapeutic drug classes, i.e. topoisomerase II inhibitors (PLD), anti-metab-olites (5-FU) and platinum analogs (oxaliplatin) provided that IL-21 therapy is delayed relative tochemotherapy.

2009 Elsevier Ltd. All rights reserved.

1. Introduction

Interleukin-21 (IL-21) is a novel four helix bundle class I cyto-kine produced endogenously by activated CD4 + T cells and naturalkiller T (NKT) cells [1,2] . IL-21 signals through a heterodimericreceptor complex comprised of the unique IL-21 receptor protein(IL-21R) and the common c chain. IL-21R is predominantly ex-pressed by lymphocytes and dendritic cells, and in common withother common c chain associated receptors, IL-21R signals primar-ily through the transcriptional JAK/STAT activators pathway [35] .IL-21 has profound effects on most lymphocyte subsets, includingcostimulation of B cell proliferation, differentiation and isotypeswitching, enhancement of CD8 + T cell proliferation and effectorfunction, activation of NK cells and differentiation of CD4 + T cellsinto Th17 cells (reviewed in [6] ). In vivo studies using recombinantmurine IL-21 have demonstrated signicant antitumor efcacy in avariety of tumor models including melanoma and renal cell carci-noma (RCC) [7,8] , and studies in mice have identied cytotoxic Tcell and natural killer (NK) cell functions as likely mediators of IL-21-induced antitumor activity [7,911] ; a nding that is consis-

tent with the ability of IL-21 to enhance effector functions of thesecell types in vitro and augment proliferation of cytotoxic T cells.

Clinical studies with recombinant human IL-21 administered asmonotherapy have been conducted in patients with stage IV mela-noma and renal cell carcinoma. IL-21 demonstrated an acceptablesafety prole and was associated with antitumor activity whenadministered as monotherapy in previously pretreated patients inphase 1 and 2 trials [1214] . IL-21 iscurrentlybeing tested ina phaseII trial in combination with sorafenib in RCC (clinicaltrials.govidentier NCT00389285) and in phase I trials in combination withrituximab in non-Hodgkins lymphoma (clinicaltrials.gov identierNCT00347971), with cetuximab in colorectal cancer (EudractNo. 2006-004231-30) and with pegylated liposomal doxorubicin(PLD) in epithelial ovarian cancer (clinicaltrials.gov identierNCT00523380) are also ongoing. Combining IL-21 with other drugsis thenext obvious step in thefuture development of IL-21,andsincethemajorityofcancer patientsareundergoingchemotherapyat somestage during their disease course it is highly relevant to investigate if IL-21 therapy can be successfully combined with chemotherapy.

Traditionally combining chemotherapy with immunotherapyhas not been considered feasible due to the adverse effect of mostcytostatics on the bone marrow and on dividing lymphocytes,which are required for raising an adaptive antitumor immune re-sponse. However, more recently several studies have shown that

1043-4666/$ - see front matter 2009 Elsevier Ltd. All rights reserved.doi: 10.1016/j.cyto.2009.07.039

* Corresponding author. Tel.: +45 4443 1594; fax: +45 4443 4537.E-mail address: [email protected] (K. Skak).

Cytokine 48 (2009) 231238

Contents lists available at ScienceDirect

Cytokine

j ou rna l h omep age : www.e l s ev i e r. com/ loca t e / i s sn /10434666
http://dx.doi.org/10.1016/j.cyto.2009.07.039mailto:[email protected]://www.sciencedirect.com/science/journal/10434666http://www.elsevier.com/locate/issn/10434666http://www.elsevier.com/locate/issn/10434666http://www.sciencedirect.com/science/journal/10434666mailto:[email protected]://dx.doi.org/10.1016/j.cyto.2009.07.039

8/6/2019 avi1-1

2/8

cytostatics can as well augment tumor immunity due to their abil-ity to induce immunogenic cell death, which may subsequentlylead to pro-inammatory responses at the tumor site, uptake of tu-mor antigen by resident antigen-presenting cells and subsequentaugmentation of antitumor T cell responses [15] . In vitro resultsindicate that adjuvant IL-2 based immunotherapy combines effec-tively with a number of cytostatics e.g. 5-uorouracil (5-FU) 1 and

doxorubicin [16,17] . Similarly, 5-FU permitted efcient CTL-medi-ated killing of target cells in vitro [16] . In this study we have inves-tigated how administration of chemotherapy affects the number of circulating lymphocyte subsets in a time-course study and the abil-ity of CD8 + T cells to respond to IL-21 stimulation in vivo measuredas increased granzyme B mRNA expression. Furthermore, we haveaddressed whether the antitumor effect of IL-21 can be maintainedwhen chemotherapy is administered prior to or simultaneous withIL-21 therapy. To this end we chose four different chemotherapeu-tics, i.e. the slow release topoisomerase II inibitor PLD, the third gen-eration platinum analog oxaliplatin, the topoisomerase I inhibitoririnotecan, and the anti-metabolite 5-FU which is used in combina-tion with leucovorin and either oxaliplatin or irinotecan. These che-motherapeutics are used either as monotherapy or in differentcombinations for the treatment of various cancers e.g. gastrointesti-nal, breast, bladder and ovarian cancers. In two different mouse tu-mor models we have addressed whether IL-21 can be successfullycombined with any of these chemotherapeutic compounds.

2. Materials and methods

2.1. Animals

C57BL/6 and Balb/c female mice, 810 weeks-old, were pur-chased from Taconics. All experiments were conducted in accor-dance with local guidelines on use of experimental animals andapproved by the Danish National Ethics Committee on Experimen-tal Animals.

2.2. Cell culture

C57BL/6 derived B16 (F0) melanoma cells (American Type Cul-ture Collection (ATCC), CRL-6322) and BALB/c derived RenCa renalcell carcinoma cells (kindly provided by Dr. Robert H. Wiltrout, NCIat Frederick, MD, USA) were cultured in RPMI 1640 with GlutaMAXsupplemented with 10% heat-inactivated FCS, sodium pyruvate(RenCa only), nonessential amino acids (RenCa only), and 5% pen-icillinstreptomycin (all from GIBCO Cell Culture, Invitrogen,Denmark).

2.3. Reagents

Recombinant murine IL-21 produced by Novo Nordisk A/S wasused throughout all experiments. The test substance was formu-lated as 10.5 mg/ml IL-21 in 0.16% L -histidine + 4.66% D-mannitol,pH 5.1. Before injection IL-21 was diluted in PBS. PBS was usedas vehicle control for IL-21.

PLD (Schering-Plough), irinotecan (Mayne Pharma), 5-FU (May-ne Pharma) and oxaliplatin (Mayne Pharma) were all purchasedthrough Nomeco (Copenhagen, Denmark).

2.4. Chemotherapy-induced lymphocytopenia in mice

PLD, and oxaliplatin were administered to C57BL/6 or Balb/cmice as indicated in the gure legends by intravenous injection

once on day 0. Irinotecan and vehicle were administered intraper-itoneally once on day 0. 5-Fluorouracil (5-FU) was administeredintraperitoneally twice on day 0 and 1. All cytostatics were admin-istered using a dose close to MTD for mice as the highest dose, or if the MTD was not available thedose was based on published papersusing these compounds in mice. Blood samples of up to 100 l lwere drawn from the periorbital plexus under isourane anaesthe-sia into heparinized tubes at the following time points: pre-dosing,24 h, 72 h, 7 days, 14 days, 21 days and 28 days post-dosing. Twoalternating cohorts of 4 mice each were used for each group in or-der to reduce blood sampling from individual mice to maximumtwo times within one week. From each blood sample 50 l l bloodwas transferred to True-count tubes (BD Biosciences) and stainedfor 1520 min at RT with the antibodies TCR- b PE-CY5.5 (cloneH97597, eBioscience) CD4 PE (clone GK1.5, BD Biosciences),CD8 APC (clone 566.7, BD Biosciences), CD19 APC-Cy7 (clone1D3, BD Biosciences) and NK1.1 FITC (clone PK136, BD Biosci-ences). To each tube 1 ml FACS lyzing solution (BD Biosciences)was added, and the samples were incubated for 15 min at RT andtransferred to ice. For enumeration of granulocyte and monocyte20 l l whole blood was stained with CD11b APC-Cy7 (clone M1/70, BD Biosciences), CD16/32 FITC (clone 2.4G2, BD Biosciences),CD4 PE and NK1.1 in true-count tubes as above. Granulocytesand monocytes were dened as CD11b +CD16/32 +NK1.1 CD4

combined with FSC/SSC gating. For enumeration of Treg cells80 l l erythrocytes were lyzed in whole blood samples, and thesamples were stained with TCR- b PE-Cy5.5 (clone H57597, eBio-science), CD4 Pacic Orange (clone RM45, Caltag) and CD25 FITC(clone PC61, eBioscience) followed by xation/permeabilizationand staining with Foxp3 PE (clone FJP-16, eBioscience) accordingto the manufacturers recommendations. Data acquisition was per-formed on a LSR II ow cytometer (BD Biosciences) and data wereanalyzedwith BD FACSDiva software (BDBiosciences) for theabso-lute number of lymphocytes. Dataare normalized to a vehicle-trea-ted group in order to compensate for day-to-day variations.

2.5. Effect of chemotherapy on IL-21 induced granzyme B

Cohorts of 8 mice were injected on day 0 with PLD (200 l g/mouse), oxaliplatin (5 mg/kg), irinotecan (150 mg/kg) or 5-FU(50 mg/kg on two consecutive days) as described above. At timepoints 24h, 72h, 7 days and 14days half ofthemicein eachcohortwere injected s.c. with 50 l g IL-21, the other half were injectedwith equi-volume PBS. An additional cohort of mice ( N = 8) was injected only with IL-21 or PBS on day 0 to serve as baseline for themice injected with chemotherapy. Four hours after IL-21 or PBSinjection the mice were sacriced and spleens were removed forsingle cell preparation followed by lysis of erythrocytes in ACK buf-fer. CD8 + T cells were isolated from 2 10 7 splenocytes by positiveselection using magnetic beads according to the manufacturer

instruction (Miltenyi, Bergisch Gladbach, Germany). The puritywas generally 8090%.

Sorted CD8 + T cell samples were lyzed in TRIzol reagent (Invitro-gen,Carlsbad,CA) andchloroformadded.Samples were vortexedfor15 s and phases separated bycentrifugationfor15 min at 10,000 g at4 C. Total RNA from the aqueous phase was further puried usingtheRNeasy 96Qiagenvacuumsystemfollowing theClean-up pro-cedure.RNAintegrity wasconrmedon a 2100Bioanalyzer (AgilentTechnologies, Palo Alto, CA) using the RNA 6000 Pico LabChip kit(Agilent Technologies). cDNA was prepared from total RNA usingrandom hexamer primers and TaqMan Reverse Transcription re-agents (Applied Biosystems, Foster City, CA, USA) according to themanufacturer instructions. Quantitative PCR was performed induplicateoneachofthecDNAsamples (10 dilutionsofcDNA)using

TaqManUniversal PCRMasterMix (AppliedBiosystems) andthe ABIPRISM 7900HT Sequence Detection System (Applied Biosystems).1 Abbreviations used: 5-FU, 5-uorouracil; GZMB, granzyme B; PLD, pegylated

liposomal doxorubicin; RCC, renal cell carcinoma.

232 K. Skak et al./ Cytokine 48 (2009) 231238

8/6/2019 avi1-1

3/8

Primers andFAM-labeled-probes formurinegranzymeB mRNA and18SrRNAwere ordered asAssays-on-Demand(AppliedBiosystems).Probe sequences for these assays were: granzyme B (GZMB)(CCAGGACAAAGGCAGGGGAGATCAT (assay Mm00442834_m1)),and 18S rRNA (TGGAGGGCAAGTCTGGTGCCAGCAG; (assay Hs99999901_s1)). Data were analyzed using ABI Prism SDS 2.2 software(Applied Biosystems), andexpressionlevels forGZMB were normal-ized to 18S rRNA levels.

2.6. Tumor experiments

RenCa renal cell carcinoma cells (2 10 5 per mouse) or B16melanoma cells (2 10 5 per mouse) were injected subcutaneouslyin the right ank of syngenic mice, i.e. Balb/c mice for RenCa cellsand C57BL/6 mice for B16 cells. Tumor growth was monitored bymeasuring the longest diameter and the perpendicular diameterwith at digital calliper. Tumor volume was calculated accordingto the following formula:

Volume = (longest diameter) (perpendicular diameter) 2 /2.When tumors were visible the mice were allocated to 5 treat-

ment groups: vehicle, IL-21 early, cytostatic, cytostatic + IL-21

early and cytostatic + IL-21 late. Mice were allocated accordingto tumor size to obtain as similar as possible average tumor size inall groups. Unless otherwise indicated chemotherapy was initiatedwhen tumors were small (1050 mm 3 ) in order obtain maximal ef-fect of IL-21, which has most effect on small tumors [7] . Murine IL-21 was administered subcutaneously on 5 consecutive days start-ing on the day of chemotherapy (early) or 7 days after chemo-therapy (late). The exact scheduling of therapy is indicated inthe gure legend for each experiment.

The tumor size was measured three times weekly. Tumor sizeand KaplanMeyer survival analysis of time to reach tumor si-ze = 750 mm 3 were used as endpoints. This size was chosen ascut-off value as many tumors had a tendency to ulcerate whenthey became larger. Mean growth curves were calculated until

more than 20% of the mice in each group had exceeded maximumallowed tumor size (1000 mm 3). Since mice with tumors exceeding1000 mm 3 had to be terminated according to our guidelines thelast observation was carried forward for mice terminated due to

tumor size exceeding 1000 mm 3 before the analysis of mean tumorsize was carried out.

2.7. Statistics

A two-sided, unpaired,equalvarianceStudents t test was usedtocompare the mean tumor size between groups and to compare cell

counts between mice treated with vehicle and test compound. Thelog-rank test was used to compare KaplanMeyer survival curves.

3. Results

3.1. Chemotherapy-induced lymphocytopenia in mice

The effect of cytostatics injection on the number of circulatingblood lymphocytes was measured by ow cytometry on bloodsamples drawn from mice treated with a panel of cytostatics. Theabsolute number of CD4 + T cells (dened as TCR- b+CD4 +), CD8 + Tcells (dened as TCR- b+CD8 +), B cells (dened as TCR- b CD19 +)and NK cells (dened as TCR- b NK1.1 +) were measured at denedtime points. In the section below the results are presented sepa-

rately for each drug. IL-21 administration up to 50 l g/mouse didnot have any measurable effect on the above lymphocyte subsetsat 24 h up to 7 days after administration (unpublished data). Wehave therefore administered the chemotherapies only as mono-therapy assuming that IL-21 would not substantially changecounts when given in combination with chemotherapy.

3.1.1. Pegylated liposomal doxorubicin (PLD)PLD is a pegylated liposomal formulation of doxorubicin used

among others for the treatment of ovarian cancer. In C57Bl/6 micea single dose of 200 l g/mouse (approximately 8 mg/kg) resulted ina decrease to 6070% of controls in the circulating CD4 + and CD8 + Tcells on day 3 (CD8: p < 0.01 and CD4: p = 0.064 vs vehicle) withfull recovery on day 7. B cells and NK cells decreased to 4050%

of controls ( p < 0.001 vs vehicle on day 3, 7 and 14 [B cells] andday 1 and 3 [NK cells]) but returned to baseline after 23 weeks(Fig. 1 b). At 30 l g/mouse (approximately 1.2 mg/kg), only a minor,non-signicant decrease in lymphocyte counts was observed

0%

50%

100%

150%

200%

250%

Day

% o

f v e

h i c l e

CD19

CD4

CD8NK1.1

0%

20%

40%

60%

80%

100%

120%

140%

Day

0%

20%40%60%80%

100%120%

140%160%

180%

Day

0%

20%

40%

60%

80%

100%

120%

140%

Day

0%

20%

40%60%

80%

100%

120%140%160%

180%

Day

0%

20%

40%

60%

80%

100%

120%

140%

Day

0%

20%

40%

60%

80%

100%

120%

140%160%

180%

Day

PLD, 30 g/mouse PLD, 200 g/mouse

C 5 7 B l / 6

B a

l b / c

Irino tecan, 150 mg/kg 5-FU, 50 mg/kg

5-FU

Legend:

dcba

4=n7=n7=n7=n

3=n3=n3=n

% o

f v e

h i c l e

% o

f v e

h i c l e

0 7 14 21 28 0 7 14 21 28 0 7 14 21 28 0 7 14 21 28

0 7 14 21 28 0 7 14 21 28 0 7 14 21 28

Fig. 1. Transient lymphopenia induced by PLD, irinotecan and 5-FU. Vehicle (isotonic NaCl) or 30 l g/mouse PLD (a), 200 l g/mouse PLD (b), 150 mg/kg irinotecan (c) or50 mg/kg 5-FU (d) was injected intravenously (PLD) or intraperitoneally (irinotecan and 5-FU) in C57Bl/6 mice (upper panel) and Balb/c (lower panel, only PLD and

irinotecan) miceon day 0. Injection of 5-FUwas repeatedon day 1. The absolute numbers of CD4 +, CD8 +, NK1.1 + andCD19 + lymphocytes were measured in theblood samplesdrawn pre-dose and day 1, 3, 7, 14, 21 and 28 by ow cytometry. The data have been normalized to vehicle-treated mice. Error bars are SEM.

K. Skak et al./ Cytokine 48 (2009) 231238 233

8/6/2019 avi1-1

4/8

(Fig. 1 a). The effect of PLD was compared between C57Bl/6 andBalb/c mice. No difference between the strains was found at200 l g/mouse. Due to the lack of the NK1.1 molecule in Balb/cmice NK cells were not measured in this mouse strain.

3.1.2. IrinotecanAfter a single injection of 150 mg/kg irinotecan into C57Bl/6

mice, lymphocyte counts decreased to 60% of controls on day 1after dosing ( p < 0.01 vs vehicle for all subsets) with full recoveryaround day 37. The effect of irinotecan was more profound inBalb/c mice ( Fig. 1 c) leading to lower counts (2848% of controls, p < 0.05 vs vehicle on day 3 for all subsets and day 1 for B cellsonly) and slower recovery.

3.1.3. 5-FU At50 mg/kggivenontwo consecutivedaysa small (2746%) drop

in all lymphocyte subsets was observed on day 3 (day 1 and 3: p < 0.05 vs vehicle for B and NK cells), with rebound effect reaching200% of controls on day 14 for B and T cells ( p < 0.05 vs vehicle)and 150% of controls for NK cells (non-signicant) ( Fig. 1 d).

3.1.4. OxaliplatinAt a dose of 5 mg/kg a decrease to 5070% of controls was ob-served for all subsets on day 7 (day 3 and 7: p < 0.05 vs vehiclefor all subsets), full recovery (B cells and NK cells) or partial recov-ery (T cells) was observed on day 21 ( Fig. 2 a). No signicant effectwas observed at 1 mg/kg except an increase in NK cells day 7( p < 0.001 vs vehicle). At 10 mg/kg a much more profound lympho-penia was observed. T cell numbers were decreased to 2535% of controls on day 1 (day 1: p < 0.01 and day 3: p < 0.001 vs vehiclefor all subsets) with partial recovery on day 7 ( p < 0.05 vs vehiclefor all subsets). B cells and NK cells decreased to 6% of controlsat day 7, at which time point the mice had to be terminated dueto weight loss and toxicity induced by oxaliplatin.

3.2. Antitumor effect of IL-21 in mice treated with chemotherapy

Chemotherapymayinterferewithimmunotherapydueto thead-verse effect of many chemotherapies on the hematopoietic system

and immune function. We wanted to test whether IL-21 treatmentwouldpreserve itsantitumoreffect inmice treatedwithchemother-apy. To this end we used the subcutaneous RenCa renal cell carci-noma and B16 melanoma tumor models, as previous studies haveshown that IL-21 has antitumor effect in both these syngeneicmouse tumor models [7] . We tested the effect of IL-21 therapy incombinationwithPLD andirinotecan inbothRenCa andB16 models,andadditionally incombinationwithoxaliplatinand 5-FUin theRe-nCa model. Our results above show that for all chemotherapies ex-cept oxaliplatin circulating T lymphocyte numbers werenormalized 7 days after chemotherapy treatment. Since timing of immunotherapy relative to the chemotherapy may be crucial forsuccess, the possible additive effect of IL-21 and chemotherapywas tested in two different schedules, where treatment with IL-21and chemotherapy were initiated either on the same day (early)or IL-21 therapywasinitiated 7 days after chemotherapy(late).Be-lowthe results are presented separately for each compound.

3.2.1. PLDSince this compound has a potent antitumor effect against Re-

nCa tumors, a dose-titration was initially performed to establisha dose where PLD would lead to partial inhibition of tumor growth.A single injection of PLD reduced growth of RenCa tumors dose-dependently, and treatment at small tumor size was more efcientthan treatment at larger tumor size ( Fig. 3 a). The highest dose(200 l g/mouse) led to partial regression and slow recovery,whereas the lower doses tested (20 and 50 l g/mouse) led to partialreduction in growth rate without any tumor regression. Based onthese results 30 l g/mouse of PLD was chosen in the followingstudy to give partial tumor inhibition.

The combination of IL-21 and PLD (30 l g/mouse) was tested intheRenCa tumor model. Compared to PLDas singletherapy, a signif-icant additive antitumoreffectwas obtainedwhenIL-21therapy wasinitiated one week after PLD injection ( Fig. 3 b). A small, non-signi-cant reduction in tumor growth was observed when IL-21 therapywas initiated on the same day as PLD injection. A similar study wassubsequently performed in the B16 model. Since these tumors aremuch more resistant to PLD therapy than RenCa tumors (data notshown) the mice were treated with 200 l g/mouse PLD. This studyshowed a similar additive effect of IL-21 in the B16 model as in theRenCa model, with the late IL-21 treatment being superior to earlyIL-21treatment( Fig.3 c).Thus,we concludethat IL-21andPLDhas anadditive antitumor effect in both B16and RenCa models.

3.2.2. IrinotecanA pilot study showed that only administration of irinotecan at

the MTD (150 mg/kg) resulted in a minor reduction in tumorgrowth ( Supplementary Fig. 1a). This dose was selected for thecombination studies.

Two combination studies were performed in the RenCa model

and one study in the B16 model. In all experiments the mice re-ceived a single injection of 150 mg/kg irinotecan. Whereas IL-21alone reduced the growth of both RenCa and B16 tumors, irinotec-an given in combination with IL-21 did not inhibit tumor growthcompared to either compound alone; only irinotecan + IL-21 latehad a small, non-signicant effect on tumor growth ( Fig. 4 ). Thus,there was no additive antitumor effect of irinotecan and IL-21 inthe B16 and RenCa models.

3.2.3. OxaliplatinA titration study was performed to establish the optimal dose of

oxaliplatin in Balb/c mice (data not shown). Based on this study5 mg/kg oxaliplatin was established as MTD in mice and chosenfor combination studies with IL-21. The combination of oxaliplatin

and IL-21 was performed in the RenCa tumor model. In this exper-iment both combination regimens reduced tumor growth com-

0%

20%

40%

60%

80%

100%

120%

% o

f v e

h i c l e

CD19

CD4

CD8NK1.1

0%20%40%60%80%

100%120%140%160%180%200%

0 7 14 21 28 0 7 14 21 28

0%

20%

40%

60%

80%100%120%

140%

160%

180%

Oxaliplatin

Legend:

a

4=n4=n

n=4

1 mg/kg

5 mg/kg

10 mg/kg

% o

f v e

h i c l e

% o

f v e

h i c l e

Day

Day

0 7 14 21 28

Fig. 2. Oxaliplatin induces transient, dose-dependent lymphopenia. Vehicle (iso-tonic NaCl) or oxaliplatin was injected intravenously in C57Bl/6 mice on day 0. Theabsolute numbers of CD4 +, CD8 +, NK1.1 + and CD19 + lymphocytes were measured in

the blood samples drawn pre-dose and day1, 3, 7, 14, 21 and 28 by owcytometry.The data have been normalized to vehicle-treated mice. Error bars are SEM.


8/6/2019 avi1-1

5/8

pared to oxaliplatin alone, with the largest effect observed whenIL-21 therapy was initiated one week after oxaliplatin injection(Fig. 5 ). Thus, we conclude that oxaliplatin and IL-21 has additiveantitumor effect in the RenCa model.

3.2.4. 5-FU In the clinic 5-FU is normally administered as a bolus followed

by 48 h infusion. In order to mimic this regimen we administered5-FU as a once daily injection on two consecutive days. A dose-titration of 5-FU in the RenCa model showed a small antitumor ef-

fect at the highest dose tested, 50 mg/kg per injection ( Supplemen-tary Fig. 1b). This dose was used in the following combinationstudy in the RenCa model. For technical reasons the group treatedwith IL-21 alone was not included in this experiment. In the 5-FU + IL-21 late group a reduction in tumor size up to 75% com-pared to 5-FU alone was observed ( Fig. 6 ). In the KaplanMeyersurvival analysis of time to reach tumor volume = 750 mm 3 , 5-FU + IL-21 late therapy signicantly increased survival time com-pared to 5-FU alone, whereas the difference in tumor volume wasnon-signicant. It should be noted that in this experiment varia-tion was high and the group size was small ( N = 710 mice).

3.3. Effect of chemotherapeutics and IL-21 on regulatory T cells

Theadditive effect ofoxaliplatin, PLDand5-FU combinedwith IL-21couldbe due to a decrease in regulatory T cells (Tregs). To investi-

gatewhether treatment with chemotherapeuticsor IL-21 affect Tregnumbers we injected these drugs in mice and subsequently moni-tored the circulating numbers of Treg cells over a 4 week period. Aminor, non-signicant decrease in CD4 +CD25 +Foxp3 + Treg cells wasobserved around day7 after injectionof thechemotherapies, consis-tent with a general decrease inCD4 + T cells,( Fig. 7 a).IL-21 did not af-fect the numberof circulating Treg cells ( Fig. 7 a) nor did it affect thenumbers of CD4 + andCD8 + T cells in the blood (data not shown).

In the same experiment we also monitored circulating granulo-cytes and monocytes. Here, oxaliplatin treatment resulted in 3-fold

increase in neutrophils on day 7 whereas 5-FU led to profound neu-tropenia on day 7 leading to subsequent recovery day 14 slightlyabove baseline. PLD led to 7090% increase in granulocyte numbersfromday 7 (non-signicant)whereasIL-21did notaffectgranulocytenumbers ( Fig. 7 b). Both oxaliplatin and 5-FU led to an initial reduc-tion in monocytes which subsequently recovered beyond baseline.PLD led to an approximately 3-fold increase in monocyte numbersfrom day 7 whereas IL-21did not affect monocyte numbers ( Fig.7 c).

A comparison between spleen and blood on day 7 showed thatthe relative effect of the drugs compared to vehicle was similar inspleen and blood (data not shown).

3.4. IL-21 mediated upregulation of granzyme B mRNA in CD8 + T-cells

To examine whether the chemotherapeutic compounds sup-pressed IL-21 mediated effects in a relevant immune-cell subset,

0 5 10 15 20 25 30 35 40 450

250

500

750

1000

Control20 g PLD d950 g PLD d9

100 g PLD d9100 g PLD d16200 g PLD d16PLD

PLD

Days after tumor inoculation

T u m o r v o

l u m e

( m m

3 )

0 10 20 30 40 500

25

50

75

100VehiclePLD + PBSVehicle + mIL-21 d4-8PLD + mIL-21 d4-8PLD + mIL-21 d11-15


% m

i c e w

i t h t u m o r s

< 7 5 0 m m

3

0 5 10 15 20 250

250

500

750

1000

1250

1500

PLD


T u m o r v o

l u m e

( m m

3 )

0 10 20 30 40 500

250

500

750

1000

PLD


T u m o r v o

l u m e

( m m

3 )

0 20 40 60 800

20

40

60

80

100VehiclePLD + PBSVehicle + mIL-21 d10-14PLD + mIL-21 d10-14PLD + mIL-21 d17-21


% m

i c e w

i t h t u m o r s

< 7 5 0 m m

3

* **

* #

**

a

b

c

Fig. 3. Additive antitumoreffectof PLDand IL-21 in theRenCa model. (a)RenCa cells were injected s.c. on day0. PLD wasinjectedintravenously at theindicated doses on day9 or 16. N = 5. (b) RenCa cells were injected s.c. on day 0. PLD (30 l g/mouse) or vehicle was injected intravenously on day 10. Murine IL-21 (50 l g/injection) or PBS was

administered s.c. daily for 5 days on the days shown. N = 11. (c) B16 cells were injected s.c. on day 0. PLD (200 l g/mouse) or vehicle was injected intravenously on day 4.Murine IL-21 (50 l g/injection) or PBS was administered s.c. daily for 5 days on the days shown. N = 10. Tumors were measured thrice weekly and the volume was calculated.The charts to the left show mean tumor size, whereas the charts to the right show KaplanMeyer survival analysis of mice with tumors

8/6/2019 avi1-1

6/8

we analyzed the mRNA expression of the cytotoxic effector mole-cule granzyme B (GZMB) in MACS-sorted CD8 + T cells from spleens.Mice were dosed with 5-FU, oxaliplatin, irinotecan, or PLD on day0, and IL-21 orvehiclewasinjected at day 1, 3, 7 or 14. The effect of IL-21 dosing was analyzed 4 h after injection of IL-21 ( Fig. 8 ). TheGZMB mRNA levels were very low in the PBS injected groups,

and clearly upregulated after 4 h in all of the IL-21 dosed groups(on average $ 8-fold upregulation). When comparing the GZMBmRNA levels in the IL-21 dosed groups, there were generally nosignicant differences between the control group (receiving nochemotherapy), and the chemotherapeutics dosed groups. Theonlytwogroups whichwere found to be marginally suppressed was theirinotecan dosed group at day 3 and the 5-FU dosed group at day 1( p

< 0.05 with no correction for multiple testing). In the PLD dosedgroup a trend towards increasing responses to IL-21 was observedat day 7 and 14 after compound injection.

4. Discussion

Chemotherapy has a long history in the treatment of cancer, butso far it is only in a few indications that these agents can cure can-cer. Immunotherapy is another approach that has proven success-ful in some clinical trials, but is still only used in certain narrowindications. Combining immunotherapy with chemotherapy hasusually been considered unfeasible due to the known suppressiveeffects of many chemotherapies on the bone marrow, although, agrowing body of evidence is emerging that these modalities maycomplement rather than antagonize each other [15,18] .

In this study we demonstrate an additive antitumor effectin vivo of IL-21 in combination with chemotherapeutic agents withdifferent mechanisms of action, i.e. topoisomerase II inhibitingdrugs (PLD), anti-metabolites (5-FU) and platinum analogs (oxa-liplatin) provided that IL-21 therapy is delayed relative to chemo-therapy. To investigate the possible antitumor effect of combiningIL-21 therapy with chemotherapy we used the subcutaneous Re-nCa renal cell carcinoma and B16 melanoma tumor models. Thesecell lines were chosen since they have both proven to be respon-sive to IL-21 therapy in vivo [7] . Generally, IL-21 dosing initiated7 days after chemotherapy showed improved antitumor efcacycompared to IL-21 therapy initiated simultaneously with chemo-therapy. The antitumor activity of IL-21 has generally been as-

0 5 10 15 200

200

400

600

800

1000

1200

1400

VehicleIrinotecan + PBSVehicle + mIL-21 d3-6Irinotecan + mIL-21 d3-6+11-14Irinotecan + mIL-21 d13-17

Irinotecan

0 5 10 15 20 25 300

100

200

300

400

500

600

700

VehicleIrinotecan + PBSVehicle + mIL-21 d11-15Irinotecan + mIL-21 d11-15Irinotecan + mIL-21 d15-21

Irinotecan


RenCa tumors

B16 tumors

T u m o r v o

l u m e

( m m

3 )

T u m o r v o

l u m e

( m m

3 )

Fig. 4. No additive antitumor effect of irinotecan and IL-21. (a) RenCa cells were

injected s.c. on day 0. Irinotecan (150 mg/kg) or vehicle was injected intraperito-neally on day 11. Murine IL-21 (50 l g/injection) or PBS was administered s.c. dailyfor 5 days as indicated. N = 12. The data shown are representative of twoindependent experiments. (b) B16 cells were injected s.c. on day 0. Irinotecan(150 mg/kg) or vehicle was injected intravenously on day 3. Murine IL-21 (50 l g/injection) or PBS was administered s.c. daily as indicated. N = 1012. The chartsshow the mean tumor size. Error bars are SEM.

0 10 20 30 400

200

400

600

800

Oxaliplatin


T u m o r v o

l u m e

( m m

3 )

**

* *

*****0 10 20 30 40 50 60 70

0

25

50

75

100


% m

i c e w

i t h t u m o r s

< 7 5 0 m m

3

VehicleOxaliplatin + PBSVehicle + mIL-21 d8-12Oxaliplatin + mIL-21 d8-12Oxaliplatin + mIL-21 d15-19

Fig. 5. Additive antitumor effect of oxaliplatin and IL-21. RenCa cells were injected s.c. on day0. Oxaliplatin (5 mg/kg) or vehicle wasinjected intravenously on day8. MurineIL-21 (50 l g/injection) or PBS was administered s.c. daily for 5 days on the days shown. The left chart shows mean tumor size. The right chart shows KaplanMeyer survivalanalysis of mice with tumors

8/6/2019 avi1-1

7/8

cribed to costimulation and expansion of antigen-specic T cells aswell as costimulation of NK cell activity [8,11,19] . A possible expla-nation for our ndings is the fact that chemotherapy induces shortterm immune suppression which may be harmful to the effect of IL-21, whereas at a later stage the immune system may recover,and dying tumor cells may facilitate presentation of tumor anti-gens and activation of phagocytes and DCs leading to augmentedantitumor T cell responses, which can be enhanced by IL-21 ther-apy. This explanation is supported by our differential lymphocytecounts, which showed varying degrees of lymphopenia after injec-

tion of the chemotherapeutics but generally returned to normal orslightly above normal levels approx. 7 days post injection, with the

exception of oxaliplatin given at 10 mg/kg, which was discontin-ued due to associated toxicity.

Our results suggest that the antitumor effect of chemotherapyand IL-21 is not related to their effect on monocytes and granulo-cytes. Thus on day 7, the optimal time point for combination ther-apy, 5-FU had opposite effect on monocytes and granulocytesnumbers compared to PLD and oxaliplatin, and IL-21 did not haveany effect at all. T cells generally appeared to recover faster fromthe treatment than B and NK cells, whichmay be important consid-ering that the primary antitumor effect of IL-21 is through activa-tion of CD8 + T cells. Treatment with 5-FU even caused B and T cellnumbers to increase following an initial drop, suggesting that 5-FUcould have a benecial effect on lymphocytes. Considering themodest decrease in lymphocyte numbers observed after chemo-therapy it is not likely that the lymphopenia per se will confoundthe effect of IL-21 therapy, especially if IL-21 is given after the na-dir. Also, we did not observe a signicant change in the number of circulating Tregs following chemotherapy or IL-21 injection, so theantitumor effect of the compounds is not likely to be caused by acontraction of Tregs. Rather, it is possible that in the recoveryphase following the modest lymphopenia, homeostatic prolifera-tion may produce memory-like T cells. This process may be rein-forced by IL-21 therapy, leading to enhanced T cell activity, asdemonstrated in a study where IL-21 was shown to enhancehomeostatic proliferation leading to rapid T cell turnover and auto-immunity [20] . Thus, the ability of IL-21 to promote homeostaticproliferation may contribute to the antitumor activity of IL-21.Establishing similar kinetics of chemotherapy-induced lymphope-nia in humans may be important to clinically translate our results.

In contrast to these results, combining IL-21 with the topoiso-merase I inhibitor irinotecan produced no additive effect or evenan antagonizing effect of IL-21 even with postponed initiation of IL-21, suggesting a negative impact of irinotecan on the target cells.As with the other chemotherapies, T cell numbers were almostback to normal 7 days after irinotecan injection; nevertheless iri-notecan inhibited the antitumor effect of IL-21 therapy initiated7 days after irinotecan injection. It is possible that the initial de-cline in lymphocytes is reducing the responsiveness to IL-21, butthe fact that the antitumor effect of IL-21 was lost in mice treatedwith irinotecan suggests that not only the number of circulatinglymphocytes is important for the antitumor effect of IL-21. There-fore, we also addressed whether the immune cells may be func-tionally impaired after exposure to certain chemotherapeutics,leading to a longer lasting unresponsiveness to IL-21 stimulation.Previously, we have demonstrated that GZMB mRNA was upregu-lated in CD8 + T cells and CD56 + NK cells frommetastatic melanomapatients administered with recombinant human IL-21 [12,21] , andhenceused this biologically relevant marker in the present study toexamine whether the chemotherapeutic compounds suppressedIL-21-induced activation of CD8 + T cells. The strong IL-21 mediated

upregulations of GZMB mRNA in CD8+

T cells observed in all treat-ment groups suggests that the ability of the CD8 + T-lymphocytes torespond to IL-21 was intact after administration of chemotherapy.Thus, our observed differences in antitumor activity of the variouscombinations of IL-21 and chemotherapy must be due to otherparameters. Obviously, there might still be differences in the spe-cic immunomodulatory effects of the chemotherapeutics usedhere, which have to be determined.

Differences in the immunogenicity of dying tumor cells inducedby the various chemotherapeutics could be another important fac-tor [22] . Here, doxorubicin, the active component of PLD, has beenthoroughly studied and showed superior induction of immuno-genic cell death when compared to a panel of distinct chemother-apies [23] . Furthermore, tumor cell death induced by doxorubicin

as well as oxaliplatin has also been shown to boost tumor immuneresponses via stimulation of TLR-4 [24] . In combination with IL-2,

0%

20%

40%

60%

80%

100%

120%

140%

160%

% o

f v e

h i c l e

% o

f v e

h i c l e

0%

50%

100%

150%

200%

250%

300%

350%

0%

50%100%

150%

200%250%

300%

350%400%

450%Granulocytes

Legend:PLD, 30 g/mouse5-FU, 50 mg/kg x 2Oxaliplatin, 5 mg/kgIL-21, 50 g/mouse

a

n=4

Monocytescb

DayDay

Treg

***

***

** *

**

** * ***

0 7 14 21 280 7 14 21 28

0 7 14 21 28

Fig. 7. Effect of chemotherapy on granulocytes and monocytes but not Tregs.Vehicle (isotonic NaCl), PLD, oxaliplatin, 5-FU or IL-21 was injected in C57Bl/6 onday 0. The absolute numbers of CD4 +CD25 +Foxp3 + Tregs (a), granulocytes (b) andmonocytes (c)were measured in theblood samples drawn pre-dose andon day1, 3,7, 14, 21 and 28 by ow cytometry. The data have been normalized to vehicle-treated mice. * p < 0.05, ** p < 0.01 and *** p < 0.001 vs vehicle by Students t test.Error bars are SEM.

Granzyme B mRNA in CD8+ cells

N o

C o m p o u n

d

1 ( 5 - F

U )

3 ( 5 - F

U )

7 ( 5 - F

U )

1 4 ( 5 - F

U )

1 ( O x a

l i p

l a t i n

)

3 ( O x a

l i p

l a t i n

)

7 ( O x a

l i p

l a t i n

)

1 4 ( O x a

l i p

l a t i n

)

1 ( I r i n o

t e c a n

)

3 ( I r i n o

t e c a n

)

7 ( I r i n o

t e c a n

)

1 4 ( I r i n o

t e c a n

)

1 ( P L D )

3 ( P L D )

7 ( P L D )

1 4 ( P L D )

0

1

2

3

4

5PBSIL21

Days after injection of chemo (compound)

G Z M B m

R N A ( 1 8 S n o r m a

l i z e

d )

Fig. 8. No chemotherapeutic impairment of IL-21 mediated granzyme B (GZMB)mRNA upregulation in CD8 + cells. GZMB mRNA was quantied by qRT-PCR in CD8 +

cells from mice ( N = 4) 4 h after s.c. administration with either PBS or murine IL-21(50 l g/injection). The effect of IL-21 dosing on GZMB mRNA levels was analyzed atday 1, 3, 7, and 14 after injection of either 5-FU, oxaliplatin, irinotecan, or PLD. Agroup receiving no chemotherapeutic compounds was included as a reference. All

GZMB levels were normalized to 18S, and mean values with SEM error bars areshown.

K. Skak et al./ Cytokine 48 (2009) 231238 237

8/6/2019 avi1-1

8/8

doxorubicin also resulted in immune mediated cures of metastaticmurine breast cancer [25] . Thus, the dissimilar effect of differentchemotherapies on the immunogenicity of dying tumor cells mayprovide an explanation to the different ability to provide additiveantitumor effects with IL-21, and furthermore this ability to induceimmunogenic cell death may to some extent counteract the ad-verse effect of chemotherapy on immune cells and bone marrow.

The chemotherapeutics combined with IL-21 in this study areused as monotherapy or in different combinations in the treatmentof various human solid tumors such as ovarian cancer and gastro-intestinal malignancies, whereas IL-21 primarily is expected to beused in indications with known immunotherapeutic success, i.e.melanoma and RCC. Immune surveillance mechanisms have alsobeen shown to be active in selective patients with ovarian, colorec-tal and esophageal cancer, and profoundly affected the naturalcourse and clinical outcome of these diseases [2630] . Thus, theseresults suggest that other indications may also be amenable to IL-21-mediated immunotherapy and/or chemo-immunotherapy. Aphase 1 trial combining recombinant human IL-21 with liposomaldoxorubicin in ovarian cancer patients is currently ongoing (clini-caltrials.gov identier NCT00523380).

In summary, we show that IL-21 can be successfully combinedwith certain chemotherapeutic agents without loosing its immunestimulating and antitumor activity, supporting clinical trials of thisconcept. Our data also highlight the importance of selecting theproper time point for commencing IL-21 therapy after chemother-apy, a notion which should be considered in future clinical trials.

Conict of interest

K.S., H.S. and K.S.F. are employees of Novo Nordisk A/S whosponsored this study and who has been involved in the develop-ment of IL-21 as oncology drug.

Acknowledgements

We thank Ann-Christin Lff, Semra Esiyok, Ken Heding, LeneNormann Nielsen, and Heidi Winther for technical assistance withthe experiments.

Appendix A. Supplementary data

Supplementary data associated with this article can be found, inthe online version, at doi:10.1016/j.cyto.2009.07.039 .

References

[1] Parrish-Novak J, Dillon SR, Nelson A, Hammond A, Sprecher C, Gross JA, et al.Interleukin 21 and its receptor are involved in NK cell expansion andregulation of lymphocyte function. Nature 2000;408:5763.

[2] CoquetJM, Kyparissoudis K, Pellicci DG, Besra G, Berzins SP, Smyth MJ, et al. IL-21 is produced by NKT cells and modulates NKT cell activation and cytokineproduction. J Immunol 2007;178:282734.

[3] Asao H, Okuyama C, Kumaki S, Ishii N, Tsuchiya S, Foster D, et al. Cutting edge:the common gamma-chain is an indispensable subunit of the IL-21 receptorcomplex. J Immunol 2001;167:15.

[4] Strengell M, Sareneva T, Foster D, Julkunen I, Matikainen S. IL-21 up-regulatesthe expression of genes associated with innate immunity and Th1 response. JImmunol 2002;169:36005.

[5] Brenne A, Ro TB, Waage A, Sundan A, Borset M, Hjorth-Hansen H. Interleukin-21 is a growth and survival factor for human myeloma cells. Blood2002;99:375662.

[6] Spolski R, Leonard WJ. Interleukin-21: basic biology and implications forcancer and autoimmunity. Annu Rev Immunol 2008;26:5779.

[7] Sndergaard H, Frederiksen KS, Thygesen P, Galsgaard ED, Skak K, KristjansenPE,et al. Interleukin 21 therapy increasesthe density of tumor inltrating CD8 +

T cells and inhibits the growth of syngeneic tumors. Cancer ImmunolImmunother 2007;56:141728.

[8] Zeng R, Spolski R, Finkelstein SE, Oh S, Kovanen PE, Hinrichs CS, et al. Synergyof IL-21 and IL-15 in regulating CD8 + T cell expansion and function. J Exp Med2005;201:13948.

[9] Brady J, Hayakawa Y, Smyth MJ, Nutt SL. IL-21 induces the functionalmaturation of murine NK cells. J Immunol 2004;172:204858.

[10] Wang G, Tschoi M, Spolski R, Lou Y, Ozaki K, Feng C, et al. In vivo antitumoractivity of interleukin 21 mediated by natural killer cells. Cancer Res2003;63:901622.

[11] Moroz A, Eppolito C, Li Q, Tao J, Clegg CH, Shrikant PA. IL-21 enhances andsustains CD8 + T cell responses to achieve durable tumor immunity:comparative evaluation of IL-2, IL-15, and IL-21. J Immunol 2004;173:9009.

[12] Davis ID, Skrumsager BK, Cebon J, Nicholaou T, Barlow JW, Moller NPH,et al. An open-label, two-arm, phase I trial of recombinant humaninterleukin-21 in patients with metastatic melanoma. Clin Cancer Res2007;13:36306.

[13] Thompson JA, Curti BD, Redman BG, Bhatia S, Weber JS, Agarwala SS, et al.Phase I study of recombinant interleukin-21 in patients with metastaticmelanoma and renal cell carcinoma. J Clin Oncol 2008;26:20349.

[14] Davis ID, Brady B, Kefford RF, Millward M, Cebon J, Skrumsager BK, et al.Clinical and biological efcacy of recombinant human interleukin-21 inpatients with stage IV malignant melanoma without prior treatment: aphase IIa trial. Clin Cancer Res 2009;15:21239.

[15] Lake RA, Robinson BW. Immunotherapy and chemotherapy a practicalpartnership. Nat Rev Cancer 2005;5:397405.

[16] Fujii S, Shimizu K, Smith C, Bonifaz L, Steinman RM. Activation of naturalkiller T cells by alpha-galactosylceramide rapidly induces the fullmaturation of dendritic cells in vivo and thereby acts as an adjuvant forcombined CD4 and CD8 T cell immunity to a coadministered protein. J ExpMed 2003;198:26779.

[17] Giaccone G, Punt CJ, Ando Y, Ruijter R, Nishi N, Peters M, et al. A phase I studyof the natural killer T-cell ligand alpha-galactosylceramide (KRN7000) inpatients with solid tumors. Clin Cancer Res 2002;8:37029.

[18] Zitvogel L, Apetoh L, Ghiringhelli F, Kroemer G. Immunological aspects of cancer chemotherapy. Nat Rev Immunol 2008;8:5973.

[19] Kasaian MT, Whitters MJ, Carter LL, Lowe LD, Jussif JM, Deng BJ, et al. IL-21limits NK cell responses and promotes antigen-specic T cell activation: amediator of the transition from innate to adaptive immunity. Immunity2002;16:55969.

[20] King C, Ilic A, Koelsch K, Sarvetnick N. Homeostatic expansion of T cells duringimmune insufciency generates autoimmunity. Cell 2004;117:26577.

[21] Frederiksen KS, Lundsgaard D, Freeman JA, Hughes SD, Holm TL, SkrumsagerBK,et al. IL-21 induces in vivo immuneactivation of NKcells andCD8(+) T cellsin patients with metastatic melanoma and renal cell carcinoma. CancerImmunol Immunother 2008;57:143949.

[22] Lake RA, van der Most RG. A better way for a cancer cell to die. N Engl J Med2006;354:25034.

[23] Obeid M, Tesniere A, Ghiringhelli F, Fimia GM, Apetoh L, Perfettini JL, et al.Calreticulin exposure dictates the immunogenicity of cancer cell death. NatMed 2007;13:5461.

[24] Apetoh L, Ghiringhelli F, Tesniere A, Obeid M, Ortiz C, Criollo A, et al. Toll-likereceptor 4-dependent contribution of the immune system to anticancerchemotherapy and radiotherapy. Nat Med 2007;13:10509.

[25] Ewens A, Luo L, Berleth E, Alderfer J, Wollman R, Hafeez BB, et al. Doxorubicinplus interleukin-2 chemoimmunotherapy against breast cancer in mice.Cancer Res 2006;66:541926.

[26] Coukos G, Conejo-Garcia JR, Roden RBS, Wu TC. Immunotherapy forgynaecological malignancies. Expert Opin Biol Ther 2005;5:1193210.

[27] Zhang L, Conejo-Garcia JR, Katsaros D, Gimotty PA, Massobrio M, Regnani G,et al. Intratumoral T cells, recurrence, and survival in epithelial ovarian cancer.N Engl J Med 2003;348:20313.

[28] Naito Y, Saito K, Shiiba K, Ohuchi A, Saigenji K, Nagura H, et al. CD8 + T cellsinltrated within cancer cell nests as a prognostic factor in human colorectalcancer. Cancer Res 1998;58:34914.

[29] Galon J, Costes A, Sanchez-Cabo F, Kirilovsky A, Mlecnik B, Lagorce-Pages C,et al. Type, density, and location of immune cells within human colorectaltumors predict clinical outcome. Science 2006;313:19604.

[30] Schumacher K, Haensch W, Roefzaad C, Schlag PM. Prognostic signicance of activated CD8 + T cell inltrations within esophageal carcinomas. Cancer Res2001;61:39326.

http://dx.doi.org/10.1016/j.cyto.2009.07.039http://dx.doi.org/10.1016/j.cyto.2009.07.039

avi1-1

Documents