base mutations on protein function and phenotypes
TRANSCRIPT
![Page 1: Base Mutations on Protein Function and Phenotypes](https://reader038.vdocument.in/reader038/viewer/2022102818/56649d125503460f949e5b21/html5/thumbnails/1.jpg)
Base Mutations on Protein Function and
Phenotypes
![Page 2: Base Mutations on Protein Function and Phenotypes](https://reader038.vdocument.in/reader038/viewer/2022102818/56649d125503460f949e5b21/html5/thumbnails/2.jpg)
Polypeptides made up of amino acids Proteins are polypeptides, numerous amino
acids
First Recall Proteins------
**Peptide Bond between amino acids
**Notice the “R” group. It’s a group of molecules that determines the amino acid.
![Page 3: Base Mutations on Protein Function and Phenotypes](https://reader038.vdocument.in/reader038/viewer/2022102818/56649d125503460f949e5b21/html5/thumbnails/3.jpg)
The amino acid sequence determines the protein!! Shape-specific
Example - The sequence for a specific enzyme will be totally different from that of a hormone!
Amino Acid Sequence - Polypeptide
Human Growth HormoneAmylase Enzyme
![Page 4: Base Mutations on Protein Function and Phenotypes](https://reader038.vdocument.in/reader038/viewer/2022102818/56649d125503460f949e5b21/html5/thumbnails/4.jpg)
Basic Types of Proteins
![Page 5: Base Mutations on Protein Function and Phenotypes](https://reader038.vdocument.in/reader038/viewer/2022102818/56649d125503460f949e5b21/html5/thumbnails/5.jpg)
Forms part of cell materials Provides support
fibrous and stringy and provide support. Examples: Keratins strengthen protective coverings such as hair, quills, feathers, horns, and beaks. include keratin
Collagen, and elastin are examples. Collagens and elastin provide support for connective tissue such as tendons and ligaments.
Structural Proteins
![Page 6: Base Mutations on Protein Function and Phenotypes](https://reader038.vdocument.in/reader038/viewer/2022102818/56649d125503460f949e5b21/html5/thumbnails/6.jpg)
Hormones – Chemical Signals released by a cell or a gland in one part of the body that sends out messages that affect cells in other parts of the organism
Growth and development Metabolism - how your body gets energy from the foods you eat Sexual function Reproduction Mood
Enzymes – catalyze chemical reactions. Example – Amylase is the enzyme that breaks starches in
your mouth. Speeds up the rate of digestion. Nearly all biochemical reactions require them!
Functional Proteins
![Page 7: Base Mutations on Protein Function and Phenotypes](https://reader038.vdocument.in/reader038/viewer/2022102818/56649d125503460f949e5b21/html5/thumbnails/7.jpg)
** Newly synthesized DNA is EXACTLY the same as the parent DNA……or is it??
![Page 8: Base Mutations on Protein Function and Phenotypes](https://reader038.vdocument.in/reader038/viewer/2022102818/56649d125503460f949e5b21/html5/thumbnails/8.jpg)
Remember that DNA is replicated during the S phase of Interphase of the cell cycle and during Meiosis (the formation of gametes)
Mutations may or may not change the function of a protein
May change phenotype or how a gene is expressed
Example: brown hair is a phenotype, sickle cell anemia is a phenotype, dwarfism is a phenotype
Mistakes Can Occur!!
![Page 9: Base Mutations on Protein Function and Phenotypes](https://reader038.vdocument.in/reader038/viewer/2022102818/56649d125503460f949e5b21/html5/thumbnails/9.jpg)
***Errors usually occur during DNA replication and transcription by external agents called mutagens (chemicals, radiation, X-rays etc.)
***Some occur randomly and some phenotypes are selected for in nature
***Although mutations can cause problems, if it weren’t for mutations, we wouldn’t have new genes such as those for green eyes
Mutations
![Page 10: Base Mutations on Protein Function and Phenotypes](https://reader038.vdocument.in/reader038/viewer/2022102818/56649d125503460f949e5b21/html5/thumbnails/10.jpg)
Enzymes proofread as bases are paired during replication and replace those wrongly paired
Other enzymes police the replication process
But…………
“Fixing” Errors
![Page 11: Base Mutations on Protein Function and Phenotypes](https://reader038.vdocument.in/reader038/viewer/2022102818/56649d125503460f949e5b21/html5/thumbnails/11.jpg)
May be random or spontaneous. When genes have an error in their DNA code, they
may not work properly, and are said to be "altered" or mutated.
DNA damage from environmental agents such as radiation (sunlight), nuclear radiation, some viruses, some chemicals, genetics, inflammation, infection
Mistakes that occur when a cell copies its DNA in preparation for cell division.
Can occur during meiosis (making of sperm, and egg) Changes mRNA codons
Mutations Change a DNA Sequence and May Affect a
Gene
![Page 12: Base Mutations on Protein Function and Phenotypes](https://reader038.vdocument.in/reader038/viewer/2022102818/56649d125503460f949e5b21/html5/thumbnails/12.jpg)
Mismatched Base Pair Can Occur – Usually Random
![Page 13: Base Mutations on Protein Function and Phenotypes](https://reader038.vdocument.in/reader038/viewer/2022102818/56649d125503460f949e5b21/html5/thumbnails/13.jpg)
Spontaneous Mutations Environmental agents such as nuclear radiation can damage DNA by breaking bonds between nucleotides on either side of the DNA molecule can occur
![Page 14: Base Mutations on Protein Function and Phenotypes](https://reader038.vdocument.in/reader038/viewer/2022102818/56649d125503460f949e5b21/html5/thumbnails/14.jpg)
Some mutated cells will be defeated by the body's immune system
others may undergo apoptosis, or “cell suicide”. occasionally a cell with mutations slips through
proofreading safeguards. When mutations accumulate, the genetic material is so
scrambled that the cell no longer acts like a normal, healthy cell.
Tumors, mass of cells that have no purpose, may form
Mutated Cells
![Page 15: Base Mutations on Protein Function and Phenotypes](https://reader038.vdocument.in/reader038/viewer/2022102818/56649d125503460f949e5b21/html5/thumbnails/15.jpg)
Not malignant tumor (cancerous) Does not invade nearby tissue or spread to other parts of
the body the way cancer can. But benign tumors can be serious if they press on vital
structures such as blood vessels or nerves. Some, such as colon polyps, can become cancerous
Benign Tumors (non-cancerous)
![Page 16: Base Mutations on Protein Function and Phenotypes](https://reader038.vdocument.in/reader038/viewer/2022102818/56649d125503460f949e5b21/html5/thumbnails/16.jpg)
Abnormal cells grow uncontrolled Invades surrounding tissues Usually capable of producing metastases
(spread to other organs) May recur after attempted removal May cause death of the host unless
adequately treated
Cancerous Tumor (malignant)
![Page 17: Base Mutations on Protein Function and Phenotypes](https://reader038.vdocument.in/reader038/viewer/2022102818/56649d125503460f949e5b21/html5/thumbnails/17.jpg)
Mutations and Reproduction**Mutations can occur during meiosis, the
making of sperm or egg and can be passed along to offspring
**Example: Achonroplasia is a type of dwarfism that can come from a mutation during sperm
formation**The mutation may produce a new trait
(good OR bad) .
![Page 18: Base Mutations on Protein Function and Phenotypes](https://reader038.vdocument.in/reader038/viewer/2022102818/56649d125503460f949e5b21/html5/thumbnails/18.jpg)
Types of Base Mutations
** Point mutations, base substitution, affects a single base
**Frameshift – Addition or deletion of a base – Affects entire protein
![Page 19: Base Mutations on Protein Function and Phenotypes](https://reader038.vdocument.in/reader038/viewer/2022102818/56649d125503460f949e5b21/html5/thumbnails/19.jpg)
Base Pair Substitution – AKA Point Mutation
![Page 20: Base Mutations on Protein Function and Phenotypes](https://reader038.vdocument.in/reader038/viewer/2022102818/56649d125503460f949e5b21/html5/thumbnails/20.jpg)
Affects a single base and change the codon
May or may not affect the amino acid Sometimes if the third base of the codon
changes, the amino acid may stay the same!
UCU UCC UCA UCG
Point Mutations
ALL code for Ser
![Page 21: Base Mutations on Protein Function and Phenotypes](https://reader038.vdocument.in/reader038/viewer/2022102818/56649d125503460f949e5b21/html5/thumbnails/21.jpg)
TACCAGGATTAACATGGAAGTGTAATCAUGGUCCUAAUUGUACCUUCACAUUAG
Met Val (STOP)HisSerProVal IleLeu
DNA
mRNA
Base Substitution MAY or MAY NOT Change the Protein
Met Val IleLeu
TACCAGGATTAAAUGGUCCUAAUU
AATGGAAGTGTAATC DNA
UUACCUUCACAUUAG mRNA
Leu (STOP)HisSerPro
What if the C was substituted with an A ?????
REMEMBER if the 3rd base is changed, it may not change the protein!
![Page 22: Base Mutations on Protein Function and Phenotypes](https://reader038.vdocument.in/reader038/viewer/2022102818/56649d125503460f949e5b21/html5/thumbnails/22.jpg)
Sickle Cell Anemia – red blood cells have a protein on their surgface called hemoglobin that carry oxygen. Patients with this affliction have misshaped (sickle-shaped) red blood cells and cannot carry enough oxygen
**Notice the DNA sequence below.. A is substituted for a T
Base Substitution Example
![Page 23: Base Mutations on Protein Function and Phenotypes](https://reader038.vdocument.in/reader038/viewer/2022102818/56649d125503460f949e5b21/html5/thumbnails/23.jpg)
Insertion (addition) or deletion of a base shift the frame of bases left or right, changing the amino acids affecting the whole protein. It won’t function properly
Frameshift Mutation
![Page 24: Base Mutations on Protein Function and Phenotypes](https://reader038.vdocument.in/reader038/viewer/2022102818/56649d125503460f949e5b21/html5/thumbnails/24.jpg)
Met Val IleLeu
TACCAGGATTAAAUG GUC CUA AUU
CTATGGAAGTGTAATC… GAUACCUUCACAUUAG…
Asp Phe ThrThr
Example: Addition of a T beside of the C... shifts the entire protein over to the right– changes ENTIRE
PROTEIN – There is NO STOP CODON!!
Leu Extra Base
Frame-Shift Addition
TACCAGGATTAACATGGAAGTGTAATC
AUGGUCCUAAUUGUACCUUCACAUUAG
(STOP)HisSerProValMet Val IleLeu
DNA
mRNA
DNA
mRNA
![Page 25: Base Mutations on Protein Function and Phenotypes](https://reader038.vdocument.in/reader038/viewer/2022102818/56649d125503460f949e5b21/html5/thumbnails/25.jpg)
Met Val IleLeu
TACCAGGATTAAAUG GUC CUA AUU
ATGGAAGTGTAATC… UACCUUCACAUUAG…
Thr His IleLeu Ser or Arg
Frameshift Deletion
TACCAGGATTAACATGGAAGTGTAATC
AUGGUCCUAAUUGUACCUUCACAUUAG
(STOP)HisSerProValMet Val IleLeu
DNA
mRNA
DNA
mRNA
Example: Deletion of the C... shifts the entire protein over to the Left– changes ENTIRE PROTEIN – There
is NO STOP CODON!!