beata kmieca,*, pedro f. teixeiraa, monika w. murcha ......accepted article 2013). the fourth...

Acc

epte

d A

rticl

eDivergent evolution of the M3A family of metallopeptidases in plants

Beata Kmieca,*, Pedro F. Teixeiraa, Monika W. Murchab and Elzbieta Glasera,*

aDepartment of Biochemistry and Biophysics, Stockholm University, Arrhenius Laboratories for

Natural Sciences, SE-106 91 Stockholm, Sweden bARC Centre of Excellence in Plant Energy Biology, University of Western Australia, Crawley,

Western Australia, Australia

*Corresponding authors, e-mail: [email protected]; [email protected]

Plants, as stationary organisms, have developed mechanisms allowing them efficient resource

reallocation and a response to changing environmental conditions. One of these mechanisms is

proteome remodeling via a broad peptidase network present in various cellular compartments

including mitochondria and chloroplasts. The genome of the model plant Arabidopsis thaliana

encodes as many as 616 putative peptidase-coding genes organized in 55 peptidase families. In the

present study we describe the M3A family of peptidases, which comprises four members:

mitochondrial and chloroplastic oligopeptidase (OOP), cytosolic oligopeptidase (CyOP),

mitochondrial octapeptidyl aminopeptidase 1 (Oct1) and plant-specific protein of M3 family (PSPM3)

of unknown function. We have analyzed the evolutionary conservation of M3A peptidases across

plant species and the functional specialization of the three distinct subfamilies. We found that the

subfamily containing OOP and CyOP-like peptidases, responsible for oligopeptide degradation in the

endosymbiotic organelles (OOP) or in the cytosol (CyOP), is highly conserved in all kingdoms of life.

The Oct1-like peptidase subfamily involved in pre-protein maturation in mitochondria is conserved in

all eukaryotes, whereas the PSPM3-like protein subfamily is strictly conserved in higher plants only

and is of unknown function. Specific characteristics within PSPM3 sequences, i.e. occurrence of a N-

terminal transmembrane domain and amino acid changes in distal substrate-binding motif, distinguish

PSPM3 proteins from other members of M3A family. We performed peptidase activity measurements

to analyze the role of substrate-binding residues in the different Arabidopsis M3A paralogs.

Abbreviations – a.a., amino acid; CyOP, cytosolic oligopeptidase; Oct1, octapeptidyl aminopeptidase

1; OOP, organellar oligopeptidase; PSPM3, plant-specific protein of M3 family.

This article is protected by copyright. All rights reserved.

This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process, which may lead to differences between this version and the Version of Record. Please cite this article as doi: 10.1111/ppl.12457

Acc

epte

d A

rticl

eIntroduction

As plants are sessile and lack the capacity to relocate to different environments, they have developed

many biochemical and genetic mechanisms allowing them to adapt to changing environmental

conditions. One such mechanism is rapid proteome remodeling, executed by peptidases (also termed

proteases). Peptidases have diverse roles from regulatory functions, through the degradation of

proteins that are no longer functional or needed, to the cleavage of short peptides down to amino acids

(a.a.) in a resource-recovery process. In the membrane-enclosed organelles, the majority (in case of

mitochondria and chloroplasts) or all of the proteins (in case of endoplasmic reticulum and

peroxisomes) are synthesized in the cytosol and imported into the organelles in a targeting peptide-

dependent fashion (Murcha et al. 2014). A multitude of peptidases are involved in cleaving-off and

subsequently degrading the targeting peptides, and are therefore vital in the maturation process of the

organellar pre-proteins (Teixeira and Glaser 2013). The genome of the model higher plant Arabidopsis

thaliana, contains 616 putative peptidase-coding genes (including 89 genes coding for inactive

homologs) (Pesquet 2012). Arabidopsis peptidases are organized into 55 clans of distinct activity and

structure, each containing multiple members (MEROPS database release 9.13; Rawlings et al. 2014).

In the present study we focus on the M3A family of peptidases, belonging to MA clan of

metallopeptidases (MEROPS; Rawlings et al. 2014).

The members of the M3A family are classified through similarity with the model MA peptidase

thermolysin, and contain a signature HEXXH zinc-binding motif in the active site (MEROPS;

Rawlings et al. 2014). M3A peptidases were initially identified in bacteria, as peptide-degrading

enzymes, also referred to as oligopeptidases, accepting peptides of up to 20 amino acids and degrading

them to shorter fragments (Vimr et al. 1983, Yaron et al. 1972). The model bacterial species,

Escherichia coli possesses two members of M3A family, i.e. oligopeptidase A (OpdA), which is an

endopeptidase involved in degradation of signaling peptides (Novak and Dev 1988), and peptidyl-

dipeptidase Dcp, an exopeptidase, cleaving C-terminal dipeptides from its peptide substrates (Yaron et

al. 1972). Dipeptidyl-dipeptidase activity of Dcp is not conserved among eukaryotic members of M3A

family. The model yeast species, Saccharomyces cerevisiae, possesses one M3A peptidase of OpdA-

like function, referred to as saccharolysin (also known as Proteinase yscD or Prd1) (Garcia-Alvarez et

al. 1987). Saccharolysin is localized in mitochondria, and it was suggested to be involved in the

degradation of mitochondrial peptides (Kambacheld et al. 2005). Yeasts contain an additional M3A

peptidase, named octapeptidyl aminopeptidase 1, Oct1 (also known as mitochondrial intermediate

peptidase, MIP). Oct1 also resides in mitochondria, where it plays a role in maturation of

mitochondria-targeted precursors (Vogtle et al. 2011). In contrast to the previously described members

of M3A family, Oct1 accepts full-length proteins as substrates and cleaves off 8-amino acid fragments

from their N-termini (Vogtle et al. 2011). Physiological analyses showed that Oct1, but not

saccharolysin, activity is essential for mitochondrial respiratory function (Garcia-Alvarez et al. 1987,

Isaya et al. 1994). Both types of activities are preserved in mammals, with the human genome


Acc

epte

d A

rticl

eencoding two orthologs of OpdA (neurolysin, Nln and thimet oligopeptidase, TOP) and one ortholog

of Oct1, termed human mitochondrial processing peptidase (HMIP or MIPEP). While the localization

and physiological function of Nln is presently unknown, TOP is localized in the cytosol, acting

downstream of the proteasome pathway (Saric et al. 2004). The function of TOP in degradation of

proteasome-generated peptides is needed for amino acid recycling, as well as for more specific

functions, such as antigenic peptide processing (Kessler et al. 2011). Human Oct1 was proposed to

perform a similar molecular function as the yeast Oct1, based on a positive functional

complementation assay in yeast Δoct1 cells (Chew et al. 2000). More detailed analyses of a rat

ortholog confirmed that the mammalian Oct1 is involved in mitochondrial preprotein processing in a

similar fashion as its yeast counterpart, i.e. by cleaving off octapeptides from their N-termini

(Kalousek et al. 1992).

In the model plant Arabidopsis thaliana, the function of two M3A peptidases has been

investigated in the context of organellar peptide degradation and protein maturation. The function of

organellar oligopeptidase (OOP, At5g65620) has been particularly well studied (Kmiec et al. 2013).

OOP is dually targeted to the mitochondrial matrix and the plastidic stroma, where it is involved in the

degradation of mitochondrial and chloroplastic targeting peptides, as well as peptides arising as

products of general degradation of organellar proteins (Kmiec et al. 2013). In this process OOP

cooperates with presequence protease (PreP, member of the M16 family) (Falkevall et al. 2006,

Johnson et al. 2006, Stahl et al. 2002). OOP and PreP form a complementary degradation pathway that

can cleave a wide range of substrates and is important for normal plant development (Kmiec et al.

2013, Kmiec et al. 2014). A. thaliana Oct1 (At5g51540) is related to the yeast and human Oct1 and is

involved in proteolytic maturation of mitochondrial pre-proteins. N-terminal protein analysis of A.

thaliana oct1 mutant lines allowed identification of seven Oct1 substrates and revealed a distinct

cleavage mechanism for the plant enzyme (Carrie et al. 2015). The obtained results suggest that A.

thaliana Oct1, in contrast to its yeast and mammalian orthologs, cleaves off peptides of variable

length.

In the present work, we used sequence analysis to understand the organization of M3A peptidases

across plant species and we will discuss conservation of the M3A family of peptidases during the

course of evolution with a focus on the plant lineage. Additionally, we combined these data with

peptidase activity measurements to analyze the role of substrate-binding residues in the different

Arabidopsis M3A paralogs.

Materials and methods

Sequence analysis

The identification of M3A peptidases is based on the collection of Mitochondrial Protein Import

Components (MPIC) database (http://www.plantenergy.uwa.edu.au/applications/mpic/) (Murcha et al.


Acc

epte

d A

rticl

e2015) and Phytozome v10.3 database (http://phytozome.jgi.doe.gov/pz/portal.html), as well as on a

manual search using Protein BLAST (http://blast.ncbi.nlm.nih.gov) using each of the A. thaliana M3A

peptidases as a query. Multiple sequence alignment was performed using Clustal Omega

(http://www.ebi.ac.uk/Tools/msa/clustalo). Phylogenetic analysis was performed through the MABL

server (http://www.phylogeny.fr) using MUSCLE, curated using Gblocks; bootstrap values calculated

using PhyML. The phylogenetic tree was created using iTOL tool (http://itol.embl.de/). Sequence logo

analysis was performed using WebLogo (http://weblogo.berkeley.edu/logo.cgi).

Purification of recombinant wild-type OOP (and variants)

Plasmids pGEX6p2 encoding A. thaliana OOP lacking the putative targeting sequence Δ1–82 a.a. (or

variants E572Q, H703R, Y709S and Y716R) were transformed into E. coli Rosetta 2 cells (Novagen).

Site-directed mutagenesis to introduce mutations corresponding to the previous variants was

performed using the QuikchangeII kit (Agilent) according to the manufacturers’ instruction and the

following oligonucleotide primers: H703Rf (CTCTGTAGCTTCAGTCGTATCTTTGCCGGGGGA),

H703Rr (TCCCCCGGCAAAGA TACGACTGAAGCTACAGAG), Y709Sf

(ATCTTTGCCGGGGGATCTGCAGCTGGATATTAC), Y709Sr

(GTAATATCCAGCTGCAGATCCCCCGGCAAAGAT), Y716Rf (GCTGGATATTACAGT

CGCAAGTGGGCAGAAGTT), Y716Rr (AACTTCTGCCCACTTGCGACTGTAATATCCAGC).

Cell growth and protein purification were performed as described previously (Kmiec et al. 2013).

Oligopeptidase activity measurements

For the activity measurements, OOP (wild-type or variants; 1.25 pmol per assay) were mixed with

either 0.72 nmol substrate V (Mca-RPPGFSAFKdnp; R&D systems), 1.1 nmol pF1β43–53 (Mca-

KGFLLNRAVQYKdnp; Teixeira et al 2015) or 3.5 nmol Sdh1 octapeptide (Abz-FTSSALVKdnp) in

degradation buffer (50 mM HEPES, pH 7.4, reaction volume of 100 µl) and the increase in

fluorescence (excitation 327 nm, emission 395 nm for Substrate V and pF1β43–53; excitation 320 nm,

emission 420 nm for the Octapeptide Sdh1) immediately recorded in a plate reader (SpectraMax

Gemini, Molecular Devices, Sunnyvale, CA, USA). Results are shown as the average (± SD) of 3

independent measurements. Statistical analyses (Student’s t-test) were performed using the software

Prism 6 (Graphpad).

Results

Evolutionary conservation of M3A peptidases

Previous analysis of the Arabidopsis genome revealed the existence of four M3A peptidase homologs

(Kmiec et al. 2013). In addition to OOP and Oct1, Arabidopsis contains cytosolic oligopeptidase

(CyOP, At5g10540), and At1g67690. CyOP is localized in the cytosol and was proposed to be

involved in the degradation of short peptides generated by the action of the proteasome (Kmiec et al.


Acc

epte

d A

rticl

e2013). The fourth peptidase of M3A family in A. thaliana encoded by At1g67690 is of unknown

function. At1g67690 is present only in the higher plant lineage and will be referred to as plant-specific

protein of M3 family, PSPM3.

Phylogenetic comparison of the amino acid sequences of M3A peptidases from A. thaliana with

orthologs from other plant species showed a high level of conservation within this family, with all four

peptidases conserved in the plant lineage. The M3A peptidases from vascular plants cluster in three

main clades, representing OOP/CyOP-, Oct1- and PSPM3-like sequences (Fig. 1). OOP and CyOP

display very high sequence similarity, and therefore cluster together on the same branch. The major

difference between OOP and CyOP in A. thaliana lies within the N-terminal part of the sequence,

which in case of OOP is extended and contains a targeting peptide, conferring dual import of OOP

into mitochondria and chloroplasts (Kmiec et al. 2013). The CyOP sequence does not contain a

targeting peptide and the enzyme is localized in the cytosol (Kmiec et al. 2013). Most of the vascular

plants possess orthologs to both OOP and CyOP (Fig. 1A, Supplemental Table S1), with the OOP-like

orthologs predicted to localize either to the mitochondria or the chloroplasts (Supplemental Table S1).

As observed in Arabidopsis, it is likely that plant OOP orthologs are in fact dually targeted to

mitochondria and chloroplasts, a feature that is difficult to predict due to the intermediate sequence

composition of these targeting sequences (Carrie and Small 2013, Carrie and Whelan 2013, Ge et al.

2014). The high sequence similarity between OOP and CyOP (92%) suggests that they arose from a

recent gene duplication event, followed by the acquisition of organellar localization by OOP-like

peptidases.

The Oct1 orthologs are also highly conserved within the vascular plants, and each species

analyzed possesses one Oct1-like sequence. A. thaliana Oct1 is localized in mitochondria (Carrie et al.

2015), and Oct1-like orthologs from other plant species are also predicted to have mitochondrial

localization (Supplemental Table S1). The third group of plant M3A peptidases clusters along with the

A. thaliana peptidase encoded by At1g67690, PSPM3. As is the case for the other two groups,

PSPM3-like orthologs are conserved in almost all vascular plant species analyzed (Fig. 1,

Supplemental Table S1). The only exception is Selaginella moellendorffii, which represents

lycophytes, as a model for ancient vascular plants. PSPM3 orthologs are not predicted to possess a

targeting sequence directing them to mitochondria, chloroplasts or the endoplasmic reticulum (ER)

lumen (Supplemental Table S1). An interesting feature of PSPM3 is the presence of an N-terminal

transmembrane domain (TMD) that distinguishes them from the other M3A peptidases. This feature is

conserved in all PSPM3-like orthologs (Fig.1, Supplemental Table S1). The presence of a TMD

suggests that PSPM3-like proteins may be anchored to a membrane, with the peptidase domain

exposed to a soluble compartment.

Comparison of the amino acid sequences of M3A peptidases from vascular plants with their

orthologs from other species representing lower plants, algae, bacteria, archaea, fungi and animals

revealed conservation of OOP/CyOP-like in all kingdoms and conservation of Oct1-like peptidases in


Acc

epte

d A

rticl

eeukaryotes (Supplemental Table S1). Lower plants, algae and fungi possess typically one

representative from each of the OOP/CyOP- and Oct1-like group; animal species used in the

comparison possess typically two OOP/CyOP-like peptidases (one of them with predicted

mitochondrial localization) and one Oct1-like peptidase, also predicted to localize to mitochondria. By

comparison, bacteria usually possess only one M3A peptidase. PSPM3-like peptidases are not

conserved in other kingdoms and appear to be specific to angiosperms. It is not clear if PSPM3-like

peptidases are present also in gymnosperms, as a manual search in the Picea abies genome database

did not produce conclusive results (http://congenie.org, (Nystedt et al. 2013)).

Sequence variation in the active site of plant M3A peptidases

Among the plant M3A peptidases, OOP is best characterized in terms of mechanism of catalysis and

tertiary structure. OOP degrades short peptides of 8–23 a.a. (Kmiec et al. 2013, Kmiec et al. 2014).

The substrate size restriction is dictated by the internal volume of the catalytic cavity enclosed by the

two domains of OOP. The crystal structure of OOP has been experimentally determined using X-ray

crystallography with the identification of key residues required for the catalysis to occur (Kmiec et al.

2013). Typically for peptidases of the MA clan, the active site of OOP contains the zinc-binding motif

H571EXXH575, with the histidines coordinating the zinc ion, and glutamate coordinating the water

molecule taking part in the nucleophilic attack of the scissile bond. Additionally, residues positioned

distally to the zinc-binding motif also contribute to the active site (Fig. 2). The residues H703, Y709

and Y716 in the OOP sequence are responsible for the substrate binding and docking in the active site

(Kmiec et al. 2013). We analyzed the conservation of the zinc-binding motif and the substrate-binding

residues in different M3A peptidase subfamilies and across kingdoms.

The zinc-binding motif is conserved in all three groups of M3A peptidases analyzed (Fig. 2). In

the case of the distal substrate-binding residues, conservation was observed among the OOP/CyOP

subfamily members (Fig. 2, Supplemental Fig. S1). Similarly, all Oct1-like sequences possess all three

residues; however, the distance between the conserved H and the first Y is shorter than in case of the

OOP/CyOP -like peptidases (Fig. 2). In the OOP structure, this region has a helix-turn-helix topology

and, therefore, an alteration of the spacing between H and Y residues (as observed in Oct1 homologs)

may influence substrate recognition. The striking difference between the substrate-binding motifs of

OOP/CyOP/Oct1-like peptidases and the corresponding region in PSPM3-like sequences is the distal

histidine residue, which has been replaced by an arginine in most species, and the distal tyrosine that is

also poorly conserved (Fig. 2, Supplemental Fig. S1). Among PSPM3-like sequences we observe the

conservation of negatively charged residues and a less frequent occurrence of glycine (compared to

OOP/CyOP/Oct1) (Fig. 2), which might affect the flexibility in this region of the PSPM3-like proteins.

Impact of substitutions in the distal peptide-anchoring site on peptidase activity

We have previously shown that altering the distal substrate-anchoring residues H703 or Y709 to


Acc

epte

d A

rticl

ephenylalanine abolished activity of OOP, as it prevents hydrogen bonding to the substrate (Kmiec et

al. 2013). Surprisingly, these residues are not conserved in PSMP3 sequences, with the distal

substrate-binding region of Arabidopsis PSPM3 containing R/S/R residues replacing the distal H703,

Y709 and Y716 in OOP, respectively (Supplemental Fig. S1). To understand how the evolutionary

changes observed in PSPM3-like sequences within the distal substrate-binding regions influence the

peptidolytic activity, we engineered OOP variants with single amino acid substitutions reflecting the

alterations observed in Arabidopsis PSPM3. We overexpressed and purified three variants of OOP

bearing one of the following changes in the substrate-binding motif: H703R, Y709S and Y716R

(Supplemental Fig. S2, Fig. 2). All variants migrated as monomers as analyzed by size-exclusion

chromatography, indicating that these substitutions do not interfere with the overall fold of the

enzymes (Supplemental Fig. S2). We subsequently analyzed the activity of these variants using three

different known substrates of OOP: 8 a.a. octSdh1, 9 a.a. substrate V and 12 a.a. pF1β 43–53 (Kmiec

et al. 2013, Teixeira et al. 2015). As positive and negative controls, we used wild-type OOP and a

catalytically inactive variant, in which E572 from the zinc-binding motif was replaced by glutamine

(OOPE572Q), respectively. Degradation of all three substrates was completely abolished in the H703R

and Y716R variants, as well as in the proteolytically inactive E572 (Fig. 3). The Y709S variant

exhibited lower activity in the degradation of the shorter substrates (octSdh1 and substrate V), but

displayed a 3-fold increase in activity in the degradation of pF1β 43–53 (Fig. 3).

Discussion

Sequence analysis of the M3A family of metallopeptidases revealed a high level of conservation in the

course of evolution. Members of this family are present in all kingdoms of life, suggesting an ancient

origin (Supplemental Table S1). The phylogenetic analysis of the plant M3A peptidases reveals three

well-defined subfamilies, with OOP/CyOP-like (involved in peptide degradation) present in all

kingdoms of life, Oct1-like (involved in mitochondrial pre-protein maturation) conserved in

eukaryotes and PSPM3-like peptidases being plant-specific. The lack of PSPM3-like homologues in

algae (Cyanidioschyzon merolae, Chlamydomonas reinhardtii, Ectocarpus siliculosus, Volvox

carteri), moss (Physcomitrella patens) or in lycophyta (Selaginella moellendorffii) suggests that

PSPM3-like M3A peptidases evolved later during the land plant evolution.

A closer look at the active site revealed a fully conserved zinc-binding motif, which is a signature

catalytic motif for all proteolytically active metallopetidases of the MA clan, including OOP/CyOP-

and Oct1-like peptidases. Interestingly, PSPM3-like peptidases do not possess the key H-Y-Y residues

within the distal substrate-binding motif that were shown to interact with peptide substrates of OOP

peptidase (Kmiec et al. 2013). These distal residues are conserved in all subfamilies of M3A

peptidases, including the bacterial exopeptidase Dcp (data not shown), which suggests that the H-Y-Y

residues are important for interaction with a wide range of substrates of different lengths. Substitution

of the distal residues H703 and Y716 in OOP for the corresponding ones present in PSPM3 (R-R)


Acc

epte

d A

rticl

eresulted in an inhibition of peptidolytic activity, suggesting that such active site configuration does not

support substrate binding. The lack of the distal histidine is conserved among all PSPM3-like

sequences, being most commonly replaced by an arginine (in 14 out of 17 sequences). In one sequence

(Medicago truncatula), histidine is replaced by phenylalanine, a substitution that also inhibits

peptidolytic activity (Kmiec et al. 2013). Conversely, the substitution of Y706 in OOP for S did not

prevent peptidolytic activity (in the case of pF1β 43–53 we even observed a 3-fold increase), possibly

because it is a conservative change reflecting an alteration of the size of the side chain but retaining

the –OH group required for hydrogen bonding with the substrate.

Interestingly, the changes in the distal substrate-binding motif observed in Arabidopsis PSPM3

are characteristic for all PSPM3-like peptidases. Based simply on the conservation of residues that do

not support peptidase activity in the distal substrate-binding region among PSPM3-like proteins, it is

tempting to speculate that PSPM3-like proteins are actually proteolytically inactive. In this way, the

plant specific PSPM3-like proteins could have evolved to perform specialized functions as

proteolytically inactive peptidase homologues. Occurrence of inactive homologs in multi-member

family of peptidases is common. Interesting examples of the divergent evolution of inactive peptide

homologs exist in the large families of FtsH and Rhom peptidases, where the proteolytically inactive

members (FtsHi and iRhoms) were shown to perform vital, but different functions than the active FtsH

and Rhom peptidases (Christova et al. 2013, Hsu et al. 2010, Kadirjan-Kalbach et al. 2012, Zettl et al.

2011). It is worth noting that FtsHi and iRhoms lack the signature catalytic residues in their active

sites (i.e. HEXXH and S-H, respectively), which is not the case for PSPM3-like peptidases. We should

point out that presently we cannot exclude that PSMP3-like proteins are, in fact, active peptidases.

However, if that were the case, the mode of substrate binding in the internal cavity of PSPM3-like

peptidases, or the architecture of the substrate-binding site itself would have to be very different from

the organization observed in OOP/CyOP/Oct1-like peptidases.

In conclusion, sequence analysis of the M3A peptidase family reveals great conservation across

three domains of life, but with observed neo-functionalization in eukaryotic organisms, particularly in

the plant lineage. Despite possessing a similar structure and overall fold, M3A peptidases have

specialized to perform distinct functions (e.g. protein maturation and peptide degradation) and

therefore, constitute an interesting example of functional divergence among plant peptidases.

Author contributions

BK, PFT performed the experiments; BK, PFT, EG wrote the manuscript; MWM took part in the

initial stage of the project.

Acknowledgements – This work was supported by research grants from The Swedish Research

Council and The Swedish Foundation for International Cooperation in Research and Higher Education

(STINT) to EG. MWM was supported by an Australian Research Council Future Fellowship grant


Acc

epte

d A

rticl

eFT130100112.

References

Carrie C, Small I (2013) A reevaluation of dual-targeting of proteins to mitochondria and chloroplasts.

Biochim Biophys Acta 1833: 253–259

Carrie C, Venne AS, Zahedi RP, Soll J (2015) Identification of cleavage sites and substrate proteins

for two mitochondrial intermediate peptidases in Arabidopsis thaliana. J Exp Bot 66: 2691–2708

Carrie C, Whelan J (2013) Widespread dual targeting of proteins in land plants: when, where, how and

why. Plant Signal Behav 8: e25034

Chew A, Sirugo G, Alsobrook JP, 2nd, Isaya G (2000) Functional and genomic analysis of the human

mitochondrial intermediate peptidase, a putative protein partner of frataxin. Genomics 65: 104–

112

Christova Y, Adrain C, Bambrough P, Ibrahim A, Freeman M (2013) Mammalian iRhoms have

distinct physiological functions including an essential role in TACE regulation. EMBO Rep 14:

884–890

Falkevall A, Alikhani N, Bhushan S, Pavlov PF, Busch K, Johnson KA, Eneqvist T, Tjernberg L,

Ankarcrona M, Glaser E (2006) Degradation of the amyloid beta-protein by the novel

mitochondrial peptidasome, PreP. J Biol Chem 281: 29096–29104

Garcia-Alvarez N, Teichert U, Wolf DH (1987) Proteinase yscD mutants of yeast. Isolation and

characterization. Eur J Biochem 163: 339–346

Ge C, Spanning E, Glaser E, Wieslander A (2014) Import determinants of organelle-specific and dual

targeting peptides of mitochondria and chloroplasts in Arabidopsis thaliana. Mol Plant 7: 121–

136

Hsu SC, Belmonte MF, Harada JJ, Inoue K (2010) Indispensable Roles of Plastids in Arabidopsis

thaliana Embryogenesis. Curr Genomics 11: 338–349

Isaya G, Miklos D, Rollins RA (1994) MIP1, a new yeast gene homologous to the rat mitochondrial

intermediate peptidase gene, is required for oxidative metabolism in Saccharomyces cerevisiae.

Mol Cell Biol 14: 5603–5616

Johnson KA, Bhushan S, Stahl A, Hallberg BM, Frohn A, Glaser E, Eneqvist T (2006) The closed

structure of presequence protease PreP forms a unique 10,000 Angstroms3 chamber for

proteolysis. EMBO J 25: 1977–1986

Kadirjan-Kalbach DK, Yoder DW, Ruckle ME, Larkin RM, Osteryoung KW (2012) FtsHi1/ARC1 is

an essential gene in Arabidopsis that links chloroplast biogenesis and division. Plant J 72: 856–

867

Kalousek F, Isaya G, Rosenberg LE (1992) Rat liver mitochondrial intermediate peptidase (MIP):

purification and initial characterization. EMBO J 11: 2803–2809

Kambacheld M, Augustin S, Tatsuta T, Muller S, Langer T (2005) Role of the novel metallopeptidase


Acc

epte

d A

rticl

eMop112 and saccharolysin for the complete degradation of proteins residing in different

subcompartments of mitochondria. J Biol Chem 280: 20132–20139

Kessler JH, Khan S, Seifert U, Le Gall S, Chow KM, Paschen A, Bres-Vloemans SA, de Ru A, van

Montfoort N, Franken KL, Benckhuijsen WE, Brooks JM, van Hall T, Ray K, Mulder A,

Doxiadis, II, van Swieten PF, Overkleeft HS, Prat A, Tomkinson B, Neefjes J, Kloetzel PM,

Rodgers DW, Hersh LB, Drijfhout JW, van Veelen PA, Ossendorp F, Melief CJ (2011) Antigen

processing by nardilysin and thimet oligopeptidase generates cytotoxic T cell epitopes. Nat

Immunol 12: 45–53

Kmiec B, Teixeira PF, Berntsson RP, Murcha MW, Branca RM, Radomiljac JD, Regberg J, Svensson

LM, Bakali A, Langel U, Lehtio J, Whelan J, Stenmark P, Glaser E (2013) Organellar

oligopeptidase (OOP) provides a complementary pathway for targeting peptide degradation in

mitochondria and chloroplasts. Proc Natl Acad Sci USA 110: E3761–3769

Kmiec B, Teixeira PF, Glaser E (2014) Shredding the signal: targeting peptide degradation in

mitochondria and chloroplasts. Trends Plant Sci 19: 771–778

Murcha MW, Kmiec B, Kubiszewski-Jakubiak S, Teixeira PF, Glaser E, Whelan J (2014) Protein

import into plant mitochondria: signals, machinery, processing, and regulation. J Exp Bot 65:

6301–6335

Murcha MW, Narsai R, Devenish J, Kubiszewski-Jakubiak S, Whelan J (2015) MPIC: a mitochondrial

protein import components database for plant and non-plant species. Plant Cell Physiol 56: e10

Novak P, Dev IK (1988) Degradation of a signal peptide by protease IV and oligopeptidase A. J

Bacteriol 170: 5067–5075

Nystedt B, Street NR, Wetterbom A, Zuccolo A, Lin YC, Scofield DG, Vezzi F, Delhomme N,

Giacomello S, Alexeyenko A, Vicedomini R, Sahlin K, Sherwood E, Elfstrand M, Gramzow L,

Holmberg K, Hallman J, Keech O, Klasson L, Koriabine M, Kucukoglu M, Kaller M, Luthman J,

Lysholm F, Niittyla T, Olson A, Rilakovic N, Ritland C, Rossello JA, Sena J, Svensson T,

Talavera-Lopez C, Theissen G, Tuominen H, Vanneste K, Wu ZQ, Zhang B, Zerbe P, Arvestad

L, Bhalerao R, Bohlmann J, Bousquet J, Garcia Gil R, Hvidsten TR, de Jong P, MacKay J,

Morgante M, Ritland K, Sundberg B, Thompson SL, Van de Peer Y, Andersson B, Nilsson O,

Ingvarsson PK, Lundeberg J, Jansson S (2013) The Norway spruce genome sequence and conifer

genome evolution. Nature 497: 579–584

Pesquet E (2012) Plant proteases – from detection to function. Physiol Plant 145: 1–4

Rawlings ND, Waller M, Barrett AJ, Bateman A (2014) MEROPS: the database of proteolytic

enzymes, their substrates and inhibitors. Nucleic Acids Res 42: D503–509

Saric T, Graef CI, Goldberg AL (2004) Pathway for degradation of peptides generated by

proteasomes: a key role for thimet oligopeptidase and other metallopeptidases. J Biol Chem 279:

46723–46732

Stahl A, Moberg P, Ytterberg J, Panfilov O, Brockenhuus Von Lowenhielm H, Nilsson F, Glaser E


Acc

epte

d A

rticl

e(2002) Isolation and identification of a novel mitochondrial metalloprotease (PreP) that degrades

targeting presequences in plants. J Biol Chem 277: 41931–41939

Teixeira PF, Branca RM, Kmiec B, Glaser E (2015) A flowchart to analyze protease activity in plant

mitochondria. Methods Mol Biol 1305: 123–130

Teixeira PF, Glaser E (2013) Processing peptidases in mitochondria and chloroplasts. Biochim

Biophys Acta 1833: 360–370

Vimr ER, Green L, Miller CG (1983) Oligopeptidase-deficient mutants of Salmonella typhimurium. J

Bacteriol 153: 1259–1265

Vogtle FN, Prinz C, Kellermann J, Lottspeich F, Pfanner N, Meisinger C (2011) Mitochondrial protein

turnover: role of the precursor intermediate peptidase Oct1 in protein stabilization. Mol Biol Cell

22: 2135–2143

Yaron A, Mlynar D, Berger A (1972) A dipeptidocarboxypeptidase from E. coli. Biochem Biophys

Res Commun 47: 897–902

Zettl M, Adrain C, Strisovsky K, Lastun V, Freeman M (2011) Rhomboid family pseudoproteases use

the ER quality control machinery to regulate intercellular signaling. Cell 145: 79–91

Supporting Information

Additional Supporting Information may be found in the online version of this article:

Table S1. List of all M3A peptidases analyzed.

Fig. S1. Multiple sequence alignment of the region containing the distal substrate-binding residues.

Fig. S2. Purity and homogeneity of OOP variants.

Edited by I. M. Møller


Acc

epte

d A

rticl

eFigure legends

Fig. 1. Phylogenetic tree of M3A peptidases from vascular plants. Peptidases with predicted N-


Acc

epte

d A

rticl

eterminal TMD are indicated with green circles. Numbers represent bootstrap values. Analysis was

performed through MABL server (http://www.phylogeny.fr) using MUSCLE, curated using Gblocks;

bootstrap values were calculated using PhyML. The tree was created using iTOL tool

(http://itol.embl.de/).

Fig. 2. Conservation of the zinc-binding and the distal substrate-binding motifs in M3A peptidases.

Cartoon shows domain organization of M3A peptidases and position of the zinc- and the distal

substrate-binding motifs in the primary structure. Sequence logo analysis of the zinc-binding and


Acc

epte

d A

rticl

edistal substrate-binding motifs was performed using WebLogo (http://weblogo.berkeley.edu/logo.cgi).

Amino acids colored according to their physicochemical properties (KRH – blue, DE – red,

AVLIPWFM – black, NQ – magenta, other – green). The residues essential for Zn or peptide binding

are indicated by circles above the amino acids. All peptidases listed in Supplemental Table S1 were

included in the analysis.

Fig. 3. OOP variants mimicking At1g67690 peptide-binding site. A) Drawing of OOP structure (PDB,


Acc

epte

d A

rticl

e4KA7) with the residues involved in Zn binding are colored red and the residues of the distal peptide

binding site are colored yellow. The trapped substrate is shown in cyan and the zinc ion in gray. B)

Peptidolytic activity of OOP variants (H703R; Y706S; Y716R) bearing substitutions mimicking

PSPM3 sequence analyzed with three different substrates: 8 amino acid (a.a.) octSdh1 (FTSSALVH);

9 a.a. substrate V (RPPGFSAFK) and 12 a.a. pF1β43–53 (KGFLLNRAVQYK).


beata kmieca,*, pedro f. teixeiraa, monika w. murcha ......accepted article 2013). the fourth...

Documents