beata kmieca,*, pedro f. teixeiraa, monika w. murcha ......accepted article 2013). the fourth...
TRANSCRIPT
Acc
epte
d A
rticl
eDivergent evolution of the M3A family of metallopeptidases in plants
Beata Kmieca,*, Pedro F. Teixeiraa, Monika W. Murchab and Elzbieta Glasera,*
aDepartment of Biochemistry and Biophysics, Stockholm University, Arrhenius Laboratories for
Natural Sciences, SE-106 91 Stockholm, Sweden bARC Centre of Excellence in Plant Energy Biology, University of Western Australia, Crawley,
Western Australia, Australia
*Corresponding authors, e-mail: [email protected]; [email protected]
Plants, as stationary organisms, have developed mechanisms allowing them efficient resource
reallocation and a response to changing environmental conditions. One of these mechanisms is
proteome remodeling via a broad peptidase network present in various cellular compartments
including mitochondria and chloroplasts. The genome of the model plant Arabidopsis thaliana
encodes as many as 616 putative peptidase-coding genes organized in 55 peptidase families. In the
present study we describe the M3A family of peptidases, which comprises four members:
mitochondrial and chloroplastic oligopeptidase (OOP), cytosolic oligopeptidase (CyOP),
mitochondrial octapeptidyl aminopeptidase 1 (Oct1) and plant-specific protein of M3 family (PSPM3)
of unknown function. We have analyzed the evolutionary conservation of M3A peptidases across
plant species and the functional specialization of the three distinct subfamilies. We found that the
subfamily containing OOP and CyOP-like peptidases, responsible for oligopeptide degradation in the
endosymbiotic organelles (OOP) or in the cytosol (CyOP), is highly conserved in all kingdoms of life.
The Oct1-like peptidase subfamily involved in pre-protein maturation in mitochondria is conserved in
all eukaryotes, whereas the PSPM3-like protein subfamily is strictly conserved in higher plants only
and is of unknown function. Specific characteristics within PSPM3 sequences, i.e. occurrence of a N-
terminal transmembrane domain and amino acid changes in distal substrate-binding motif, distinguish
PSPM3 proteins from other members of M3A family. We performed peptidase activity measurements
to analyze the role of substrate-binding residues in the different Arabidopsis M3A paralogs.
Abbreviations – a.a., amino acid; CyOP, cytosolic oligopeptidase; Oct1, octapeptidyl aminopeptidase
1; OOP, organellar oligopeptidase; PSPM3, plant-specific protein of M3 family.
This article is protected by copyright. All rights reserved.
This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process, which may lead to differences between this version and the Version of Record. Please cite this article as doi: 10.1111/ppl.12457
Acc
epte
d A
rticl
eIntroduction
As plants are sessile and lack the capacity to relocate to different environments, they have developed
many biochemical and genetic mechanisms allowing them to adapt to changing environmental
conditions. One such mechanism is rapid proteome remodeling, executed by peptidases (also termed
proteases). Peptidases have diverse roles from regulatory functions, through the degradation of
proteins that are no longer functional or needed, to the cleavage of short peptides down to amino acids
(a.a.) in a resource-recovery process. In the membrane-enclosed organelles, the majority (in case of
mitochondria and chloroplasts) or all of the proteins (in case of endoplasmic reticulum and
peroxisomes) are synthesized in the cytosol and imported into the organelles in a targeting peptide-
dependent fashion (Murcha et al. 2014). A multitude of peptidases are involved in cleaving-off and
subsequently degrading the targeting peptides, and are therefore vital in the maturation process of the
organellar pre-proteins (Teixeira and Glaser 2013). The genome of the model higher plant Arabidopsis
thaliana, contains 616 putative peptidase-coding genes (including 89 genes coding for inactive
homologs) (Pesquet 2012). Arabidopsis peptidases are organized into 55 clans of distinct activity and
structure, each containing multiple members (MEROPS database release 9.13; Rawlings et al. 2014).
In the present study we focus on the M3A family of peptidases, belonging to MA clan of
metallopeptidases (MEROPS; Rawlings et al. 2014).
The members of the M3A family are classified through similarity with the model MA peptidase
thermolysin, and contain a signature HEXXH zinc-binding motif in the active site (MEROPS;
Rawlings et al. 2014). M3A peptidases were initially identified in bacteria, as peptide-degrading
enzymes, also referred to as oligopeptidases, accepting peptides of up to 20 amino acids and degrading
them to shorter fragments (Vimr et al. 1983, Yaron et al. 1972). The model bacterial species,
Escherichia coli possesses two members of M3A family, i.e. oligopeptidase A (OpdA), which is an
endopeptidase involved in degradation of signaling peptides (Novak and Dev 1988), and peptidyl-
dipeptidase Dcp, an exopeptidase, cleaving C-terminal dipeptides from its peptide substrates (Yaron et
al. 1972). Dipeptidyl-dipeptidase activity of Dcp is not conserved among eukaryotic members of M3A
family. The model yeast species, Saccharomyces cerevisiae, possesses one M3A peptidase of OpdA-
like function, referred to as saccharolysin (also known as Proteinase yscD or Prd1) (Garcia-Alvarez et
al. 1987). Saccharolysin is localized in mitochondria, and it was suggested to be involved in the
degradation of mitochondrial peptides (Kambacheld et al. 2005). Yeasts contain an additional M3A
peptidase, named octapeptidyl aminopeptidase 1, Oct1 (also known as mitochondrial intermediate
peptidase, MIP). Oct1 also resides in mitochondria, where it plays a role in maturation of
mitochondria-targeted precursors (Vogtle et al. 2011). In contrast to the previously described members
of M3A family, Oct1 accepts full-length proteins as substrates and cleaves off 8-amino acid fragments
from their N-termini (Vogtle et al. 2011). Physiological analyses showed that Oct1, but not
saccharolysin, activity is essential for mitochondrial respiratory function (Garcia-Alvarez et al. 1987,
Isaya et al. 1994). Both types of activities are preserved in mammals, with the human genome
This article is protected by copyright. All rights reserved.
Acc
epte
d A
rticl
eencoding two orthologs of OpdA (neurolysin, Nln and thimet oligopeptidase, TOP) and one ortholog
of Oct1, termed human mitochondrial processing peptidase (HMIP or MIPEP). While the localization
and physiological function of Nln is presently unknown, TOP is localized in the cytosol, acting
downstream of the proteasome pathway (Saric et al. 2004). The function of TOP in degradation of
proteasome-generated peptides is needed for amino acid recycling, as well as for more specific
functions, such as antigenic peptide processing (Kessler et al. 2011). Human Oct1 was proposed to
perform a similar molecular function as the yeast Oct1, based on a positive functional
complementation assay in yeast Δoct1 cells (Chew et al. 2000). More detailed analyses of a rat
ortholog confirmed that the mammalian Oct1 is involved in mitochondrial preprotein processing in a
similar fashion as its yeast counterpart, i.e. by cleaving off octapeptides from their N-termini
(Kalousek et al. 1992).
In the model plant Arabidopsis thaliana, the function of two M3A peptidases has been
investigated in the context of organellar peptide degradation and protein maturation. The function of
organellar oligopeptidase (OOP, At5g65620) has been particularly well studied (Kmiec et al. 2013).
OOP is dually targeted to the mitochondrial matrix and the plastidic stroma, where it is involved in the
degradation of mitochondrial and chloroplastic targeting peptides, as well as peptides arising as
products of general degradation of organellar proteins (Kmiec et al. 2013). In this process OOP
cooperates with presequence protease (PreP, member of the M16 family) (Falkevall et al. 2006,
Johnson et al. 2006, Stahl et al. 2002). OOP and PreP form a complementary degradation pathway that
can cleave a wide range of substrates and is important for normal plant development (Kmiec et al.
2013, Kmiec et al. 2014). A. thaliana Oct1 (At5g51540) is related to the yeast and human Oct1 and is
involved in proteolytic maturation of mitochondrial pre-proteins. N-terminal protein analysis of A.
thaliana oct1 mutant lines allowed identification of seven Oct1 substrates and revealed a distinct
cleavage mechanism for the plant enzyme (Carrie et al. 2015). The obtained results suggest that A.
thaliana Oct1, in contrast to its yeast and mammalian orthologs, cleaves off peptides of variable
length.
In the present work, we used sequence analysis to understand the organization of M3A peptidases
across plant species and we will discuss conservation of the M3A family of peptidases during the
course of evolution with a focus on the plant lineage. Additionally, we combined these data with
peptidase activity measurements to analyze the role of substrate-binding residues in the different
Arabidopsis M3A paralogs.
Materials and methods
Sequence analysis
The identification of M3A peptidases is based on the collection of Mitochondrial Protein Import
Components (MPIC) database (http://www.plantenergy.uwa.edu.au/applications/mpic/) (Murcha et al.
This article is protected by copyright. All rights reserved.
Acc
epte
d A
rticl
e2015) and Phytozome v10.3 database (http://phytozome.jgi.doe.gov/pz/portal.html), as well as on a
manual search using Protein BLAST (http://blast.ncbi.nlm.nih.gov) using each of the A. thaliana M3A
peptidases as a query. Multiple sequence alignment was performed using Clustal Omega
(http://www.ebi.ac.uk/Tools/msa/clustalo). Phylogenetic analysis was performed through the MABL
server (http://www.phylogeny.fr) using MUSCLE, curated using Gblocks; bootstrap values calculated
using PhyML. The phylogenetic tree was created using iTOL tool (http://itol.embl.de/). Sequence logo
analysis was performed using WebLogo (http://weblogo.berkeley.edu/logo.cgi).
Purification of recombinant wild-type OOP (and variants)
Plasmids pGEX6p2 encoding A. thaliana OOP lacking the putative targeting sequence Δ1–82 a.a. (or
variants E572Q, H703R, Y709S and Y716R) were transformed into E. coli Rosetta 2 cells (Novagen).
Site-directed mutagenesis to introduce mutations corresponding to the previous variants was
performed using the QuikchangeII kit (Agilent) according to the manufacturers’ instruction and the
following oligonucleotide primers: H703Rf (CTCTGTAGCTTCAGTCGTATCTTTGCCGGGGGA),
H703Rr (TCCCCCGGCAAAGA TACGACTGAAGCTACAGAG), Y709Sf
(ATCTTTGCCGGGGGATCTGCAGCTGGATATTAC), Y709Sr
(GTAATATCCAGCTGCAGATCCCCCGGCAAAGAT), Y716Rf (GCTGGATATTACAGT
CGCAAGTGGGCAGAAGTT), Y716Rr (AACTTCTGCCCACTTGCGACTGTAATATCCAGC).
Cell growth and protein purification were performed as described previously (Kmiec et al. 2013).
Oligopeptidase activity measurements
For the activity measurements, OOP (wild-type or variants; 1.25 pmol per assay) were mixed with
either 0.72 nmol substrate V (Mca-RPPGFSAFKdnp; R&D systems), 1.1 nmol pF1β43–53 (Mca-
KGFLLNRAVQYKdnp; Teixeira et al 2015) or 3.5 nmol Sdh1 octapeptide (Abz-FTSSALVKdnp) in
degradation buffer (50 mM HEPES, pH 7.4, reaction volume of 100 µl) and the increase in
fluorescence (excitation 327 nm, emission 395 nm for Substrate V and pF1β43–53; excitation 320 nm,
emission 420 nm for the Octapeptide Sdh1) immediately recorded in a plate reader (SpectraMax
Gemini, Molecular Devices, Sunnyvale, CA, USA). Results are shown as the average (± SD) of 3
independent measurements. Statistical analyses (Student’s t-test) were performed using the software
Prism 6 (Graphpad).
Results
Evolutionary conservation of M3A peptidases
Previous analysis of the Arabidopsis genome revealed the existence of four M3A peptidase homologs
(Kmiec et al. 2013). In addition to OOP and Oct1, Arabidopsis contains cytosolic oligopeptidase
(CyOP, At5g10540), and At1g67690. CyOP is localized in the cytosol and was proposed to be
involved in the degradation of short peptides generated by the action of the proteasome (Kmiec et al.
This article is protected by copyright. All rights reserved.
Acc
epte
d A
rticl
e2013). The fourth peptidase of M3A family in A. thaliana encoded by At1g67690 is of unknown
function. At1g67690 is present only in the higher plant lineage and will be referred to as plant-specific
protein of M3 family, PSPM3.
Phylogenetic comparison of the amino acid sequences of M3A peptidases from A. thaliana with
orthologs from other plant species showed a high level of conservation within this family, with all four
peptidases conserved in the plant lineage. The M3A peptidases from vascular plants cluster in three
main clades, representing OOP/CyOP-, Oct1- and PSPM3-like sequences (Fig. 1). OOP and CyOP
display very high sequence similarity, and therefore cluster together on the same branch. The major
difference between OOP and CyOP in A. thaliana lies within the N-terminal part of the sequence,
which in case of OOP is extended and contains a targeting peptide, conferring dual import of OOP
into mitochondria and chloroplasts (Kmiec et al. 2013). The CyOP sequence does not contain a
targeting peptide and the enzyme is localized in the cytosol (Kmiec et al. 2013). Most of the vascular
plants possess orthologs to both OOP and CyOP (Fig. 1A, Supplemental Table S1), with the OOP-like
orthologs predicted to localize either to the mitochondria or the chloroplasts (Supplemental Table S1).
As observed in Arabidopsis, it is likely that plant OOP orthologs are in fact dually targeted to
mitochondria and chloroplasts, a feature that is difficult to predict due to the intermediate sequence
composition of these targeting sequences (Carrie and Small 2013, Carrie and Whelan 2013, Ge et al.
2014). The high sequence similarity between OOP and CyOP (92%) suggests that they arose from a
recent gene duplication event, followed by the acquisition of organellar localization by OOP-like
peptidases.
The Oct1 orthologs are also highly conserved within the vascular plants, and each species
analyzed possesses one Oct1-like sequence. A. thaliana Oct1 is localized in mitochondria (Carrie et al.
2015), and Oct1-like orthologs from other plant species are also predicted to have mitochondrial
localization (Supplemental Table S1). The third group of plant M3A peptidases clusters along with the
A. thaliana peptidase encoded by At1g67690, PSPM3. As is the case for the other two groups,
PSPM3-like orthologs are conserved in almost all vascular plant species analyzed (Fig. 1,
Supplemental Table S1). The only exception is Selaginella moellendorffii, which represents
lycophytes, as a model for ancient vascular plants. PSPM3 orthologs are not predicted to possess a
targeting sequence directing them to mitochondria, chloroplasts or the endoplasmic reticulum (ER)
lumen (Supplemental Table S1). An interesting feature of PSPM3 is the presence of an N-terminal
transmembrane domain (TMD) that distinguishes them from the other M3A peptidases. This feature is
conserved in all PSPM3-like orthologs (Fig.1, Supplemental Table S1). The presence of a TMD
suggests that PSPM3-like proteins may be anchored to a membrane, with the peptidase domain
exposed to a soluble compartment.
Comparison of the amino acid sequences of M3A peptidases from vascular plants with their
orthologs from other species representing lower plants, algae, bacteria, archaea, fungi and animals
revealed conservation of OOP/CyOP-like in all kingdoms and conservation of Oct1-like peptidases in
This article is protected by copyright. All rights reserved.
Acc
epte
d A
rticl
eeukaryotes (Supplemental Table S1). Lower plants, algae and fungi possess typically one
representative from each of the OOP/CyOP- and Oct1-like group; animal species used in the
comparison possess typically two OOP/CyOP-like peptidases (one of them with predicted
mitochondrial localization) and one Oct1-like peptidase, also predicted to localize to mitochondria. By
comparison, bacteria usually possess only one M3A peptidase. PSPM3-like peptidases are not
conserved in other kingdoms and appear to be specific to angiosperms. It is not clear if PSPM3-like
peptidases are present also in gymnosperms, as a manual search in the Picea abies genome database
did not produce conclusive results (http://congenie.org, (Nystedt et al. 2013)).
Sequence variation in the active site of plant M3A peptidases
Among the plant M3A peptidases, OOP is best characterized in terms of mechanism of catalysis and
tertiary structure. OOP degrades short peptides of 8–23 a.a. (Kmiec et al. 2013, Kmiec et al. 2014).
The substrate size restriction is dictated by the internal volume of the catalytic cavity enclosed by the
two domains of OOP. The crystal structure of OOP has been experimentally determined using X-ray
crystallography with the identification of key residues required for the catalysis to occur (Kmiec et al.
2013). Typically for peptidases of the MA clan, the active site of OOP contains the zinc-binding motif
H571EXXH575, with the histidines coordinating the zinc ion, and glutamate coordinating the water
molecule taking part in the nucleophilic attack of the scissile bond. Additionally, residues positioned
distally to the zinc-binding motif also contribute to the active site (Fig. 2). The residues H703, Y709
and Y716 in the OOP sequence are responsible for the substrate binding and docking in the active site
(Kmiec et al. 2013). We analyzed the conservation of the zinc-binding motif and the substrate-binding
residues in different M3A peptidase subfamilies and across kingdoms.
The zinc-binding motif is conserved in all three groups of M3A peptidases analyzed (Fig. 2). In
the case of the distal substrate-binding residues, conservation was observed among the OOP/CyOP
subfamily members (Fig. 2, Supplemental Fig. S1). Similarly, all Oct1-like sequences possess all three
residues; however, the distance between the conserved H and the first Y is shorter than in case of the
OOP/CyOP -like peptidases (Fig. 2). In the OOP structure, this region has a helix-turn-helix topology
and, therefore, an alteration of the spacing between H and Y residues (as observed in Oct1 homologs)
may influence substrate recognition. The striking difference between the substrate-binding motifs of
OOP/CyOP/Oct1-like peptidases and the corresponding region in PSPM3-like sequences is the distal
histidine residue, which has been replaced by an arginine in most species, and the distal tyrosine that is
also poorly conserved (Fig. 2, Supplemental Fig. S1). Among PSPM3-like sequences we observe the
conservation of negatively charged residues and a less frequent occurrence of glycine (compared to
OOP/CyOP/Oct1) (Fig. 2), which might affect the flexibility in this region of the PSPM3-like proteins.
Impact of substitutions in the distal peptide-anchoring site on peptidase activity
We have previously shown that altering the distal substrate-anchoring residues H703 or Y709 to
This article is protected by copyright. All rights reserved.
Acc
epte
d A
rticl
ephenylalanine abolished activity of OOP, as it prevents hydrogen bonding to the substrate (Kmiec et
al. 2013). Surprisingly, these residues are not conserved in PSMP3 sequences, with the distal
substrate-binding region of Arabidopsis PSPM3 containing R/S/R residues replacing the distal H703,
Y709 and Y716 in OOP, respectively (Supplemental Fig. S1). To understand how the evolutionary
changes observed in PSPM3-like sequences within the distal substrate-binding regions influence the
peptidolytic activity, we engineered OOP variants with single amino acid substitutions reflecting the
alterations observed in Arabidopsis PSPM3. We overexpressed and purified three variants of OOP
bearing one of the following changes in the substrate-binding motif: H703R, Y709S and Y716R
(Supplemental Fig. S2, Fig. 2). All variants migrated as monomers as analyzed by size-exclusion
chromatography, indicating that these substitutions do not interfere with the overall fold of the
enzymes (Supplemental Fig. S2). We subsequently analyzed the activity of these variants using three
different known substrates of OOP: 8 a.a. octSdh1, 9 a.a. substrate V and 12 a.a. pF1β 43–53 (Kmiec
et al. 2013, Teixeira et al. 2015). As positive and negative controls, we used wild-type OOP and a
catalytically inactive variant, in which E572 from the zinc-binding motif was replaced by glutamine
(OOPE572Q), respectively. Degradation of all three substrates was completely abolished in the H703R
and Y716R variants, as well as in the proteolytically inactive E572 (Fig. 3). The Y709S variant
exhibited lower activity in the degradation of the shorter substrates (octSdh1 and substrate V), but
displayed a 3-fold increase in activity in the degradation of pF1β 43–53 (Fig. 3).
Discussion
Sequence analysis of the M3A family of metallopeptidases revealed a high level of conservation in the
course of evolution. Members of this family are present in all kingdoms of life, suggesting an ancient
origin (Supplemental Table S1). The phylogenetic analysis of the plant M3A peptidases reveals three
well-defined subfamilies, with OOP/CyOP-like (involved in peptide degradation) present in all
kingdoms of life, Oct1-like (involved in mitochondrial pre-protein maturation) conserved in
eukaryotes and PSPM3-like peptidases being plant-specific. The lack of PSPM3-like homologues in
algae (Cyanidioschyzon merolae, Chlamydomonas reinhardtii, Ectocarpus siliculosus, Volvox
carteri), moss (Physcomitrella patens) or in lycophyta (Selaginella moellendorffii) suggests that
PSPM3-like M3A peptidases evolved later during the land plant evolution.
A closer look at the active site revealed a fully conserved zinc-binding motif, which is a signature
catalytic motif for all proteolytically active metallopetidases of the MA clan, including OOP/CyOP-
and Oct1-like peptidases. Interestingly, PSPM3-like peptidases do not possess the key H-Y-Y residues
within the distal substrate-binding motif that were shown to interact with peptide substrates of OOP
peptidase (Kmiec et al. 2013). These distal residues are conserved in all subfamilies of M3A
peptidases, including the bacterial exopeptidase Dcp (data not shown), which suggests that the H-Y-Y
residues are important for interaction with a wide range of substrates of different lengths. Substitution
of the distal residues H703 and Y716 in OOP for the corresponding ones present in PSPM3 (R-R)
This article is protected by copyright. All rights reserved.
Acc
epte
d A
rticl
eresulted in an inhibition of peptidolytic activity, suggesting that such active site configuration does not
support substrate binding. The lack of the distal histidine is conserved among all PSPM3-like
sequences, being most commonly replaced by an arginine (in 14 out of 17 sequences). In one sequence
(Medicago truncatula), histidine is replaced by phenylalanine, a substitution that also inhibits
peptidolytic activity (Kmiec et al. 2013). Conversely, the substitution of Y706 in OOP for S did not
prevent peptidolytic activity (in the case of pF1β 43–53 we even observed a 3-fold increase), possibly
because it is a conservative change reflecting an alteration of the size of the side chain but retaining
the –OH group required for hydrogen bonding with the substrate.
Interestingly, the changes in the distal substrate-binding motif observed in Arabidopsis PSPM3
are characteristic for all PSPM3-like peptidases. Based simply on the conservation of residues that do
not support peptidase activity in the distal substrate-binding region among PSPM3-like proteins, it is
tempting to speculate that PSPM3-like proteins are actually proteolytically inactive. In this way, the
plant specific PSPM3-like proteins could have evolved to perform specialized functions as
proteolytically inactive peptidase homologues. Occurrence of inactive homologs in multi-member
family of peptidases is common. Interesting examples of the divergent evolution of inactive peptide
homologs exist in the large families of FtsH and Rhom peptidases, where the proteolytically inactive
members (FtsHi and iRhoms) were shown to perform vital, but different functions than the active FtsH
and Rhom peptidases (Christova et al. 2013, Hsu et al. 2010, Kadirjan-Kalbach et al. 2012, Zettl et al.
2011). It is worth noting that FtsHi and iRhoms lack the signature catalytic residues in their active
sites (i.e. HEXXH and S-H, respectively), which is not the case for PSPM3-like peptidases. We should
point out that presently we cannot exclude that PSMP3-like proteins are, in fact, active peptidases.
However, if that were the case, the mode of substrate binding in the internal cavity of PSPM3-like
peptidases, or the architecture of the substrate-binding site itself would have to be very different from
the organization observed in OOP/CyOP/Oct1-like peptidases.
In conclusion, sequence analysis of the M3A peptidase family reveals great conservation across
three domains of life, but with observed neo-functionalization in eukaryotic organisms, particularly in
the plant lineage. Despite possessing a similar structure and overall fold, M3A peptidases have
specialized to perform distinct functions (e.g. protein maturation and peptide degradation) and
therefore, constitute an interesting example of functional divergence among plant peptidases.
Author contributions
BK, PFT performed the experiments; BK, PFT, EG wrote the manuscript; MWM took part in the
initial stage of the project.
Acknowledgements – This work was supported by research grants from The Swedish Research
Council and The Swedish Foundation for International Cooperation in Research and Higher Education
(STINT) to EG. MWM was supported by an Australian Research Council Future Fellowship grant
This article is protected by copyright. All rights reserved.
Acc
epte
d A
rticl
eFT130100112.
References
Carrie C, Small I (2013) A reevaluation of dual-targeting of proteins to mitochondria and chloroplasts.
Biochim Biophys Acta 1833: 253–259
Carrie C, Venne AS, Zahedi RP, Soll J (2015) Identification of cleavage sites and substrate proteins
for two mitochondrial intermediate peptidases in Arabidopsis thaliana. J Exp Bot 66: 2691–2708
Carrie C, Whelan J (2013) Widespread dual targeting of proteins in land plants: when, where, how and
why. Plant Signal Behav 8: e25034
Chew A, Sirugo G, Alsobrook JP, 2nd, Isaya G (2000) Functional and genomic analysis of the human
mitochondrial intermediate peptidase, a putative protein partner of frataxin. Genomics 65: 104–
112
Christova Y, Adrain C, Bambrough P, Ibrahim A, Freeman M (2013) Mammalian iRhoms have
distinct physiological functions including an essential role in TACE regulation. EMBO Rep 14:
884–890
Falkevall A, Alikhani N, Bhushan S, Pavlov PF, Busch K, Johnson KA, Eneqvist T, Tjernberg L,
Ankarcrona M, Glaser E (2006) Degradation of the amyloid beta-protein by the novel
mitochondrial peptidasome, PreP. J Biol Chem 281: 29096–29104
Garcia-Alvarez N, Teichert U, Wolf DH (1987) Proteinase yscD mutants of yeast. Isolation and
characterization. Eur J Biochem 163: 339–346
Ge C, Spanning E, Glaser E, Wieslander A (2014) Import determinants of organelle-specific and dual
targeting peptides of mitochondria and chloroplasts in Arabidopsis thaliana. Mol Plant 7: 121–
136
Hsu SC, Belmonte MF, Harada JJ, Inoue K (2010) Indispensable Roles of Plastids in Arabidopsis
thaliana Embryogenesis. Curr Genomics 11: 338–349
Isaya G, Miklos D, Rollins RA (1994) MIP1, a new yeast gene homologous to the rat mitochondrial
intermediate peptidase gene, is required for oxidative metabolism in Saccharomyces cerevisiae.
Mol Cell Biol 14: 5603–5616
Johnson KA, Bhushan S, Stahl A, Hallberg BM, Frohn A, Glaser E, Eneqvist T (2006) The closed
structure of presequence protease PreP forms a unique 10,000 Angstroms3 chamber for
proteolysis. EMBO J 25: 1977–1986
Kadirjan-Kalbach DK, Yoder DW, Ruckle ME, Larkin RM, Osteryoung KW (2012) FtsHi1/ARC1 is
an essential gene in Arabidopsis that links chloroplast biogenesis and division. Plant J 72: 856–
867
Kalousek F, Isaya G, Rosenberg LE (1992) Rat liver mitochondrial intermediate peptidase (MIP):
purification and initial characterization. EMBO J 11: 2803–2809
Kambacheld M, Augustin S, Tatsuta T, Muller S, Langer T (2005) Role of the novel metallopeptidase
This article is protected by copyright. All rights reserved.
Acc
epte
d A
rticl
eMop112 and saccharolysin for the complete degradation of proteins residing in different
subcompartments of mitochondria. J Biol Chem 280: 20132–20139
Kessler JH, Khan S, Seifert U, Le Gall S, Chow KM, Paschen A, Bres-Vloemans SA, de Ru A, van
Montfoort N, Franken KL, Benckhuijsen WE, Brooks JM, van Hall T, Ray K, Mulder A,
Doxiadis, II, van Swieten PF, Overkleeft HS, Prat A, Tomkinson B, Neefjes J, Kloetzel PM,
Rodgers DW, Hersh LB, Drijfhout JW, van Veelen PA, Ossendorp F, Melief CJ (2011) Antigen
processing by nardilysin and thimet oligopeptidase generates cytotoxic T cell epitopes. Nat
Immunol 12: 45–53
Kmiec B, Teixeira PF, Berntsson RP, Murcha MW, Branca RM, Radomiljac JD, Regberg J, Svensson
LM, Bakali A, Langel U, Lehtio J, Whelan J, Stenmark P, Glaser E (2013) Organellar
oligopeptidase (OOP) provides a complementary pathway for targeting peptide degradation in
mitochondria and chloroplasts. Proc Natl Acad Sci USA 110: E3761–3769
Kmiec B, Teixeira PF, Glaser E (2014) Shredding the signal: targeting peptide degradation in
mitochondria and chloroplasts. Trends Plant Sci 19: 771–778
Murcha MW, Kmiec B, Kubiszewski-Jakubiak S, Teixeira PF, Glaser E, Whelan J (2014) Protein
import into plant mitochondria: signals, machinery, processing, and regulation. J Exp Bot 65:
6301–6335
Murcha MW, Narsai R, Devenish J, Kubiszewski-Jakubiak S, Whelan J (2015) MPIC: a mitochondrial
protein import components database for plant and non-plant species. Plant Cell Physiol 56: e10
Novak P, Dev IK (1988) Degradation of a signal peptide by protease IV and oligopeptidase A. J
Bacteriol 170: 5067–5075
Nystedt B, Street NR, Wetterbom A, Zuccolo A, Lin YC, Scofield DG, Vezzi F, Delhomme N,
Giacomello S, Alexeyenko A, Vicedomini R, Sahlin K, Sherwood E, Elfstrand M, Gramzow L,
Holmberg K, Hallman J, Keech O, Klasson L, Koriabine M, Kucukoglu M, Kaller M, Luthman J,
Lysholm F, Niittyla T, Olson A, Rilakovic N, Ritland C, Rossello JA, Sena J, Svensson T,
Talavera-Lopez C, Theissen G, Tuominen H, Vanneste K, Wu ZQ, Zhang B, Zerbe P, Arvestad
L, Bhalerao R, Bohlmann J, Bousquet J, Garcia Gil R, Hvidsten TR, de Jong P, MacKay J,
Morgante M, Ritland K, Sundberg B, Thompson SL, Van de Peer Y, Andersson B, Nilsson O,
Ingvarsson PK, Lundeberg J, Jansson S (2013) The Norway spruce genome sequence and conifer
genome evolution. Nature 497: 579–584
Pesquet E (2012) Plant proteases – from detection to function. Physiol Plant 145: 1–4
Rawlings ND, Waller M, Barrett AJ, Bateman A (2014) MEROPS: the database of proteolytic
enzymes, their substrates and inhibitors. Nucleic Acids Res 42: D503–509
Saric T, Graef CI, Goldberg AL (2004) Pathway for degradation of peptides generated by
proteasomes: a key role for thimet oligopeptidase and other metallopeptidases. J Biol Chem 279:
46723–46732
Stahl A, Moberg P, Ytterberg J, Panfilov O, Brockenhuus Von Lowenhielm H, Nilsson F, Glaser E
This article is protected by copyright. All rights reserved.
Acc
epte
d A
rticl
e(2002) Isolation and identification of a novel mitochondrial metalloprotease (PreP) that degrades
targeting presequences in plants. J Biol Chem 277: 41931–41939
Teixeira PF, Branca RM, Kmiec B, Glaser E (2015) A flowchart to analyze protease activity in plant
mitochondria. Methods Mol Biol 1305: 123–130
Teixeira PF, Glaser E (2013) Processing peptidases in mitochondria and chloroplasts. Biochim
Biophys Acta 1833: 360–370
Vimr ER, Green L, Miller CG (1983) Oligopeptidase-deficient mutants of Salmonella typhimurium. J
Bacteriol 153: 1259–1265
Vogtle FN, Prinz C, Kellermann J, Lottspeich F, Pfanner N, Meisinger C (2011) Mitochondrial protein
turnover: role of the precursor intermediate peptidase Oct1 in protein stabilization. Mol Biol Cell
22: 2135–2143
Yaron A, Mlynar D, Berger A (1972) A dipeptidocarboxypeptidase from E. coli. Biochem Biophys
Res Commun 47: 897–902
Zettl M, Adrain C, Strisovsky K, Lastun V, Freeman M (2011) Rhomboid family pseudoproteases use
the ER quality control machinery to regulate intercellular signaling. Cell 145: 79–91
Supporting Information
Additional Supporting Information may be found in the online version of this article:
Table S1. List of all M3A peptidases analyzed.
Fig. S1. Multiple sequence alignment of the region containing the distal substrate-binding residues.
Fig. S2. Purity and homogeneity of OOP variants.
Edited by I. M. Møller
This article is protected by copyright. All rights reserved.
Acc
epte
d A
rticl
eFigure legends
Fig. 1. Phylogenetic tree of M3A peptidases from vascular plants. Peptidases with predicted N-
This article is protected by copyright. All rights reserved.
Acc
epte
d A
rticl
eterminal TMD are indicated with green circles. Numbers represent bootstrap values. Analysis was
performed through MABL server (http://www.phylogeny.fr) using MUSCLE, curated using Gblocks;
bootstrap values were calculated using PhyML. The tree was created using iTOL tool
(http://itol.embl.de/).
Fig. 2. Conservation of the zinc-binding and the distal substrate-binding motifs in M3A peptidases.
Cartoon shows domain organization of M3A peptidases and position of the zinc- and the distal
substrate-binding motifs in the primary structure. Sequence logo analysis of the zinc-binding and
This article is protected by copyright. All rights reserved.
Acc
epte
d A
rticl
edistal substrate-binding motifs was performed using WebLogo (http://weblogo.berkeley.edu/logo.cgi).
Amino acids colored according to their physicochemical properties (KRH – blue, DE – red,
AVLIPWFM – black, NQ – magenta, other – green). The residues essential for Zn or peptide binding
are indicated by circles above the amino acids. All peptidases listed in Supplemental Table S1 were
included in the analysis.
Fig. 3. OOP variants mimicking At1g67690 peptide-binding site. A) Drawing of OOP structure (PDB,
This article is protected by copyright. All rights reserved.
Acc
epte
d A
rticl
e4KA7) with the residues involved in Zn binding are colored red and the residues of the distal peptide
binding site are colored yellow. The trapped substrate is shown in cyan and the zinc ion in gray. B)
Peptidolytic activity of OOP variants (H703R; Y706S; Y716R) bearing substitutions mimicking
PSPM3 sequence analyzed with three different substrates: 8 amino acid (a.a.) octSdh1 (FTSSALVH);
9 a.a. substrate V (RPPGFSAFK) and 12 a.a. pF1β43–53 (KGFLLNRAVQYK).
This article is protected by copyright. All rights reserved.