boblme-2015-ecology-28 · boblme-2015-ecology-28 . ii ... indian mackerel for which the...

34
ii BOBLME-2015-Ecology-28

Upload: phungthuy

Post on 16-Jun-2019

216 views

Category:

Documents


0 download

TRANSCRIPT

ii

BOBLME-2015-Ecology-28

ii

The designations employed and the presentation of material in this publication do not imply the expression of any opinion whatsoever on the part of Food and Agriculture Organization of the United Nations concerning the legal and development status of any country, territory, city or area or of its authorities, or concerning the delimitation of its frontiers or boundaries. The BOBLME Project encourages the use of this report for study, research, news reporting, criticism or review. Selected passages, tables or diagrams may be reproduced for such purposes provided acknowledgment of the source is included. Major extracts or the entire document may not be reproduced by any process without the written permission of the BOBLME Project Regional Coordinator. BOBLME contract: LOA/RAP/2012/35 For bibliographic purposes, please reference this publication as:

BOBLME (2015) Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers, BOBLME-2015-Ecology-28

Terminal report

Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers

Prepared by

Marine Fishery Resources Development and Management Department

Southeast Asian Fisheries Development Centre

2015

Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers

iv

Executive summary

Belonging to the family Scombridae of order Perciformes, the Indian mackerel (Rastrelliger kanagurta) is an important food fish and is commonly used in South and Southeast Asian cuisine. This mackerel species is commonly found in warm shallow waters along the coasts of the Indian and West Pacific oceans, and their surrounding seas. However, the population structure of the Indian mackerel is largely unknown in the entire BOBLME region.

In order to address the need to know the population structure of this species in the region, and to support improved regional resource conservation and management, the BOBLME Project work plan for 2012 was developed and the Project Steering Committee (PSC) adopted this initiative in March 2012. This project was the outcome from the Indian mackerel working group formed in 2011. The project was undertaken to develop the first ever region wide stock discrimination analysis for Indian mackerel, and at the same time contributing to the refinement of national assessments. This project was related to SEAFDEC/MFRDMD’s programme of work in support of the activities concerning Indian mackerel for which the SEAFDEC/MFRDMD has the regional responsibility. A Letter of Agreement to that effect was signed between the Marine Fishery Resources Development and Management Department, Southeast Asian Fisheries Development Centre (SEAFDEC/MFRDMD) and FAO-BOBLME granting support of RM 181 330.00.

Through the first genetic working group meeting in Colombo, Sri Lanka from 28 to 29 May 2012, SEAFDEC/MFRDMD was appointed to sample 100 fishes each of Indian mackerel for genetic work from two locations namely Kuantan (KT) and Kudat (KD), Malaysia, as outgroups (South China Sea). One location each from Male’ Maldives (MA) and two locations from Myanmar with Yangon representative for Rakhine (RK) and Kawthung representative for Myeik (MY) were also chosen for sampling locations. The aim of this meeting was to establish a sound genetic sampling scheme, and analysis outline for assessing the stock structure of Indian mackerel in the Bay of Bengal region. All the samples were taken back to the biotechnology laboratory in SEAFDEC/MFRDMD for further analysis and PCR products have been genotyped by SciGenom facility in Kochi, India for fragment analysis.

The Indian mackerel genetics harmonisation training workshop was also held on 20 to 27 August 2013 at the genetics lab in the National Bureau of Fish Genetic Resources (NBFGR) Regional Research Station, Kochi, located at the campus of the Central Marine Fisheries Research Institute(CMFRI). This training workshop allowed regional genetic laboratories to use a standard set of genetic markers to analyse local R. kanagurta samples.

Through this project it is hoped that knowledge can be improved and understanding the population structure will facilitate better assessment of the stocks and ultimately improved better management of the fisheries of Indian mackerel in the region.

Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers

v

Table of contents

1. Background .................................................................................................................................. 1

2. Objectives .................................................................................................................................... 1

3. Implementation of project .......................................................................................................... 1

3.1. Tissue sample collection ....................................................................................................... 1

3.2. Laboratory analysis ............................................................................................................... 1

4. Outcomes .................................................................................................................................... 2

5. Conclusion ................................................................................................................................... 2

6. Recommendations ....................................................................................................................... 2

Appendix I Biological sampling information for collections R. kanagurta used for DNA analysis by country. ....................................................................................................................... 3

Appendix II List of fourteen primers identified at NBFGR with optimal annealing conditions which can be used for genetic analysis of R. kanagurta ................................................ 24

Appendix III Number of R. kanagurta genotyped by loci and sample site. ....................................... 26

Appendix IV Genotype data for R. kanagurta samples collected from South China Sea, Maldives and Myanmar. ................................................................................................................ 27

Acronyms used

BOBLME Bay of Bengal Large Marine Ecosystem Project

CMFRI Central Marine Fisheries Research Institute

DNA Deoxyribonucleic acid

DOF Department of Fisheries

FAO Food and Agriculture Organisation

MFRDMD Marine Fishery Resources Development and Management Department

NBFGR National Bureau of Fish Genetic Resources

PCR Polymerase Chain Reaction

PSC Project Steering Committee

RM Malaysian Ringgit

SCS South China Sea

SEAFDEC Southeast Asian Fisheries Development Centre

SOP Standard Operating Procedure

Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers

1

1. Background

The Indian mackerel working group meeting held in Colombo, Sri Lanka from 28 to 29 May 2012, came out with a sampling plan for implementation of the genetic stock structure study on Indian mackerel in the Bay of Bengal region and established standardized procedures for marker use, identification and analysis. A Letter of Agreement to that effect was signed between the Marine Fishery Resources Development and Management Department, Southeast Asian Fisheries Development Centre (SEAFDEC/MFRDMD) and BOBLME-FAO granting support of RM 104 530 for conducting a one-year activity from September 2012 to September 2013. However, the project had been extended to February 2015 with additional financial contribution RM 76 800.00 to make it a total of RM 181 330.00. According to the agreement SEAFDEC/MFRDMD was appointed to carry out sampling programme for genetic test of specimens of Indian mackerel in the South China Sea (SCS), Myanmar, Bangladesh and Maldives, and undertake the genetic testing by using microsatellite method and report on the results.

In order to address the need to harmonize the genetic data among the BOBLME region, a regional training and standardisation workshop, the Indian mackerel genetics harmonisation training workshop was held from 20 to 27 August 2013 at the genetics lab in the National Bureau of Fish Genetic Resources (NBFGR) Regional Research Station, Kochi, Kerala, India, located at the campus of Central Marine Fisheries Research Institute. During this training a standardized protocol on laboratory analysis of genetic stock identification of Indian mackerel across the BOBLME region using microsatellite markers was produced.

2. Objectives

Objectives of this project were:

To improve understanding of the population structure of Indian mackerel in the South China Sea outside the BOBLME basin but part of the distribution range of the species. The number of fish specimens tested and the results with regard to relatedness in stocks at different locations during different times will be indicators of performance.

To assist BOBLME member countries (Myanmar, Bangladesh and Maldives) to improve understanding of the population structure of Indian mackerel in the BOBLME basin.

3. Implementation of project

3.1. Tissue sample collection

A total number of 668 samples were collected from South China Sea (Kuantan and Kudat), Bangladesh (Chittagong and Cox’ Bazaar), Myanmar (Yangon (Rakhine) and Kawthung (Myeik)) and Maldives (Male’) according to Standard Operating Procedure (SOP) of Tissue sample collection provided by BOBLME. Sampling activity in Kudat (100 samples) was conducted from 7 to 11 January 2013 and Kuantan (100 samples) from 11 to 13 March 2013. Samples from Bangladesh (200 samples), Myanmar (200 samples) and Maldives (68 samples) were couriered to SEAFDEC/MFRDMD. The samples were labelled according to; Kuantan (KT), Kudat (KD), Rakhine (RK), Myeik (MY), Male’ (MA) and Control Sample (C). The list of samples collected for each sampling sites is in Appendix I

3.2. Laboratory analysis

A total of 14 primers were used for this project as listed in Appendix II The DNA from fin clip tissue was extracted from August 2013 and the PCR products were sent to India for genotyping started

Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers

2

from June 2014. An overall 6 308 (96%) PCR products (468 samples x 14 loci) have been genotyped by SciGenom in Cochin, India for fragment analysis as in Appendix III. The genotyping results are shown in Appendix IV.

A total of 200 samples from Bangladesh were transferred to NBFGR, Cochin India for laboratory analysis due to technical problem. The samples were sent out to India on June 2014.

The regional data analysis will be done by NBFGR, CMFRI and BOBLME genetic consultants as had been agreed during the BOBLME Genetics working group meeting in Phuket on 17 and 18 February 2015.

4. Outcomes

a. Improved understanding of the population structure of Indian mackerel in the South China Sea outside the BOBLME basin but part of the distribution range of the species

b. Improved understanding of the population structure of Indian mackerel in the BOBLME basin (Myanmar, Bangladesh and Maldives)

5. Conclusion

SEAFDEC/MFRDMD has successfully collected all the specimens needed from the South China Sea, Myanmar and Maldives as specified in the Letter of Agreement. Altogether, 468 specimens were analysed with 14 microsatellite loci and 6308 genotype (96%) were successfully gathered. The regional analysis of this species can lead to proper stock assessment of Indian mackerel in the BOBLME region. This project also has been a good example of countries working together for trans-boundary management of fishery resources.

6. Recommendations

Determination of genetic stock structure of Bay of Bengal Indian mackerel will need additional work to evaluate the genotypic data collected by different genetic laboratories in the region. There are still data quality issues, missing data, and species identification which need to be addressed in the next phase of work.

With the continuation of the project and alternative funding resources could open more opportunities to do more work on genetic study with other species such as tuna and grouper.

Further develop inter-laboratory cooperation to facilitate capacity building among laboratories by shared common projects.

The results obtained can appraise the managers on the importance of the work in determining the population structure of the pelagic resources.

Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers

3

Appendix I Biological sampling information for collections R. kanagurta used for DNA analysis by country.

Country : Malaysia Sampling area : Kuantan

Species : Rastrelliger kanagurta Total number of samples : 100

Technical Officer In Charge : Noorul Azliana binti Jamaludin

Agency: SEAFDEC/MFRDMD

E-mail address : [email protected] Contact no. : +6096175940

Vial no.

Date of sampling

Standard length (mm/cm)

Body weight (g)

Type of gear Sex (M/F)

Gonad weight (g)

Gonad stage ( I to V)

1. 3/12/13 18.9 144.2 Purse seine M 4.3 III

2. 3/12/13 19.3 167.1 Purse seine F 10.4 IV

3. 3/12/13 19.4 160.6 Purse seine M 9.1 IV

4. 3/12/13 19.1 142.9 Purse seine M 4.7 III

5. 3/12/13 19.4 165.8 Purse seine M 4.2 III

6. 3/12/13 19.2 150.1 Purse seine F 6.8 IV

7. 3/12/13 18.7 142.2 Purse seine M 7.4 IV

8. 3/12/13 18.5 136.6 Purse seine M 4.7 III

9. 3/12/13 18.6 148.1 Purse seine F 10.8 IV

10. 3/12/13 17.6 120.2 Purse seine M 4.5 IV

11. 3/12/13 18.1 130.5 Purse seine M 4.6 III

12. 3/12/13 19.1 157.7 Purse seine F 10.5 IV

13. 3/12/13 18.3 140.6 Purse seine M 2.8 III

14. 3/12/13 18.0 135.9 Purse seine M 6.3 IV

15. 3/12/13 19.7 172.8 Purse seine M 8.0 IV

16. 3/12/13 17.4 132.3 Purse seine M 4.7 III

17. 3/12/13 18.1 135.4 Purse seine M 5.7 IV

18. 3/12/13 17.8 124.5 Purse seine M 5.8 IV

19. 3/12/13 18.4 131.7 Purse seine M 6.4 IV

20. 3/12/13 18.3 142.0 Purse seine F 12.1 IV

21. 3/12/13 17.1 117.2 Purse seine M 2.7 III

22. 3/12/13 17.8 117.1 Purse seine M 2.7 III

23. 3/12/13 18.3 134.0 Purse seine M 3.7 III

24. 3/12/13 18.6 146.5 Purse seine F 13.6 IV

25. 3/12/13 19.1 146.0 Purse seine F 6.7 III

26. 3/12/13 18.7 156.5 Purse seine F 8.5 IV

27. 3/12/13 18.7 156.3 Purse seine M 5.8 IV

28. 3/12/13 18.2 126.2 Purse seine M 4.5 III

29. 3/12/13 18.9 152.8 Purse seine F 13.2 IV

30. 3/12/13 18.4 137.5 Purse seine M 6.5 IV

Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers

4

31. 3/12/13 18.7 143.6 Purse seine F 3.0 III

32. 3/12/13 18.7 133.1 Purse seine M 2.2 III

33. 3/12/13 18.7 152.3 Purse seine F 10.2 IV

34. 3/12/13 18.4 131.3 Purse seine F 4.2 III

35. 3/12/13 19.0 143.2 Purse seine F 9.5 IV

36. 3/12/13 17.6 129.0 Purse seine M 5.2 III

37. 3/12/13 17.8 129.4 Purse seine M 8.0 IV

38. 3/12/13 18.4 148.7 Purse seine F 6.1 IV

39. 3/12/13 18.1 119.6 Purse seine M 1.6 III

40. 3/12/13 18.6 133.9 Purse seine M 2.0 III

41. 3/12/13 18.2 133.1 Purse seine M 1.6 III

42. 3/12/13 17.3 114.1 Purse seine M 5.6 IV

43. 3/12/13 18.0 125.8 Purse seine M 2.8 III

44. 3/12/13 18.5 142.9 Purse seine F 10.9 IV

45. 3/12/13 18.1 140.9 Purse seine M 8.6 IV

46. 3/12/13 17.6 116.6 Purse seine M 2.2 III

47. 3/12/13 17.6 115.7 Purse seine F 5.4 IV

48. 3/12/13 18.1 130.1 Purse seine F 2.2 III

49. 3/12/13 19.1 153.3 Purse seine M 4.6 IV

50. 3/12/13 17.7 128.7 Purse seine M 6.4 III

51. 3/12/13 20.0 178.1 Purse seine F 11.6 IV

52. 3/12/13 18.6 140.9 Purse seine M 2.6 IV

53. 3/12/13 17.9 124.9 Purse seine M 6.9 III

54. 3/12/13 18.0 129.3 Purse seine F 6.2 IV

55. 3/12/13 20.0 181.3 Purse seine M 4.9 III

56. 3/12/13 18.8 140.5 Purse seine M 2.7 IV

57. 3/12/13 18.7 160.3 Purse seine F 12.7 IV

58. 3/12/13 19.1 151.2 Purse seine F 5.0 III

59. 3/12/13 17.4 119.3 Purse seine M 5.3 IV

60. 3/12/13 17.4 122.5 Purse seine F 8.5 IV

61. 3/12/13 17.6 125.6 Purse seine M 6.3 IV

62. 3/12/13 18.4 143.0 Purse seine M 5.2 IV

63. 3/12/13 18.8 154.4 Purse seine M 2.8 III

64. 3/12/13 18.0 125.8 Purse seine M 4.1 IV

65. 3/12/13 18.3 123.1 Purse seine M 1.2 III

66. 3/12/13 18.1 118.2 Purse seine F 3.5 III

67. 3/12/13 19.0 153.8 Purse seine M 5.9 IV

68. 3/12/13 17.8 132.4 Purse seine M 4.2 IV

69. 3/12/13 17.7 123.5 Purse seine F 5.6 IV

Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers

5

70. 3/12/13 18.2 131.4 Purse seine F 7.2 IV

71. 3/12/13 19.7 147.9 Purse seine M 6.7 IV

72. 3/12/13 18.8 144.4 Purse seine F 0.2 III

73. 3/12/13 17.2 117.8 Purse seine M 4.6 IV

74. 3/12/13 18.1 133.3 Purse seine M 6.2 IV

75. 3/12/13 19.0 152.6 Purse seine F 5.2 III

76. 3/12/13 18.4 138.3 Purse seine M 5.6 IV

77. 3/12/13 18.1 141.1 Purse seine M 9.0 IV

78. 3/12/13 13.6 128.6 Purse seine M 5.9 IV

79. 3/12/13 18.7 149.5 Purse seine F 5.2 IV

80. 3/12/13 17.5 134.0 Purse seine M 4.9 IV

81. 3/12/13 18.3 134.7 Purse seine M 4.8 III

82. 3/12/13 18.1 127.8 Purse seine M 4.5 III

83. 3/12/13 17.9 129.7 Purse seine M 1.4 III

84. 3/12/13 13.4 121.8 Purse seine F 4.8 IV

85. 3/12/13 17.8 116.4 Purse seine F 2.2 III

86. 3/12/13 18.2 121.0 Purse seine F 4.1 IV

87. 3/12/13 18.2 153.5 Purse seine M 5.8 IV

88. 3/12/13 19.2 165.5 Purse seine F 7.3 IV

89. 3/12/13 18.2 143.5 Purse seine M 4.4 IV

90. 3/12/13 18.4 137.8 Purse seine M 6.0 IV

91. 3/12/13 18.8 152.3 Purse seine F 4.6 III

92. 3/12/13 17.8 127.2 Purse seine M 5.9 IV

93. 3/12/13 17.3 114.8 Purse seine M 4.5 III

94. 3/12/13 17.7 126.8 Purse seine M 3.6 III

95. 3/12/13 17.8 130.4 Purse seine M 7.2 IV

96. 3/12/13 17.4 120.7 Purse seine F 4.7 IV

97. 3/12/13 17.5 117.4 Purse seine M 3.4 III

98. 3/12/13 17.3 121.8 Purse seine F 6.5 IV

99. 3/12/13 19.1 158.8 Purse seine F 6.3 IV

100. 3/12/13 18.2 129.6 Purse seine M 3.8 IV

Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers

6

Country : Malaysia Sampling area : Kudat

Species : Rastrelliger kanagurta Total number of samples : 100

Technical Officer In Charge : Noorul Azliana binti Jamaludin

Agency : SEAFDEC/MFRDMD

E-mail address : [email protected] Contact no. : +6096175940

Vial no.

Date of sampling

Standard length (mm/cm)

Body weight (g)

Type of gear Sex (M/F)

Gonad weight (g)

Gonad stage ( I to V)

1. 1/8/12 190.0 120.3 Purse seine F 2.9 III

2. 1/8/12 190.0 133.1 Purse seine F 3.5 III

3. 1/8/12 195.0 159.2 Purse seine M 8.2 III

4. 1/8/12 204.0 166.3 Purse seine M 4.0 III

5. 1/8/12 194.0 126.0 Purse seine F 2.4 IV

6. 1/8/12 202.0 149.2 Purse seine F 3.7 III

7. 1/8/12 179.0 101.4 Purse seine M 2.5 III

8. 1/8/12 204.0 176.9 Purse seine F 6.0 IV

9. 1/8/12 203.0 167.1 Purse seine M 6.1 V

10. 1/8/12 195.0 163.1 Purse seine M 7.6 III

11. 1/8/12 209.0 179.6 Purse seine F 4.8 III

12. 1/8/12 194.0 154.6 Purse seine M 3.9 IV

13. 1/8/12 198.0 145.3 Purse seine M 6.7 III

14. 1/8/12 202.0 171.5 Purse seine M 5.8 III

15. 1/8/12 203.0 174.1 Purse seine M 6.8 III

16. 1/8/12 198.0 162.5 Purse seine F 5.1 IV

17. 1/8/12 180.0 121.9 Purse seine M 3.9 III

18. 1/8/12 205.0 163.9 Purse seine F 2.6 IV

19. 1/8/12 183.0 115.4 Purse seine M 2.4 IV

20. 1/8/12 192.0 151.6 Purse seine M 4.5 III

21. 1/8/12 191.0 131.3 Purse seine M 2.1 IV

22. 1/8/12 192.0 146.3 Purse seine F 7.1 III

23. 1/8/12 197.0 162.0 Purse seine F 5.8 III

24. 1/8/12 183.0 114.4 Purse seine M 2.2 IV

25. 1/8/12 189.0 139.8 Purse seine M 9.7 III

26. 1/8/12 203.0 179.3 Purse seine M 2.4 IV

27. 1/8/12 196.0 146.8 Purse seine F 4.2 III

28. 1/8/12 203.0 165.9 Purse seine F 3.9 III

29. 1/8/12 187.0 122.2 Purse seine M 3.3 III

30. 1/8/12 197.0 166.1 Purse seine F 4.7 III

31. 1/8/12 203.0 196.1 Purse seine F 7.8 III

32. 1/8/12 181.0 122.6 Purse seine F 2.0 IV

Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers

7

33. 1/8/12 197.0 144.2 Purse seine F 4.3 III

34. 1/8/12 183.0 188.4 Purse seine M 1.9 II

35. 1/8/12 202.0 164.3 Purse seine M 2.7 III

36. 1/8/12 190.0 135.1 Purse seine M 2.6 III

37. 1/8/12 191.0 122.0 Purse seine F 3.3 III

38. 1/8/12 194.0 155.2 Purse seine F 5.1 III

39. 1/8/12 192.0 148.8 Purse seine M 3.6 III

40. 1/8/12 180.0 106.6 Purse seine F 1.7 III

41. 1/8/12 189.0 121.8 Purse seine F 3.4 III

42. 1/8/12 176.0 105.1 Purse seine F 1.6 III

43. 1/8/12 194.0 148.4 Purse seine F 4.0 III

44. 1/8/12 201.0 160.6 Purse seine F 2.1 IV

45. 1/8/12 200.0 165.5 Purse seine M 6.8 III

46. 1/8/12 193.0 144.3 Purse seine M 2.7 III

47. 1/8/12 203.0 172.2 Purse seine F 3.2 III

48. 1/8/12 186.0 126.8 Purse seine M 2.4 III

49. 1/8/12 178.0 115.0 Purse seine M 3.5 III

50. 1/8/12 181.0 102.3 Purse seine M 1.9 IV

51. 1/8/12 196.0 156.9 Purse seine M 4.9 III

52. 1/8/12 191.0 141.0 Purse seine M 4.8 III

53. 1/8/12 191.0 147.8 Purse seine M 6.0 III

54. 1/8/12 176.0 110.0 Purse seine M 1.6 III

55. 1/8/12 182.0 119.3 Purse seine F 2.8 III

56. 1/8/12 176.0 108.0 Purse seine F 0.4 V

57. 1/8/12 203.0 160.9 Purse seine M 2.7 II

58. 1/8/12 188.0 134.6 Purse seine M 5.2 III

59. 1/8/12 193.0 153.2 Purse seine F 4.3 III

60. 1/8/12 198.0 164.1 Purse seine M 7.8 III

61. 1/8/12 192.0 146.0 Purse seine M 4.5 III

62. 1/8/12 198.0 169.9 Purse seine F 3.6 III

63. 1/8/12 193.0 158.4 Purse seine M 8.2 III

64. 1/8/12 195.0 154.1 Purse seine F 7.9 III

65. 1/8/12 211.0 203.2 Purse seine M 8.1 IV

66. 1/8/12 188.0 129.5 Purse seine F 2.7 III

67. 1/8/12 194.0 127.9 Purse seine F 3.9 III

68. 1/8/12 194.0 149.8 Purse seine F 2.9 III

69. 1/8/12 215.0 215.2 Purse seine M 6.6 III

70. 1/8/12 192.0 147.5 Purse seine M 5.6 III

71. 1/8/12 206.0 188.0 Purse seine M 7.9 III

Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers

8

72. 1/8/12 188.0 123.5 Purse seine F 2.5 IV

73. 1/8/12 193.0 142.9 Purse seine F 2.7 IV

74. 1/8/12 196.0 164.1 Purse seine F 6.2 III

75. 1/8/12 214.0 201.3 Purse seine M 10.2 III

76. 1/8/12 196.0 148.3 Purse seine M 5.4 IV

77. 1/8/12 197.0 157.2 Purse seine F 3.5 III

78. 1/8/12 179.0 116.1 Purse seine F 2.9 IV

79. 1/8/12 203.0 173.2 Purse seine F 3.9 IV

80. 1/8/12 184.0 130.7 Purse seine F 4.2 IV

81. 1/8/12 204.0 177.9 Purse seine F 3.3 III

82. 1/8/12 199.0 152.3 Purse seine M 4.6 III

83. 1/8/12 190.0 117.9 Purse seine F 1.9 IV

84. 1/8/12 184.0 129.3 Purse seine F 0.8 V

85. 1/8/12 182.0 135.5 Purse seine M 1.9 II

86. 1/8/12 173.0 106.0 Purse seine M 3.2 III

87. 1/8/12 192.0 136.5 Purse seine M 9.1 III

88. 1/8/12 205.0 170.9 Purse seine M 2.1 II

89. 1/8/12 188.0 121.8 Purse seine F 4.6 III

90. 1/8/12 197.0 147.1 Purse seine F 3.3 III

91. 1/8/12 191.0 150.4 Purse seine M 8.6 III

92. 1/8/12 186.0 162.2 Purse seine M 2.2 III

93. 1/8/12 186.0 130.4 Purse seine M 2.5 IV

94. 1/8/12 176.0 108.7 Purse seine M 2.0 IV

95. 1/8/12 177.0 102.1 Purse seine M 2.9 IV

96. 1/8/12 190.0 104.9 Purse seine M 2.5 IV

97. 1/8/12 184.0 122.5 Purse seine M 7.5 III

98. 1/8/12 200.0 165.9 Purse seine M 3.5 III

99. 1/8/12 194.0 154.9 Purse seine M 3.8 II

100. 1/8/12 192.0 143.0 Purse seine M 4.0 II

Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers

9

Country : Bangladesh Sampling area : Cox'n Baryan

Species : Rastrelliger kanagurta Total number of samples : 100

Technical Officer In Charge :

Agency : Bangladesh Fisheries Research Institute

E-mail address : Contact no. :

Vial no.

Date of sampling

Standard length (mm/cm)

Body weight (g)

Type of gear

Gill raker count*

Sex (M/F)

Gonad stage ( I to V)

1. 4/18/13 18.9 150 Net 52 M V

2. 4/18/13 19.5 150 Net 52 F V

3. 4/18/13 18.5 150 Net 50 F V

4. 4/18/13 18.5 140 Net 50 F V

5. 4/18/13 18.5 145 Net 50 F II

6. 4/18/13 18.5 145 Net 50 M V

7. 4/18/13 19 150 Net 52 F V

8. 4/18/13 18.5 150 Net 50 F V

9. 4/18/13 18.5 150 Net 52 M V

10. 4/18/13 18.5 150 Net 52 F V

11. 4/18/13 18 150 Net 50 F III

12. 4/18/13 18 150 Net 50 M V

13. 4/18/13 18.5 155 Net 50 M V

14. 4/18/13 18.5 152 Net 52 M V

15. 4/18/13 18.5 148 Net 52 M V

16. 4/18/13 18.5 150 Net 50 M V

17. 4/18/13 19 153 Net 52 M IV

18. 4/18/13 19 152 Net 52 F V

19. 4/18/13 19 153 Net 52 M II

20. 4/18/13 18.5 145 Net 50 F V

21. 4/18/13 18.5 150 Net 50 M V

22. 4/18/13 18.5 150 Net 50 M V

23. 4/18/13 18 150 Net 48 F V

24. 4/18/13 19 153 Net 52 M V

25. 4/18/13 18.5 150 Net 50 M V

26. 4/18/13 18 145 Net 52 M II

27. 4/18/13 18 120 Net 52 M V

28. 4/18/13 18.5 150 Net 52 M II

29. 4/18/13 18.5 145 Net 52 M V

30. 4/18/13 18 150 Net 50 F V

31. 4/18/13 18.5 150 Net 52 F V

32. 4/18/13 18 145 Net 50 M V

Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers

10

33. 4/18/13 18 145 Net 50 F V

34. 4/18/13 18 150 Net 50 M V

35. 4/18/13 17.5 150 Net 48 F V

36. 4/18/13 18.5 150 Net 50 F V

37. 4/18/13 18.5 150 Net 50 F V

38. 4/18/13 18.5 152 Net 52 F V

39. 4/18/13 17.5 150 Net 50 F V

40. 4/18/13 18.5 150 Net 52 M V

41. 4/18/13 18 125 Net 52 M V

42. 4/18/13 17.5 140 Net 50 F V

43. 4/18/13 18 150 Net 48 F V

44. 4/18/13 18.5 152 Net 52 M V

45. 4/18/13 18 150 Net 50 M V

46. 4/18/13 18 150 Net 50 F V

47. 4/18/13 18.5 152 Net 52 M V

48. 4/18/13 18 150 Net 50 F V

49. 4/18/13 18 150 Net 50 M V

50. 4/18/13 18.5 152 Net 52 F V

51. 4/18/13 17.5 120 Net 48 F V

52. 4/18/13 19 180 Net 50 F V

53. 4/18/13 18 148 Net 50 M V

54. 4/18/13 18 150 Net 48 F V

55. 4/18/13 17.5 150 Net 52 M V

56. 4/18/13 18 150 Net 52 M III

57. 4/18/13 18.5 150 Net 40 M V

58. 4/18/13 17.5 148 Net 50 M V

59. 4/18/13 18 150 Net 52 F V

60. 4/18/13 18.5 170 Net 50 F V

61. 4/18/13 18 140 Net 52 M V

62. 4/18/13 18 150 Net 52 M V

63. 4/18/13 18 140 Net 52 F V

64. 4/18/13 18 140 Net 52 F V

65. 4/18/13 18.5 150 Net 50 F V

66. 4/18/13 17.5 140 Net 50 M V

67. 4/18/13 17.5 140 Net 50 F V

68. 4/18/13 18 140 Net 50 M V

69. 4/18/13 18 150 Net 50 F V

70. 4/18/13 18 150 Net 50 F V

71. 4/18/13 18 150 Net 50 F V

Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers

11

72. 4/18/13 18 147 Net 50 M V

73. 4/18/13 17.5 147 Net 48 F V

74. 4/18/13 17.5 150 Net 48 F V

75. 4/18/13 18 150 Net 50 F V

76. 4/18/13 17 148 Net 48 F V

77. 4/18/13 18.5 150 Net 50 F V

78. 4/18/13 18.5 150 Net 50 M III

79. 4/18/13 18 150 Net 50 F V

80. 4/18/13 18 150 Net 50 M I

81. 4/18/13 18 148 Net 50 F V

82. 4/18/13 17 110 Net 48 M V

83. 4/18/13 18 150 Net 50 F V

84. 4/18/13 17 145 Net 50 F V

85. 4/18/13 17.5 148 Net 50 F V

86. 4/18/13 18 153 Net 52 M V

87. 4/18/13 18 148 Net 52 F V

88. 4/18/13 18 150 Net 52 F V

89. 4/18/13 17.5 148 Net 48 F V

90. 4/18/13 17.5 148 Net 48 F V

91. 4/18/13 18 150 Net 50 F V

92. 4/18/13 18 148 Net 50 M V

93. 4/18/13 18 148 Net 50 F V

94. 4/18/13 18 160 Net 52 F V

95. 4/18/13 19 160 Net 52 F V

96. 4/18/13 17 145 Net 48 F V

97. 4/18/13 19 170 Net 52 F V

98. 4/18/13 17 148 Net 48 M V

99. 4/18/13 18.5 155 Net 52 F V

100. 4/18/13 18.5 160 Net 52 F V

Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers

12

Country : Bangladesh Sampling area : Chittagong

Species : Rastrelliger kanagurta Total number of samples : 100

Technical Officer In Charge :

Agency : Bangladesh Fisheries Research Institute

E-mail address : Contact no. :

Vial no.

Date of sampling

Standard length (mm/cm)

Body weight (g)

Type of gear

Gill raker count*

Sex (M/F)

Gonad stage ( I to V)

1. 4/7/13 19.8 150 Net 52 F IV

2. 4/7/13 18.3 120 Net 50 F IV

3. 4/7/13 18 120 Net 50 M IV

4. 4/7/13 18 130 Net 50 F II

5. 4/7/13 17.9 120 Net 48 F III

6. 4/7/13 18 120 Net 50 F V

7. 4/7/13 18 110 Net 50 M III

8. 4/7/13 18.6 120 Net 52 F IV

9. 4/7/13 18 120 Net 50 M II

10. 4/7/13 18.5 120 Net 52 M IV

11. 4/7/13 19.5 140 Net 52 F IV

12. 4/7/13 18 120 Net 48 M III

13. 4/7/13 18.2 130 Net 50 M IV

14. 4/7/13 18.5 120 Net 52 F IV

15. 4/7/13 17.6 110 Net 48 F III

16. 4/7/13 17.5 120 Net 46 F III

17. 4/7/13 18 120 Net 50 F II

18. 4/7/13 18 110 Net 50 M II

19. 4/7/13 18.5 120 Net 52 M III

20. 4/7/13 18 120 Net 50 M III

21. 4/7/13 18 110 Net 50 M III

22. 4/7/13 17.7 120 Net 48 M I

23. 4/7/13 18.4 120 Net 50 M IV

24. 4/7/13 19 120 Net 52 M IV

25. 4/7/13 17.5 120 Net 48 F V

26. 4/7/13 18 110 Net 50 F III

27. 4/7/13 17.5 110 Net 48 M III

28. 4/7/13 19 140 Net 52 M IV

29. 4/7/13 18 100 Net 50 M III

30. 4/7/13 18.3 120 Net 52 F IV

31. 4/7/13 19 130 Net 52 M IV

32. 4/7/13 18.3 120 Net 50 F IV

Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers

13

33. 4/7/13 18.6 120 Net 50 F IV

34. 4/7/13 18.5 110 Net 52 F III

35. 4/7/13 18 120 Net 50 M II

36. 4/7/13 18.6 120 Net 52 M IV

37. 4/7/13 17.7 120 Net 48 F V

38. 4/7/13 18.5 110 Net 52 M IV

39. 4/7/13 18.9 140 Net 52 F IV

40. 4/7/13 18 130 Net 48 M IV

41. 4/7/13 17.8 110 Net 48 F III

42. 4/7/13 18.8 130 Net 52 F IV

43. 4/7/13 18 120 Net 50 F V

44. 4/7/13 18.3 120 Net 52 F III

45. 4/7/13 18 120 Net 48 M III

46. 4/7/13 18.4 120 Net 52 M II

47. 4/7/13 18 120 Net 50 M III

48. 4/7/13 18 110 Net 50 M IV

49. 4/7/13 17.8 120 Net 48 M III

50. 4/7/13 18.5 120 Net 52 M III

51. 4/7/13 19 140 Net 52 M II

52. 4/7/13 17.8 100 Net 48 M III

53. 4/7/13 18.3 120 Net 50 F III

54. 4/7/13 18.6 130 Net 52 F II

55. 4/7/13 17.5 130 Net 48 F II

56. 4/7/13 18.4 110 Net 52 M IV

57. 4/7/13 18.4 110 Net 52 M III

58. 4/7/13 18.6 120 Net 52 F III

59. 4/7/13 18 120 Net 50 F IV

60. 4/7/13 18 110 Net 48 F IV

61. 4/7/13 18.8 130 Net 52 F III

62. 4/7/13 18.4 120 Net 50 M III

63. 4/7/13 18 120 Net 48 F III

64. 4/7/13 18.5 120 Net 52 F IV

65. 4/7/13 18 120 Net 48 M III

66. 4/7/13 19 130 Net 52 F IV

67. 4/7/13 18 130 Net 48 M IV

68. 4/7/13 18.4 110 Net 50 F IV

69. 4/7/13 18.5 120 Net 52 M III

70. 4/7/13 18 110 Net 48 F III

71. 4/7/13 18 120 Net 48 M IV

Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers

14

72. 4/7/13 17.8 120 Net 48 M IV

73. 4/7/13 19 140 Net 52 F IV

74. 4/7/13 18.6 120 Net 52 M III

75. 4/7/13 18 120 Net 50 F IV

76. 4/7/13 19 130 Net 52 F III

77. 4/7/13 18 110 Net 48 M V

78. 4/7/13 18 100 Net 50 M I

79. 4/7/13 18.5 120 Net 52 M I

80. 4/7/13 17.2 100 Net 46 M II

81. 4/7/13 18.3 110 Net 50 M III

82. 4/7/13 18.4 120 Net 50 M III

83. 4/7/13 18.2 120 Net 48 M IV

84. 4/7/13 18.5 120 Net 52 M III

85. 4/7/13 18.6 120 Net 52 M IV

86. 4/7/13 18 120 Net 48 F IV

87. 4/7/13 18 120 Net 48 M III

88. 4/7/13 17 100 Net 46 M II

89. 4/7/13 19 130 Net 52 F III

90. 4/7/13 18.5 120 Net 52 F IV

91. 4/7/13 18.3 120 Net 50 M IV

92. 4/7/13 18 130 Net 50 F III

93. 4/7/13 17 120 Net 46 F III

94. 4/7/13 18.2 120 Net 48 F III

95. 4/7/13 18.5 110 Net 50 F IV

96. 4/7/13 18 120 Net 50 M III

97. 4/7/13 18.3 120 Net 50 M III

98. 4/7/13 19 140 Net 52 F IV

99. 4/7/13 18.1 120 Net 48 M IV

100. 4/7/13 18 120 Net 48 F IV

Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers

15

Country : Myanmar Sampling area : Rakhine

Species : Rastrelliger kanagurta Total number of samples : 100

Technical Officer In Charge : U Soe Win (Deputy Fisheries Officer, DOF Myein distric)

Agency : Department of Fisheries

E-mail address : [email protected] Contact no. : -

Vial no.

Date of sampling

Standard length (mm/cm)

Body weight (g)

Type of gear Gill raker count*

Sex (M/F)

Gonad stage ( I to V)

1. 3/22/13 16 70.9 One drift net 45(over) M NIL

2. 3/22/13 15.7 67.4 One drift net 45(over) M NIL

3. 3/22/13 14.9 52.6 One drift net 45(over) M NIL

4. 3/22/13 14.8 52.1 One drift net 45(over) M NIL

5. 3/22/13 16.1 72.1 One drift net 45(over) M NIL

6. 3/22/13 15.7 65.7 One drift net 45(over) M NIL

7. 3/22/13 14.7 51.2 One drift net 45(over) M NIL

8. 3/22/13 14.6 51.1 One drift net 45(over) M NIL

9. 3/22/13 15.2 64.3 One drift net 45(over) M NIL

10. 3/22/13 15.8 67.6 One drift net 45(over) M NIL

11. 3/22/13 14.8 52 One drift net 45(over) M NIL

12. 3/22/13 14.2 51.5 One drift net 45(over) M NIL

13. 3/22/13 15.6 64.4 One drift net 45(over) M NIL

14. 3/22/13 14.2 52.2 One drift net 45(over) M NIL

15. 3/22/13 14.6 52.8 One drift net 45(over) M NIL

16. 3/22/13 14.5 52.8 One drift net 45(over) M NIL

17. 3/22/13 14.5 52.2 One drift net 45(over) M NIL

18. 3/22/13 14.6 52.5 One drift net 45(over) M NIL

19. 3/22/13 14 46.5 One drift net 45(over) M NIL

20. 3/22/13 14 46.9 One drift net 45(over) M NIL

21. 3/23/13 15.7 71.7

Two small purse seine 45(over) M NIL

22. 3/23/13 15.6 71.7

Two small purse seine 45(over) M NIL

23. 3/23/13 15.5 71.7

Two small purse seine 45(over) M NIL

24. 3/23/13 15.7 71.8

Two small purse seine 45(over) M NIL

25. 3/23/13 15.5 71.9

Two small purse seine 45(over) M NIL

26. 3/23/13 15.6 71.8

Two small purse seine 45(over) M NIL

27. 3/23/13 15.7 71.8

Two small purse seine 45(over) M NIL

Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers

16

28. 3/23/13 15.7 71.8

Two small purse seine 45(over) M NIL

29. 3/23/13 15.7 71.8

Two small purse seine 45(over) M NIL

30. 3/23/13 15.5 71.9

Two small purse seine 45(over) M NIL

31. 3/23/13 15.9 71.9

Two small purse seine 45(over) M NIL

32. 3/23/13 15.4 71.5

Two small purse seine 45(over) M NIL

33. 3/23/13 15.7 71.9

Two small purse seine 45(over) M NIL

34. 3/23/13 15.7 71.8

Two small purse seine 45(over) M NIL

35. 3/23/13 14.6 52

Two small purse seine 45(over) M NIL

36. 3/23/13 16.1 72.7

Two small purse seine 45(over) M NIL

37. 3/23/13 15 55.5

Two small purse seine 45(over) M NIL

38. 3/23/13 14 46.5

Two small purse seine 45(over) M NIL

39. 3/23/13 14.4 46

Two small purse seine 45(over) M NIL

40. 3/23/13 14.8 52.7

Two small purse seine 45(over) M NIL

41. 3/23/13 14 43.9

Two small purse seine 45(over) M NIL

42. 3/23/13 14.1 43.1

Two small purse seine 45(over) M NIL

43. 3/23/13 13.9 41.3

Two small purse seine 45(over) M NIL

44. 3/23/13 13.5 40.5

Two small purse seine 45(over) M NIL

45. 3/23/13 13.6 37.7

Two small purse seine 45(over) M NIL

46. 3/23/13 13 34.8

Two small purse seine 45(over) M NIL

47. 3/23/13 14.6 49.8

Two small purse seine 45(over) M NIL

48. 3/23/13 14.1 43.7

Two small purse seine 45(over) M NIL

49. 3/23/13 13.4 38.9

Two small purse seine 45(over) M NIL

50. 3/23/13 14 46.1

Two small purse seine 45(over) M NIL

Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers

17

51. 3/24/13 14 46.9

Two small purse seine 45(over) M NIL

52. 3/24/13 14.7 52.1

Two small purse seine 45(over) M NIL

53. 3/24/13 21 184.9 Surrounding net 35 (over) F III

54. 3/24/13 21.1 183.9 Surrounding net 36 (over) F III

55. 3/24/13 20.6 173 Surrounding net 37 (over) F III

56. 3/24/13 20.6 170 Surrounding net 38 (over) F III

57. 3/24/13 21.6 172.8 Surrounding net 39 (over) F III

58. 3/24/13 21.7 172.7 Surrounding net 40 (over) F III

59. 3/24/13 22.5 184.4 Surrounding net 41 (over) F III

60. 3/24/13 22.5 184.5 Surrounding net 42 (over) F III

61. 3/24/13 21 180.3 Surrounding net 43 (over) F III

62. 3/24/13 21 180.9 Surrounding net 44 (over) F III

63. 3/24/13 21.1 170.3 Surrounding net 45 (over) F III

64. 3/24/13 21 170.3 Surrounding net 46 (over) F III

65. 3/24/13 21 146.3 Surrounding net 47 (over) F III

66. 3/24/13 21.1 147 Surrounding net 48 (over) F III

67. 3/24/13 21.5 184.4 Surrounding net 49 (over) F III

68. 3/24/13 21.4 184.5 Surrounding net 50 (over) F III

69. 3/24/13 19.3 148.3 Surrounding net 51 (over) F III

70. 3/24/13 19.5 148.5 Surrounding net 52 (over) F III

71. 3/25/13 21.6 163.6 Surrounding net 53 (over) F III

72. 3/25/13 21.6 164.5 Surrounding net 54 (over) F III

73. 3/25/13 21 127.1 Surrounding net 55 (over) F III

74. 3/25/13 21.1 127.2 Surrounding net 56 (over) F III

75. 3/25/13 20.9 168.8 Surrounding net 57 (over) F III

76. 3/25/13 20.9 167.8 Surrounding net 58 (over) F III

77. 3/25/13 20.8 141.6 Surrounding net 59 (over) F III

78. 3/25/13 20.9 142 Surrounding net 60 (over) F III

79. 3/25/13 19 134.9 Surrounding net 61 (over) F III

80. 3/25/13 19.1 135 Surrounding net 62 (over) F III

81. 3/25/13 21.5 187.8 Surrounding net 63 (over) F III

82. 3/25/13 21.4 187.7 Surrounding net 64 (over) F III

83. 3/25/13 21.4 183.2 Surrounding net 65 (over) F III

84. 3/25/13 21.4 183.3 Surrounding net 66 (over) F III

85. 3/25/13 21.9 183.5 Surrounding net 67 (over) F III

86. 3/25/13 21.8 183.4 Surrounding net 68 (over) F III

87. 3/25/13 21 130 Surrounding net 69 (over) F III

88. 3/25/13 21.1 127 Surrounding net 70 (over) F III

Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers

18

89. 3/25/13 20.7 174 Surrounding net 71 (over) F III

90. 3/25/13 20.7 175 Surrounding net 72 (over) F III

91. 3/26/13 19.3 148.8 Surrounding net 73 (over) F III

92. 3/26/13 19.4 148.5 Surrounding net 74 (over) F III

93. 3/26/13 20.6 178.8 Surrounding net 75 (over) F III

94. 3/26/13 20.6 178.7 Surrounding net 76 (over) F III

95. 3/26/13 21.1 124.9 Surrounding net 77 (over) F III

96. 3/26/13 21 125 Surrounding net 78 (over) F III

97. 3/26/13 21.9 181.2 Surrounding net 79 (over) F III

98. 3/26/13 21.8 182 Surrounding net 80 (over) F III

99. 3/26/13 21.2 145 Surrounding net 81 (over) F III

100. 3/26/13 21.3 145.9 Surrounding net 82 (over) F III

Country : Myanmar Sampling area : Kawthaung

Species : Rastrelliger kanagurta Total number of samples : 100

Technical Officer In Charge : U Tun Than (Fisheries Officer)

Agency : Department of Fisheries

E-mail address : - Contact no. : -

Vial no.

Date of sampling

Standard length (mm/cm)

Body weight (g)

Type of gear Gill raker count*

Sex (M/F)

gonad Stage ( I to V)

1. 3/23/13 20 179.7 Purse seine 51 F II

2. 3/23/13 20 185.8 Purse seine 49 M II

3. 3/23/13 19.5 179.1 Purse seine 51 F IV

4. 3/23/13 19.8 172.2 Purse seine 56 M III

5. 3/23/13 18.8 157.2 Purse seine 56 M II

6. 3/23/13 18.5 145.3 Purse seine 54 F IV

7. 3/23/13 18.8 146.4 Purse seine 53 M III

8. 3/23/13 18.5 132.5 Purse seine 52 M I

9. 3/23/13 17.5 122 Purse seine 52 M I

10. 3/23/13 17.5 104.6 Purse seine 38 F II

11. 3/23/13 18 122.2 Purse seine 50 M II

12. 3/23/13 17.8 125.7 Purse seine 51 M I

13. 3/23/13 17.5 121.6 Purse seine 51 M I

14. 3/22/13 17.2 106.7 Purse seine 53 M I

15. 3/22/13 20 170 Drift net 53 F II

16. 3/22/13 20 166.6 Drift net 51 F I

17. 3/22/13 19.8 161.3 Drift net 50 F II

18. 3/22/13 19.3 140.4 Drift net 54 F II

19. 3/22/13 19.5 156.5 Drift net 53 F II

Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers

19

20. 3/22/13 18.3 132.8 Drift net 54 F I

21. 3/22/13 21 232.5 Purse seine 51 F IV

22. 3/22/13 20.5 188.9 Purse seine 53 M III

23. 3/22/13 19.4 165.4 Purse seine 53 M III

24. 3/22/13 19.8 187.3 Purse seine 54 M III

25. 3/22/13 19 139.7 Purse seine 50 F I

26. 3/23/13 21.5 251 Purse seine 54 F IV

27. 3/23/13 21.7 239.6 Purse seine 56 F IV

28. 3/23/13 21.2 207.8 Purse seine 52 M IV

29. 3/23/13 20 174.4 Purse seine 52 F IV

30. 3/23/13 19.4 185.2 Purse seine 53 M IV

31. 3/23/13 21.8 218.9 Purse seine 54 F III

32. 3/23/13 21.8 212.7 Purse seine 55 M IV

33. 3/23/13 22 235.2 Purse seine 54 F III

34. 3/23/13 21.5 222.5 Purse seine 53 M III

35. 3/23/13 20.3 188.6 Purse seine 56 M IV

36. 3/23/13 23.3 251.2 Purse seine 56 F III

37. 3/23/13 21.7 227.9 Purse seine 56 F IV

38. 3/23/13 21 195 Purse seine 56 M IV

39. 3/23/13 21.1 204.4 Purse seine 56 M IV

40. 3/23/13 20.6 195.3 Purse seine 54 F III

41. 3/23/13 20.7 180.3 Purse seine 56 M III

42. 3/23/13 21.2 193.1 Purse seine 55 M IV

43. 3/23/13 21.3 203.7 Purse seine 55 F III

44. 3/23/13 19.6 160.5 Purse seine 58 M III

45. 3/23/13 19.5 159.5 Purse seine 55 M III

46. 3/23/13 18.3 139.6 Drift net 56 F I

47. 3/23/13 18.2 130.1 Drift net 53 M I

48. 3/23/13 18.5 137.1 Drift net 55 M III

49. 3/23/13 19.2 155.1 Drift net 52 F I

50. 3/23/13 18.8 136.6 Drift net 56 F I

51. 3/24/13 20.8 187.3 Drift net 57 M III

52. 3/24/13 20.2 171.2 Drift net 51 F III

53. 3/24/13 19.8 150.6 Drift net 56 F II

54. 3/24/13 18.5 124 Drift net 57 M I

55. 3/24/13 17.8 122.1 Drift net 51 F II

56. 3/24/13 19 131.4 Drift net 53 M II

57. 3/24/13 18.3 116.4 Drift net 53 F II

58. 3/24/13 17.5 104 Drift net 53 F III

Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers

20

59. 3/24/13 18 121.2 Drift net 55 F III

60. 3/24/13 16.8 92.7 Drift net 56 F III

61. 3/24/13 18.5 132.8 Drift net 52 M III

62. 3/24/13 18.3 126.1 Drift net 51 F II

63. 3/24/13 18.5 119.9 Drift net 52 F III

64. 3/24/13 18.1 118.4 Drift net 52 M II

65. 3/24/13 18.1 112.4 Drift net 54 M III

66. 3/24/13 19 159 Drift net 52 M III

67. 3/24/13 19.2 142.6 Drift net 54 F III

68. 3/24/13 19 144.9 Drift net 54 M III

69. 3/24/13 18.5 132.6 Drift net 56 M II

70. 3/24/13 17.8 120.7 Drift net 52 M I

71. 3/24/13 19.8 172.7 Drift net 55 F II

72. 3/24/13 18 119.3 Drift net 56 F I

73. 3/24/13 18.2 128.6 Drift net 52 F I

74. 3/24/13 17.5 107.2 Drift net 37 M II

75. 3/24/13 18 123 Drift net 37 M II

76. 3/25/13 20.1 197 Drift net 36 M III

77. 3/25/13 20 176 Drift net 56 F III

78. 3/25/13 19.8 187.2 Drift net 54 F II

79. 3/25/13 19.4 159.3 Drift net 54 F III

80. 3/25/13 19.8 171.1 Drift net 54 F III

81. 3/25/13 19.5 162.4 Drift net 55 F III

82. 3/25/13 20.2 191.1 Drift net 55 M III

83. 3/25/13 21.7 220.1 Drift net 57 M II

84. 3/25/13 20.2 178.2 Drift net 54 M III

85. 3/25/13 18.4 146.8 Drift net 58 F III

86. 3/25/13 19.8 181.5 Drift net 54 F III

87. 3/25/13 20 187.9 Drift net 53 F IV

88. 3/25/13 19.5 169.7 Drift net 53 M III

89. 3/25/13 19.8 176 Drift net 53 M II

90. 3/25/13 19.5 170.4 Drift net 54 M II

91. 3/25/13 18.7 149.4 Drift net 56 F I

92. 3/25/13 18.8 144.4 Drift net 52 F I

93. 3/25/13 19.3 157.2 Drift net 52 M II

94. 3/25/13 18.3 138.1 Drift net 55 F I

95. 3/25/13 19 145.6 Drift net 53 F III

96. 3/25/13 19 152.2 Drift net 53 M II

97. 3/25/13 18.5 142 Drift net 56 M I

Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers

21

98. 3/25/13 19 154.4 Drift net 51 M III

99. 3/25/13 19.2 151.2 Drift net 55 M II

100. 3/25/13 19.5 164.7 Drift net 53 F III

Country : Maldives Sampling area : Male ‘

Species : Rastrelliger kanagurta Total number of samples : 68

Technical Officer In Charge : Mohamed Ahusan

Agency : Marine Research Centre, Maldives

E-mail address : [email protected]

[email protected]

Contact no. : +960 3322242

Vial no.

Date of sampling

Standard length (mm/cm)

Body weight (g)

Type of gear

Gill raker count*

Sex (M/F)

Gonad stage ( I to V)

1. 2/10/13 18.5 112.99 44

2. 2/10/13 25.5 316.97 44

3. 2/13/13 19.8 146.13 43

4. 2/13/13 18.5 112.06 48

5. 2/13/13 18.5 112.4 43

6. 2/13/13 19.8 135.3 45

7. 3/13/13 25.5 303.36

8. 3/13/13 25.0 288.1

9. 3/13/13 24.3 271.55

10. 3/13/13 25.5 324.17

11. 3/13/13 25.5 301.85

12. 3/13/13 25.3 299.64

13. 3/13/13 24.5 287.78

14. 3/13/13 N/A

15. 3/13/13 N/A

16. 3/13/13 N/A

17. 3/13/13 N/A

18. 3/13/13 N/A

19. 9/1/13 20.5 187.25

20. 9/1/13 21.0 215.24

21. 9/1/13 20.5 185.3

22. 9/1/13 21.9 243.18

23. 9/1/13 21.2 215

24. 9/1/13 21.0 202

Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers

22

25. 9/27/13 N/A

26. 9/27/13 N/A

27. 9/27/13 N/A

28. 9/27/13 N/A

29. 9/27/13 N/A

30. 9/27/13 N/A

31. 9/27/13 N/A

32. 9/27/13 N/A

33. 9/27/13 N/A

34. 9/27/13 N/A

35. 9/27/13 N/A

36. 9/27/13 N/A

37. 9/27/13 N/A

38. 9/27/13 N/A

39. 9/27/13 N/A

40. 9/27/13 N/A

41. 9/27/13 N/A

42. 9/27/13 N/A

43. 9/27/13 N/A

44.. 9/27/13 N/A

45. 9/30/13 N/A

46. 9/30/13 N/A

47. 9/30/13 N/A

48. 9/30/13 N/A

49. 9/30/13 N/A

50. 9/30/13 N/A

51. 9/30/13 N/A

52. 9/30/13 N/A

53. 9/30/13 N/A

54. 9/30/13 N/A

55. 9/30/13 N/A

56. 9/30/13 N/A

57. 9/30/13 N/A

58. 9/30/13 N/A

59. 9/30/13 N/A

60. 9/30/13 N/A

61. 9/30/13 N/A

62. 9/30/13 N/A

63. - -

Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers

23

64. 9/30/13 N/A

65. 9/30/13 N/A

66. 9/30/13 N/A

67. 9/30/13 N/A

68. 9/30/13 N/A

69. - -

70. 9/30/13 N/A

71.

72.

73.

74.

75.

76.

77.

78.

79.

80.

81.

82.

83.

84.

85.

86.

87.

88.

89.

90.

91.

92.

93.

94.

95.

96.

97.

98.

99.

100.

Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers

24

Appendix II List of fourteen primers identified at NBFGR with optimal annealing conditions which can be used for genetic analysis of R. kanagurta

SI no

Locus Primer sequences 5’ 3’ Repeat motif

Ta (°C) Product size

No. of alleles*

1 Raka1 F: GCTTGACTGTGTTGGAAAGAGC AAAG 58 164-292 10

R: AAAGACAGGAGCACGGAAGC

2 Raka2 F:TCATTGACTTTATTTCTGGCACG AATAG 58 192-332 9

R:AAAGCCCTGATGTCAAGATGG

3 Raka10 F: GAATATCTGGTAATGAGAACTAAATGAGC TGCG 64 292-344 7

R: CAAGCAAATACTATACTACAATGACTGG

4 Raka12 F: TGGCTTCTGTAGTGTCAATTTGC ATCT 64 284-380 10

R:CATTCAGCTTGGTAAATGCCG

5 Raka26 F:CTACATGTCCAGCTGCAGGG ATT 62 183-198 10

R:GCAGATGATAACTCAATATGTGTTGG

6 Raka46 F:GAGGATATGCAGTGTCAGGAGG ATT 60 228-243 9

R: TTTATGTATCCATTATGGTCCAGG

7 Raka48 F:TCTTAATCTGCGCTAGTGGGC AATC 58 180-224 10

R:TTTGGCAATGAAACTATGAAGTCC

8 KSJ18 F: GCTGGTCATTTGTATCTTTGA (GT)17 55 206-240 10

R: TGGCTGCCTTTTGAATAA

9 KSJ26 F: GGAGCATTTGACAACACTTAC (GT)13

AT(GT3

58 216-246 9

R: AGTCAGTTTTGGTGGATGAG

10 SA2068 F: CAAGACATGACAGAGTAGGACATTGAC (GGA)9 56 147-177 9

R: AGATTGGGAGTTTGTAGGGGTAATA

11 SA2657 F: TGTCAGAGATGTAGCACATACGG (CA)19 56 240-324 14

R: AGCATTATCTGGTGCTGTAAGGA

12 SA2770 F: AGAAATGAAAAGGGCTTTAAGGA (CA)22

56 240-324 15

R: ACTGAGCTGCTTAAAATGCAAAA

13 SCA8 F: TCAGCTGTTCATTCCCATAGCCCA (CA)21

59 140-174 13

R: ATGAAGGAACAATGAGCCTCCAGC

14 SCA30 F: TGGCTGTCGGTCACTCTGCCTC (GA

/CA)23

59 114-130 7

R: ACACACACGGGTACACACAGGG

*Fifteen individuals were used for primer screening

Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers

26

Appendix III Number of R. kanagurta genotyped by loci and sample site.

Sampling area

Primers Number of samples done

(Number of complete samples)

RAKA1 RAKA2 RAKA10 RAKA12 RAKA26 RAKA46 RAKA48 KSJ

18

KSJ

26

SA

2068

SA

2657

SA

2770

SCA8 SCA30

Kuantan 100 100 91 80 82 100 100 100 94 100 96 100 100 100 1343

Kudat 100 96 83 92 85 100 100 100 97 100 96 100 100 100 1349

Yangon (Rakhine) 100 92 98 98 89 100 81 100 100 100 96 100 100 100 1354

Kawthaung (Tanintharyi)

100 98 91 90 97 100 88 100 100 100 100 100 99 100 1363

Male’ 68 63 54 49 57 68 68 68 66 68 67 67 68 68 899

Total 468 449 417 409 410 468 437 468 457 468 455 467 467 468 6308

Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers

27

Appendix IV Genotype data for R. kanagurta samples collected from South China Sea, Maldives and Myanmar.

Annex4.xls