boblme-2015-ecology-28 · boblme-2015-ecology-28 . ii ... indian mackerel for which the...
TRANSCRIPT
ii
The designations employed and the presentation of material in this publication do not imply the expression of any opinion whatsoever on the part of Food and Agriculture Organization of the United Nations concerning the legal and development status of any country, territory, city or area or of its authorities, or concerning the delimitation of its frontiers or boundaries. The BOBLME Project encourages the use of this report for study, research, news reporting, criticism or review. Selected passages, tables or diagrams may be reproduced for such purposes provided acknowledgment of the source is included. Major extracts or the entire document may not be reproduced by any process without the written permission of the BOBLME Project Regional Coordinator. BOBLME contract: LOA/RAP/2012/35 For bibliographic purposes, please reference this publication as:
BOBLME (2015) Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers, BOBLME-2015-Ecology-28
Terminal report
Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers
Prepared by
Marine Fishery Resources Development and Management Department
Southeast Asian Fisheries Development Centre
2015
Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers
iv
Executive summary
Belonging to the family Scombridae of order Perciformes, the Indian mackerel (Rastrelliger kanagurta) is an important food fish and is commonly used in South and Southeast Asian cuisine. This mackerel species is commonly found in warm shallow waters along the coasts of the Indian and West Pacific oceans, and their surrounding seas. However, the population structure of the Indian mackerel is largely unknown in the entire BOBLME region.
In order to address the need to know the population structure of this species in the region, and to support improved regional resource conservation and management, the BOBLME Project work plan for 2012 was developed and the Project Steering Committee (PSC) adopted this initiative in March 2012. This project was the outcome from the Indian mackerel working group formed in 2011. The project was undertaken to develop the first ever region wide stock discrimination analysis for Indian mackerel, and at the same time contributing to the refinement of national assessments. This project was related to SEAFDEC/MFRDMD’s programme of work in support of the activities concerning Indian mackerel for which the SEAFDEC/MFRDMD has the regional responsibility. A Letter of Agreement to that effect was signed between the Marine Fishery Resources Development and Management Department, Southeast Asian Fisheries Development Centre (SEAFDEC/MFRDMD) and FAO-BOBLME granting support of RM 181 330.00.
Through the first genetic working group meeting in Colombo, Sri Lanka from 28 to 29 May 2012, SEAFDEC/MFRDMD was appointed to sample 100 fishes each of Indian mackerel for genetic work from two locations namely Kuantan (KT) and Kudat (KD), Malaysia, as outgroups (South China Sea). One location each from Male’ Maldives (MA) and two locations from Myanmar with Yangon representative for Rakhine (RK) and Kawthung representative for Myeik (MY) were also chosen for sampling locations. The aim of this meeting was to establish a sound genetic sampling scheme, and analysis outline for assessing the stock structure of Indian mackerel in the Bay of Bengal region. All the samples were taken back to the biotechnology laboratory in SEAFDEC/MFRDMD for further analysis and PCR products have been genotyped by SciGenom facility in Kochi, India for fragment analysis.
The Indian mackerel genetics harmonisation training workshop was also held on 20 to 27 August 2013 at the genetics lab in the National Bureau of Fish Genetic Resources (NBFGR) Regional Research Station, Kochi, located at the campus of the Central Marine Fisheries Research Institute(CMFRI). This training workshop allowed regional genetic laboratories to use a standard set of genetic markers to analyse local R. kanagurta samples.
Through this project it is hoped that knowledge can be improved and understanding the population structure will facilitate better assessment of the stocks and ultimately improved better management of the fisheries of Indian mackerel in the region.
Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers
v
Table of contents
1. Background .................................................................................................................................. 1
2. Objectives .................................................................................................................................... 1
3. Implementation of project .......................................................................................................... 1
3.1. Tissue sample collection ....................................................................................................... 1
3.2. Laboratory analysis ............................................................................................................... 1
4. Outcomes .................................................................................................................................... 2
5. Conclusion ................................................................................................................................... 2
6. Recommendations ....................................................................................................................... 2
Appendix I Biological sampling information for collections R. kanagurta used for DNA analysis by country. ....................................................................................................................... 3
Appendix II List of fourteen primers identified at NBFGR with optimal annealing conditions which can be used for genetic analysis of R. kanagurta ................................................ 24
Appendix III Number of R. kanagurta genotyped by loci and sample site. ....................................... 26
Appendix IV Genotype data for R. kanagurta samples collected from South China Sea, Maldives and Myanmar. ................................................................................................................ 27
Acronyms used
BOBLME Bay of Bengal Large Marine Ecosystem Project
CMFRI Central Marine Fisheries Research Institute
DNA Deoxyribonucleic acid
DOF Department of Fisheries
FAO Food and Agriculture Organisation
MFRDMD Marine Fishery Resources Development and Management Department
NBFGR National Bureau of Fish Genetic Resources
PCR Polymerase Chain Reaction
PSC Project Steering Committee
RM Malaysian Ringgit
SCS South China Sea
SEAFDEC Southeast Asian Fisheries Development Centre
SOP Standard Operating Procedure
Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers
1
1. Background
The Indian mackerel working group meeting held in Colombo, Sri Lanka from 28 to 29 May 2012, came out with a sampling plan for implementation of the genetic stock structure study on Indian mackerel in the Bay of Bengal region and established standardized procedures for marker use, identification and analysis. A Letter of Agreement to that effect was signed between the Marine Fishery Resources Development and Management Department, Southeast Asian Fisheries Development Centre (SEAFDEC/MFRDMD) and BOBLME-FAO granting support of RM 104 530 for conducting a one-year activity from September 2012 to September 2013. However, the project had been extended to February 2015 with additional financial contribution RM 76 800.00 to make it a total of RM 181 330.00. According to the agreement SEAFDEC/MFRDMD was appointed to carry out sampling programme for genetic test of specimens of Indian mackerel in the South China Sea (SCS), Myanmar, Bangladesh and Maldives, and undertake the genetic testing by using microsatellite method and report on the results.
In order to address the need to harmonize the genetic data among the BOBLME region, a regional training and standardisation workshop, the Indian mackerel genetics harmonisation training workshop was held from 20 to 27 August 2013 at the genetics lab in the National Bureau of Fish Genetic Resources (NBFGR) Regional Research Station, Kochi, Kerala, India, located at the campus of Central Marine Fisheries Research Institute. During this training a standardized protocol on laboratory analysis of genetic stock identification of Indian mackerel across the BOBLME region using microsatellite markers was produced.
2. Objectives
Objectives of this project were:
To improve understanding of the population structure of Indian mackerel in the South China Sea outside the BOBLME basin but part of the distribution range of the species. The number of fish specimens tested and the results with regard to relatedness in stocks at different locations during different times will be indicators of performance.
To assist BOBLME member countries (Myanmar, Bangladesh and Maldives) to improve understanding of the population structure of Indian mackerel in the BOBLME basin.
3. Implementation of project
3.1. Tissue sample collection
A total number of 668 samples were collected from South China Sea (Kuantan and Kudat), Bangladesh (Chittagong and Cox’ Bazaar), Myanmar (Yangon (Rakhine) and Kawthung (Myeik)) and Maldives (Male’) according to Standard Operating Procedure (SOP) of Tissue sample collection provided by BOBLME. Sampling activity in Kudat (100 samples) was conducted from 7 to 11 January 2013 and Kuantan (100 samples) from 11 to 13 March 2013. Samples from Bangladesh (200 samples), Myanmar (200 samples) and Maldives (68 samples) were couriered to SEAFDEC/MFRDMD. The samples were labelled according to; Kuantan (KT), Kudat (KD), Rakhine (RK), Myeik (MY), Male’ (MA) and Control Sample (C). The list of samples collected for each sampling sites is in Appendix I
3.2. Laboratory analysis
A total of 14 primers were used for this project as listed in Appendix II The DNA from fin clip tissue was extracted from August 2013 and the PCR products were sent to India for genotyping started
Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers
2
from June 2014. An overall 6 308 (96%) PCR products (468 samples x 14 loci) have been genotyped by SciGenom in Cochin, India for fragment analysis as in Appendix III. The genotyping results are shown in Appendix IV.
A total of 200 samples from Bangladesh were transferred to NBFGR, Cochin India for laboratory analysis due to technical problem. The samples were sent out to India on June 2014.
The regional data analysis will be done by NBFGR, CMFRI and BOBLME genetic consultants as had been agreed during the BOBLME Genetics working group meeting in Phuket on 17 and 18 February 2015.
4. Outcomes
a. Improved understanding of the population structure of Indian mackerel in the South China Sea outside the BOBLME basin but part of the distribution range of the species
b. Improved understanding of the population structure of Indian mackerel in the BOBLME basin (Myanmar, Bangladesh and Maldives)
5. Conclusion
SEAFDEC/MFRDMD has successfully collected all the specimens needed from the South China Sea, Myanmar and Maldives as specified in the Letter of Agreement. Altogether, 468 specimens were analysed with 14 microsatellite loci and 6308 genotype (96%) were successfully gathered. The regional analysis of this species can lead to proper stock assessment of Indian mackerel in the BOBLME region. This project also has been a good example of countries working together for trans-boundary management of fishery resources.
6. Recommendations
Determination of genetic stock structure of Bay of Bengal Indian mackerel will need additional work to evaluate the genotypic data collected by different genetic laboratories in the region. There are still data quality issues, missing data, and species identification which need to be addressed in the next phase of work.
With the continuation of the project and alternative funding resources could open more opportunities to do more work on genetic study with other species such as tuna and grouper.
Further develop inter-laboratory cooperation to facilitate capacity building among laboratories by shared common projects.
The results obtained can appraise the managers on the importance of the work in determining the population structure of the pelagic resources.
Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers
3
Appendix I Biological sampling information for collections R. kanagurta used for DNA analysis by country.
Country : Malaysia Sampling area : Kuantan
Species : Rastrelliger kanagurta Total number of samples : 100
Technical Officer In Charge : Noorul Azliana binti Jamaludin
Agency: SEAFDEC/MFRDMD
E-mail address : [email protected] Contact no. : +6096175940
Vial no.
Date of sampling
Standard length (mm/cm)
Body weight (g)
Type of gear Sex (M/F)
Gonad weight (g)
Gonad stage ( I to V)
1. 3/12/13 18.9 144.2 Purse seine M 4.3 III
2. 3/12/13 19.3 167.1 Purse seine F 10.4 IV
3. 3/12/13 19.4 160.6 Purse seine M 9.1 IV
4. 3/12/13 19.1 142.9 Purse seine M 4.7 III
5. 3/12/13 19.4 165.8 Purse seine M 4.2 III
6. 3/12/13 19.2 150.1 Purse seine F 6.8 IV
7. 3/12/13 18.7 142.2 Purse seine M 7.4 IV
8. 3/12/13 18.5 136.6 Purse seine M 4.7 III
9. 3/12/13 18.6 148.1 Purse seine F 10.8 IV
10. 3/12/13 17.6 120.2 Purse seine M 4.5 IV
11. 3/12/13 18.1 130.5 Purse seine M 4.6 III
12. 3/12/13 19.1 157.7 Purse seine F 10.5 IV
13. 3/12/13 18.3 140.6 Purse seine M 2.8 III
14. 3/12/13 18.0 135.9 Purse seine M 6.3 IV
15. 3/12/13 19.7 172.8 Purse seine M 8.0 IV
16. 3/12/13 17.4 132.3 Purse seine M 4.7 III
17. 3/12/13 18.1 135.4 Purse seine M 5.7 IV
18. 3/12/13 17.8 124.5 Purse seine M 5.8 IV
19. 3/12/13 18.4 131.7 Purse seine M 6.4 IV
20. 3/12/13 18.3 142.0 Purse seine F 12.1 IV
21. 3/12/13 17.1 117.2 Purse seine M 2.7 III
22. 3/12/13 17.8 117.1 Purse seine M 2.7 III
23. 3/12/13 18.3 134.0 Purse seine M 3.7 III
24. 3/12/13 18.6 146.5 Purse seine F 13.6 IV
25. 3/12/13 19.1 146.0 Purse seine F 6.7 III
26. 3/12/13 18.7 156.5 Purse seine F 8.5 IV
27. 3/12/13 18.7 156.3 Purse seine M 5.8 IV
28. 3/12/13 18.2 126.2 Purse seine M 4.5 III
29. 3/12/13 18.9 152.8 Purse seine F 13.2 IV
30. 3/12/13 18.4 137.5 Purse seine M 6.5 IV
Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers
4
31. 3/12/13 18.7 143.6 Purse seine F 3.0 III
32. 3/12/13 18.7 133.1 Purse seine M 2.2 III
33. 3/12/13 18.7 152.3 Purse seine F 10.2 IV
34. 3/12/13 18.4 131.3 Purse seine F 4.2 III
35. 3/12/13 19.0 143.2 Purse seine F 9.5 IV
36. 3/12/13 17.6 129.0 Purse seine M 5.2 III
37. 3/12/13 17.8 129.4 Purse seine M 8.0 IV
38. 3/12/13 18.4 148.7 Purse seine F 6.1 IV
39. 3/12/13 18.1 119.6 Purse seine M 1.6 III
40. 3/12/13 18.6 133.9 Purse seine M 2.0 III
41. 3/12/13 18.2 133.1 Purse seine M 1.6 III
42. 3/12/13 17.3 114.1 Purse seine M 5.6 IV
43. 3/12/13 18.0 125.8 Purse seine M 2.8 III
44. 3/12/13 18.5 142.9 Purse seine F 10.9 IV
45. 3/12/13 18.1 140.9 Purse seine M 8.6 IV
46. 3/12/13 17.6 116.6 Purse seine M 2.2 III
47. 3/12/13 17.6 115.7 Purse seine F 5.4 IV
48. 3/12/13 18.1 130.1 Purse seine F 2.2 III
49. 3/12/13 19.1 153.3 Purse seine M 4.6 IV
50. 3/12/13 17.7 128.7 Purse seine M 6.4 III
51. 3/12/13 20.0 178.1 Purse seine F 11.6 IV
52. 3/12/13 18.6 140.9 Purse seine M 2.6 IV
53. 3/12/13 17.9 124.9 Purse seine M 6.9 III
54. 3/12/13 18.0 129.3 Purse seine F 6.2 IV
55. 3/12/13 20.0 181.3 Purse seine M 4.9 III
56. 3/12/13 18.8 140.5 Purse seine M 2.7 IV
57. 3/12/13 18.7 160.3 Purse seine F 12.7 IV
58. 3/12/13 19.1 151.2 Purse seine F 5.0 III
59. 3/12/13 17.4 119.3 Purse seine M 5.3 IV
60. 3/12/13 17.4 122.5 Purse seine F 8.5 IV
61. 3/12/13 17.6 125.6 Purse seine M 6.3 IV
62. 3/12/13 18.4 143.0 Purse seine M 5.2 IV
63. 3/12/13 18.8 154.4 Purse seine M 2.8 III
64. 3/12/13 18.0 125.8 Purse seine M 4.1 IV
65. 3/12/13 18.3 123.1 Purse seine M 1.2 III
66. 3/12/13 18.1 118.2 Purse seine F 3.5 III
67. 3/12/13 19.0 153.8 Purse seine M 5.9 IV
68. 3/12/13 17.8 132.4 Purse seine M 4.2 IV
69. 3/12/13 17.7 123.5 Purse seine F 5.6 IV
Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers
5
70. 3/12/13 18.2 131.4 Purse seine F 7.2 IV
71. 3/12/13 19.7 147.9 Purse seine M 6.7 IV
72. 3/12/13 18.8 144.4 Purse seine F 0.2 III
73. 3/12/13 17.2 117.8 Purse seine M 4.6 IV
74. 3/12/13 18.1 133.3 Purse seine M 6.2 IV
75. 3/12/13 19.0 152.6 Purse seine F 5.2 III
76. 3/12/13 18.4 138.3 Purse seine M 5.6 IV
77. 3/12/13 18.1 141.1 Purse seine M 9.0 IV
78. 3/12/13 13.6 128.6 Purse seine M 5.9 IV
79. 3/12/13 18.7 149.5 Purse seine F 5.2 IV
80. 3/12/13 17.5 134.0 Purse seine M 4.9 IV
81. 3/12/13 18.3 134.7 Purse seine M 4.8 III
82. 3/12/13 18.1 127.8 Purse seine M 4.5 III
83. 3/12/13 17.9 129.7 Purse seine M 1.4 III
84. 3/12/13 13.4 121.8 Purse seine F 4.8 IV
85. 3/12/13 17.8 116.4 Purse seine F 2.2 III
86. 3/12/13 18.2 121.0 Purse seine F 4.1 IV
87. 3/12/13 18.2 153.5 Purse seine M 5.8 IV
88. 3/12/13 19.2 165.5 Purse seine F 7.3 IV
89. 3/12/13 18.2 143.5 Purse seine M 4.4 IV
90. 3/12/13 18.4 137.8 Purse seine M 6.0 IV
91. 3/12/13 18.8 152.3 Purse seine F 4.6 III
92. 3/12/13 17.8 127.2 Purse seine M 5.9 IV
93. 3/12/13 17.3 114.8 Purse seine M 4.5 III
94. 3/12/13 17.7 126.8 Purse seine M 3.6 III
95. 3/12/13 17.8 130.4 Purse seine M 7.2 IV
96. 3/12/13 17.4 120.7 Purse seine F 4.7 IV
97. 3/12/13 17.5 117.4 Purse seine M 3.4 III
98. 3/12/13 17.3 121.8 Purse seine F 6.5 IV
99. 3/12/13 19.1 158.8 Purse seine F 6.3 IV
100. 3/12/13 18.2 129.6 Purse seine M 3.8 IV
Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers
6
Country : Malaysia Sampling area : Kudat
Species : Rastrelliger kanagurta Total number of samples : 100
Technical Officer In Charge : Noorul Azliana binti Jamaludin
Agency : SEAFDEC/MFRDMD
E-mail address : [email protected] Contact no. : +6096175940
Vial no.
Date of sampling
Standard length (mm/cm)
Body weight (g)
Type of gear Sex (M/F)
Gonad weight (g)
Gonad stage ( I to V)
1. 1/8/12 190.0 120.3 Purse seine F 2.9 III
2. 1/8/12 190.0 133.1 Purse seine F 3.5 III
3. 1/8/12 195.0 159.2 Purse seine M 8.2 III
4. 1/8/12 204.0 166.3 Purse seine M 4.0 III
5. 1/8/12 194.0 126.0 Purse seine F 2.4 IV
6. 1/8/12 202.0 149.2 Purse seine F 3.7 III
7. 1/8/12 179.0 101.4 Purse seine M 2.5 III
8. 1/8/12 204.0 176.9 Purse seine F 6.0 IV
9. 1/8/12 203.0 167.1 Purse seine M 6.1 V
10. 1/8/12 195.0 163.1 Purse seine M 7.6 III
11. 1/8/12 209.0 179.6 Purse seine F 4.8 III
12. 1/8/12 194.0 154.6 Purse seine M 3.9 IV
13. 1/8/12 198.0 145.3 Purse seine M 6.7 III
14. 1/8/12 202.0 171.5 Purse seine M 5.8 III
15. 1/8/12 203.0 174.1 Purse seine M 6.8 III
16. 1/8/12 198.0 162.5 Purse seine F 5.1 IV
17. 1/8/12 180.0 121.9 Purse seine M 3.9 III
18. 1/8/12 205.0 163.9 Purse seine F 2.6 IV
19. 1/8/12 183.0 115.4 Purse seine M 2.4 IV
20. 1/8/12 192.0 151.6 Purse seine M 4.5 III
21. 1/8/12 191.0 131.3 Purse seine M 2.1 IV
22. 1/8/12 192.0 146.3 Purse seine F 7.1 III
23. 1/8/12 197.0 162.0 Purse seine F 5.8 III
24. 1/8/12 183.0 114.4 Purse seine M 2.2 IV
25. 1/8/12 189.0 139.8 Purse seine M 9.7 III
26. 1/8/12 203.0 179.3 Purse seine M 2.4 IV
27. 1/8/12 196.0 146.8 Purse seine F 4.2 III
28. 1/8/12 203.0 165.9 Purse seine F 3.9 III
29. 1/8/12 187.0 122.2 Purse seine M 3.3 III
30. 1/8/12 197.0 166.1 Purse seine F 4.7 III
31. 1/8/12 203.0 196.1 Purse seine F 7.8 III
32. 1/8/12 181.0 122.6 Purse seine F 2.0 IV
Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers
7
33. 1/8/12 197.0 144.2 Purse seine F 4.3 III
34. 1/8/12 183.0 188.4 Purse seine M 1.9 II
35. 1/8/12 202.0 164.3 Purse seine M 2.7 III
36. 1/8/12 190.0 135.1 Purse seine M 2.6 III
37. 1/8/12 191.0 122.0 Purse seine F 3.3 III
38. 1/8/12 194.0 155.2 Purse seine F 5.1 III
39. 1/8/12 192.0 148.8 Purse seine M 3.6 III
40. 1/8/12 180.0 106.6 Purse seine F 1.7 III
41. 1/8/12 189.0 121.8 Purse seine F 3.4 III
42. 1/8/12 176.0 105.1 Purse seine F 1.6 III
43. 1/8/12 194.0 148.4 Purse seine F 4.0 III
44. 1/8/12 201.0 160.6 Purse seine F 2.1 IV
45. 1/8/12 200.0 165.5 Purse seine M 6.8 III
46. 1/8/12 193.0 144.3 Purse seine M 2.7 III
47. 1/8/12 203.0 172.2 Purse seine F 3.2 III
48. 1/8/12 186.0 126.8 Purse seine M 2.4 III
49. 1/8/12 178.0 115.0 Purse seine M 3.5 III
50. 1/8/12 181.0 102.3 Purse seine M 1.9 IV
51. 1/8/12 196.0 156.9 Purse seine M 4.9 III
52. 1/8/12 191.0 141.0 Purse seine M 4.8 III
53. 1/8/12 191.0 147.8 Purse seine M 6.0 III
54. 1/8/12 176.0 110.0 Purse seine M 1.6 III
55. 1/8/12 182.0 119.3 Purse seine F 2.8 III
56. 1/8/12 176.0 108.0 Purse seine F 0.4 V
57. 1/8/12 203.0 160.9 Purse seine M 2.7 II
58. 1/8/12 188.0 134.6 Purse seine M 5.2 III
59. 1/8/12 193.0 153.2 Purse seine F 4.3 III
60. 1/8/12 198.0 164.1 Purse seine M 7.8 III
61. 1/8/12 192.0 146.0 Purse seine M 4.5 III
62. 1/8/12 198.0 169.9 Purse seine F 3.6 III
63. 1/8/12 193.0 158.4 Purse seine M 8.2 III
64. 1/8/12 195.0 154.1 Purse seine F 7.9 III
65. 1/8/12 211.0 203.2 Purse seine M 8.1 IV
66. 1/8/12 188.0 129.5 Purse seine F 2.7 III
67. 1/8/12 194.0 127.9 Purse seine F 3.9 III
68. 1/8/12 194.0 149.8 Purse seine F 2.9 III
69. 1/8/12 215.0 215.2 Purse seine M 6.6 III
70. 1/8/12 192.0 147.5 Purse seine M 5.6 III
71. 1/8/12 206.0 188.0 Purse seine M 7.9 III
Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers
8
72. 1/8/12 188.0 123.5 Purse seine F 2.5 IV
73. 1/8/12 193.0 142.9 Purse seine F 2.7 IV
74. 1/8/12 196.0 164.1 Purse seine F 6.2 III
75. 1/8/12 214.0 201.3 Purse seine M 10.2 III
76. 1/8/12 196.0 148.3 Purse seine M 5.4 IV
77. 1/8/12 197.0 157.2 Purse seine F 3.5 III
78. 1/8/12 179.0 116.1 Purse seine F 2.9 IV
79. 1/8/12 203.0 173.2 Purse seine F 3.9 IV
80. 1/8/12 184.0 130.7 Purse seine F 4.2 IV
81. 1/8/12 204.0 177.9 Purse seine F 3.3 III
82. 1/8/12 199.0 152.3 Purse seine M 4.6 III
83. 1/8/12 190.0 117.9 Purse seine F 1.9 IV
84. 1/8/12 184.0 129.3 Purse seine F 0.8 V
85. 1/8/12 182.0 135.5 Purse seine M 1.9 II
86. 1/8/12 173.0 106.0 Purse seine M 3.2 III
87. 1/8/12 192.0 136.5 Purse seine M 9.1 III
88. 1/8/12 205.0 170.9 Purse seine M 2.1 II
89. 1/8/12 188.0 121.8 Purse seine F 4.6 III
90. 1/8/12 197.0 147.1 Purse seine F 3.3 III
91. 1/8/12 191.0 150.4 Purse seine M 8.6 III
92. 1/8/12 186.0 162.2 Purse seine M 2.2 III
93. 1/8/12 186.0 130.4 Purse seine M 2.5 IV
94. 1/8/12 176.0 108.7 Purse seine M 2.0 IV
95. 1/8/12 177.0 102.1 Purse seine M 2.9 IV
96. 1/8/12 190.0 104.9 Purse seine M 2.5 IV
97. 1/8/12 184.0 122.5 Purse seine M 7.5 III
98. 1/8/12 200.0 165.9 Purse seine M 3.5 III
99. 1/8/12 194.0 154.9 Purse seine M 3.8 II
100. 1/8/12 192.0 143.0 Purse seine M 4.0 II
Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers
9
Country : Bangladesh Sampling area : Cox'n Baryan
Species : Rastrelliger kanagurta Total number of samples : 100
Technical Officer In Charge :
Agency : Bangladesh Fisheries Research Institute
E-mail address : Contact no. :
Vial no.
Date of sampling
Standard length (mm/cm)
Body weight (g)
Type of gear
Gill raker count*
Sex (M/F)
Gonad stage ( I to V)
1. 4/18/13 18.9 150 Net 52 M V
2. 4/18/13 19.5 150 Net 52 F V
3. 4/18/13 18.5 150 Net 50 F V
4. 4/18/13 18.5 140 Net 50 F V
5. 4/18/13 18.5 145 Net 50 F II
6. 4/18/13 18.5 145 Net 50 M V
7. 4/18/13 19 150 Net 52 F V
8. 4/18/13 18.5 150 Net 50 F V
9. 4/18/13 18.5 150 Net 52 M V
10. 4/18/13 18.5 150 Net 52 F V
11. 4/18/13 18 150 Net 50 F III
12. 4/18/13 18 150 Net 50 M V
13. 4/18/13 18.5 155 Net 50 M V
14. 4/18/13 18.5 152 Net 52 M V
15. 4/18/13 18.5 148 Net 52 M V
16. 4/18/13 18.5 150 Net 50 M V
17. 4/18/13 19 153 Net 52 M IV
18. 4/18/13 19 152 Net 52 F V
19. 4/18/13 19 153 Net 52 M II
20. 4/18/13 18.5 145 Net 50 F V
21. 4/18/13 18.5 150 Net 50 M V
22. 4/18/13 18.5 150 Net 50 M V
23. 4/18/13 18 150 Net 48 F V
24. 4/18/13 19 153 Net 52 M V
25. 4/18/13 18.5 150 Net 50 M V
26. 4/18/13 18 145 Net 52 M II
27. 4/18/13 18 120 Net 52 M V
28. 4/18/13 18.5 150 Net 52 M II
29. 4/18/13 18.5 145 Net 52 M V
30. 4/18/13 18 150 Net 50 F V
31. 4/18/13 18.5 150 Net 52 F V
32. 4/18/13 18 145 Net 50 M V
Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers
10
33. 4/18/13 18 145 Net 50 F V
34. 4/18/13 18 150 Net 50 M V
35. 4/18/13 17.5 150 Net 48 F V
36. 4/18/13 18.5 150 Net 50 F V
37. 4/18/13 18.5 150 Net 50 F V
38. 4/18/13 18.5 152 Net 52 F V
39. 4/18/13 17.5 150 Net 50 F V
40. 4/18/13 18.5 150 Net 52 M V
41. 4/18/13 18 125 Net 52 M V
42. 4/18/13 17.5 140 Net 50 F V
43. 4/18/13 18 150 Net 48 F V
44. 4/18/13 18.5 152 Net 52 M V
45. 4/18/13 18 150 Net 50 M V
46. 4/18/13 18 150 Net 50 F V
47. 4/18/13 18.5 152 Net 52 M V
48. 4/18/13 18 150 Net 50 F V
49. 4/18/13 18 150 Net 50 M V
50. 4/18/13 18.5 152 Net 52 F V
51. 4/18/13 17.5 120 Net 48 F V
52. 4/18/13 19 180 Net 50 F V
53. 4/18/13 18 148 Net 50 M V
54. 4/18/13 18 150 Net 48 F V
55. 4/18/13 17.5 150 Net 52 M V
56. 4/18/13 18 150 Net 52 M III
57. 4/18/13 18.5 150 Net 40 M V
58. 4/18/13 17.5 148 Net 50 M V
59. 4/18/13 18 150 Net 52 F V
60. 4/18/13 18.5 170 Net 50 F V
61. 4/18/13 18 140 Net 52 M V
62. 4/18/13 18 150 Net 52 M V
63. 4/18/13 18 140 Net 52 F V
64. 4/18/13 18 140 Net 52 F V
65. 4/18/13 18.5 150 Net 50 F V
66. 4/18/13 17.5 140 Net 50 M V
67. 4/18/13 17.5 140 Net 50 F V
68. 4/18/13 18 140 Net 50 M V
69. 4/18/13 18 150 Net 50 F V
70. 4/18/13 18 150 Net 50 F V
71. 4/18/13 18 150 Net 50 F V
Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers
11
72. 4/18/13 18 147 Net 50 M V
73. 4/18/13 17.5 147 Net 48 F V
74. 4/18/13 17.5 150 Net 48 F V
75. 4/18/13 18 150 Net 50 F V
76. 4/18/13 17 148 Net 48 F V
77. 4/18/13 18.5 150 Net 50 F V
78. 4/18/13 18.5 150 Net 50 M III
79. 4/18/13 18 150 Net 50 F V
80. 4/18/13 18 150 Net 50 M I
81. 4/18/13 18 148 Net 50 F V
82. 4/18/13 17 110 Net 48 M V
83. 4/18/13 18 150 Net 50 F V
84. 4/18/13 17 145 Net 50 F V
85. 4/18/13 17.5 148 Net 50 F V
86. 4/18/13 18 153 Net 52 M V
87. 4/18/13 18 148 Net 52 F V
88. 4/18/13 18 150 Net 52 F V
89. 4/18/13 17.5 148 Net 48 F V
90. 4/18/13 17.5 148 Net 48 F V
91. 4/18/13 18 150 Net 50 F V
92. 4/18/13 18 148 Net 50 M V
93. 4/18/13 18 148 Net 50 F V
94. 4/18/13 18 160 Net 52 F V
95. 4/18/13 19 160 Net 52 F V
96. 4/18/13 17 145 Net 48 F V
97. 4/18/13 19 170 Net 52 F V
98. 4/18/13 17 148 Net 48 M V
99. 4/18/13 18.5 155 Net 52 F V
100. 4/18/13 18.5 160 Net 52 F V
Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers
12
Country : Bangladesh Sampling area : Chittagong
Species : Rastrelliger kanagurta Total number of samples : 100
Technical Officer In Charge :
Agency : Bangladesh Fisheries Research Institute
E-mail address : Contact no. :
Vial no.
Date of sampling
Standard length (mm/cm)
Body weight (g)
Type of gear
Gill raker count*
Sex (M/F)
Gonad stage ( I to V)
1. 4/7/13 19.8 150 Net 52 F IV
2. 4/7/13 18.3 120 Net 50 F IV
3. 4/7/13 18 120 Net 50 M IV
4. 4/7/13 18 130 Net 50 F II
5. 4/7/13 17.9 120 Net 48 F III
6. 4/7/13 18 120 Net 50 F V
7. 4/7/13 18 110 Net 50 M III
8. 4/7/13 18.6 120 Net 52 F IV
9. 4/7/13 18 120 Net 50 M II
10. 4/7/13 18.5 120 Net 52 M IV
11. 4/7/13 19.5 140 Net 52 F IV
12. 4/7/13 18 120 Net 48 M III
13. 4/7/13 18.2 130 Net 50 M IV
14. 4/7/13 18.5 120 Net 52 F IV
15. 4/7/13 17.6 110 Net 48 F III
16. 4/7/13 17.5 120 Net 46 F III
17. 4/7/13 18 120 Net 50 F II
18. 4/7/13 18 110 Net 50 M II
19. 4/7/13 18.5 120 Net 52 M III
20. 4/7/13 18 120 Net 50 M III
21. 4/7/13 18 110 Net 50 M III
22. 4/7/13 17.7 120 Net 48 M I
23. 4/7/13 18.4 120 Net 50 M IV
24. 4/7/13 19 120 Net 52 M IV
25. 4/7/13 17.5 120 Net 48 F V
26. 4/7/13 18 110 Net 50 F III
27. 4/7/13 17.5 110 Net 48 M III
28. 4/7/13 19 140 Net 52 M IV
29. 4/7/13 18 100 Net 50 M III
30. 4/7/13 18.3 120 Net 52 F IV
31. 4/7/13 19 130 Net 52 M IV
32. 4/7/13 18.3 120 Net 50 F IV
Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers
13
33. 4/7/13 18.6 120 Net 50 F IV
34. 4/7/13 18.5 110 Net 52 F III
35. 4/7/13 18 120 Net 50 M II
36. 4/7/13 18.6 120 Net 52 M IV
37. 4/7/13 17.7 120 Net 48 F V
38. 4/7/13 18.5 110 Net 52 M IV
39. 4/7/13 18.9 140 Net 52 F IV
40. 4/7/13 18 130 Net 48 M IV
41. 4/7/13 17.8 110 Net 48 F III
42. 4/7/13 18.8 130 Net 52 F IV
43. 4/7/13 18 120 Net 50 F V
44. 4/7/13 18.3 120 Net 52 F III
45. 4/7/13 18 120 Net 48 M III
46. 4/7/13 18.4 120 Net 52 M II
47. 4/7/13 18 120 Net 50 M III
48. 4/7/13 18 110 Net 50 M IV
49. 4/7/13 17.8 120 Net 48 M III
50. 4/7/13 18.5 120 Net 52 M III
51. 4/7/13 19 140 Net 52 M II
52. 4/7/13 17.8 100 Net 48 M III
53. 4/7/13 18.3 120 Net 50 F III
54. 4/7/13 18.6 130 Net 52 F II
55. 4/7/13 17.5 130 Net 48 F II
56. 4/7/13 18.4 110 Net 52 M IV
57. 4/7/13 18.4 110 Net 52 M III
58. 4/7/13 18.6 120 Net 52 F III
59. 4/7/13 18 120 Net 50 F IV
60. 4/7/13 18 110 Net 48 F IV
61. 4/7/13 18.8 130 Net 52 F III
62. 4/7/13 18.4 120 Net 50 M III
63. 4/7/13 18 120 Net 48 F III
64. 4/7/13 18.5 120 Net 52 F IV
65. 4/7/13 18 120 Net 48 M III
66. 4/7/13 19 130 Net 52 F IV
67. 4/7/13 18 130 Net 48 M IV
68. 4/7/13 18.4 110 Net 50 F IV
69. 4/7/13 18.5 120 Net 52 M III
70. 4/7/13 18 110 Net 48 F III
71. 4/7/13 18 120 Net 48 M IV
Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers
14
72. 4/7/13 17.8 120 Net 48 M IV
73. 4/7/13 19 140 Net 52 F IV
74. 4/7/13 18.6 120 Net 52 M III
75. 4/7/13 18 120 Net 50 F IV
76. 4/7/13 19 130 Net 52 F III
77. 4/7/13 18 110 Net 48 M V
78. 4/7/13 18 100 Net 50 M I
79. 4/7/13 18.5 120 Net 52 M I
80. 4/7/13 17.2 100 Net 46 M II
81. 4/7/13 18.3 110 Net 50 M III
82. 4/7/13 18.4 120 Net 50 M III
83. 4/7/13 18.2 120 Net 48 M IV
84. 4/7/13 18.5 120 Net 52 M III
85. 4/7/13 18.6 120 Net 52 M IV
86. 4/7/13 18 120 Net 48 F IV
87. 4/7/13 18 120 Net 48 M III
88. 4/7/13 17 100 Net 46 M II
89. 4/7/13 19 130 Net 52 F III
90. 4/7/13 18.5 120 Net 52 F IV
91. 4/7/13 18.3 120 Net 50 M IV
92. 4/7/13 18 130 Net 50 F III
93. 4/7/13 17 120 Net 46 F III
94. 4/7/13 18.2 120 Net 48 F III
95. 4/7/13 18.5 110 Net 50 F IV
96. 4/7/13 18 120 Net 50 M III
97. 4/7/13 18.3 120 Net 50 M III
98. 4/7/13 19 140 Net 52 F IV
99. 4/7/13 18.1 120 Net 48 M IV
100. 4/7/13 18 120 Net 48 F IV
Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers
15
Country : Myanmar Sampling area : Rakhine
Species : Rastrelliger kanagurta Total number of samples : 100
Technical Officer In Charge : U Soe Win (Deputy Fisheries Officer, DOF Myein distric)
Agency : Department of Fisheries
E-mail address : [email protected] Contact no. : -
Vial no.
Date of sampling
Standard length (mm/cm)
Body weight (g)
Type of gear Gill raker count*
Sex (M/F)
Gonad stage ( I to V)
1. 3/22/13 16 70.9 One drift net 45(over) M NIL
2. 3/22/13 15.7 67.4 One drift net 45(over) M NIL
3. 3/22/13 14.9 52.6 One drift net 45(over) M NIL
4. 3/22/13 14.8 52.1 One drift net 45(over) M NIL
5. 3/22/13 16.1 72.1 One drift net 45(over) M NIL
6. 3/22/13 15.7 65.7 One drift net 45(over) M NIL
7. 3/22/13 14.7 51.2 One drift net 45(over) M NIL
8. 3/22/13 14.6 51.1 One drift net 45(over) M NIL
9. 3/22/13 15.2 64.3 One drift net 45(over) M NIL
10. 3/22/13 15.8 67.6 One drift net 45(over) M NIL
11. 3/22/13 14.8 52 One drift net 45(over) M NIL
12. 3/22/13 14.2 51.5 One drift net 45(over) M NIL
13. 3/22/13 15.6 64.4 One drift net 45(over) M NIL
14. 3/22/13 14.2 52.2 One drift net 45(over) M NIL
15. 3/22/13 14.6 52.8 One drift net 45(over) M NIL
16. 3/22/13 14.5 52.8 One drift net 45(over) M NIL
17. 3/22/13 14.5 52.2 One drift net 45(over) M NIL
18. 3/22/13 14.6 52.5 One drift net 45(over) M NIL
19. 3/22/13 14 46.5 One drift net 45(over) M NIL
20. 3/22/13 14 46.9 One drift net 45(over) M NIL
21. 3/23/13 15.7 71.7
Two small purse seine 45(over) M NIL
22. 3/23/13 15.6 71.7
Two small purse seine 45(over) M NIL
23. 3/23/13 15.5 71.7
Two small purse seine 45(over) M NIL
24. 3/23/13 15.7 71.8
Two small purse seine 45(over) M NIL
25. 3/23/13 15.5 71.9
Two small purse seine 45(over) M NIL
26. 3/23/13 15.6 71.8
Two small purse seine 45(over) M NIL
27. 3/23/13 15.7 71.8
Two small purse seine 45(over) M NIL
Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers
16
28. 3/23/13 15.7 71.8
Two small purse seine 45(over) M NIL
29. 3/23/13 15.7 71.8
Two small purse seine 45(over) M NIL
30. 3/23/13 15.5 71.9
Two small purse seine 45(over) M NIL
31. 3/23/13 15.9 71.9
Two small purse seine 45(over) M NIL
32. 3/23/13 15.4 71.5
Two small purse seine 45(over) M NIL
33. 3/23/13 15.7 71.9
Two small purse seine 45(over) M NIL
34. 3/23/13 15.7 71.8
Two small purse seine 45(over) M NIL
35. 3/23/13 14.6 52
Two small purse seine 45(over) M NIL
36. 3/23/13 16.1 72.7
Two small purse seine 45(over) M NIL
37. 3/23/13 15 55.5
Two small purse seine 45(over) M NIL
38. 3/23/13 14 46.5
Two small purse seine 45(over) M NIL
39. 3/23/13 14.4 46
Two small purse seine 45(over) M NIL
40. 3/23/13 14.8 52.7
Two small purse seine 45(over) M NIL
41. 3/23/13 14 43.9
Two small purse seine 45(over) M NIL
42. 3/23/13 14.1 43.1
Two small purse seine 45(over) M NIL
43. 3/23/13 13.9 41.3
Two small purse seine 45(over) M NIL
44. 3/23/13 13.5 40.5
Two small purse seine 45(over) M NIL
45. 3/23/13 13.6 37.7
Two small purse seine 45(over) M NIL
46. 3/23/13 13 34.8
Two small purse seine 45(over) M NIL
47. 3/23/13 14.6 49.8
Two small purse seine 45(over) M NIL
48. 3/23/13 14.1 43.7
Two small purse seine 45(over) M NIL
49. 3/23/13 13.4 38.9
Two small purse seine 45(over) M NIL
50. 3/23/13 14 46.1
Two small purse seine 45(over) M NIL
Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers
17
51. 3/24/13 14 46.9
Two small purse seine 45(over) M NIL
52. 3/24/13 14.7 52.1
Two small purse seine 45(over) M NIL
53. 3/24/13 21 184.9 Surrounding net 35 (over) F III
54. 3/24/13 21.1 183.9 Surrounding net 36 (over) F III
55. 3/24/13 20.6 173 Surrounding net 37 (over) F III
56. 3/24/13 20.6 170 Surrounding net 38 (over) F III
57. 3/24/13 21.6 172.8 Surrounding net 39 (over) F III
58. 3/24/13 21.7 172.7 Surrounding net 40 (over) F III
59. 3/24/13 22.5 184.4 Surrounding net 41 (over) F III
60. 3/24/13 22.5 184.5 Surrounding net 42 (over) F III
61. 3/24/13 21 180.3 Surrounding net 43 (over) F III
62. 3/24/13 21 180.9 Surrounding net 44 (over) F III
63. 3/24/13 21.1 170.3 Surrounding net 45 (over) F III
64. 3/24/13 21 170.3 Surrounding net 46 (over) F III
65. 3/24/13 21 146.3 Surrounding net 47 (over) F III
66. 3/24/13 21.1 147 Surrounding net 48 (over) F III
67. 3/24/13 21.5 184.4 Surrounding net 49 (over) F III
68. 3/24/13 21.4 184.5 Surrounding net 50 (over) F III
69. 3/24/13 19.3 148.3 Surrounding net 51 (over) F III
70. 3/24/13 19.5 148.5 Surrounding net 52 (over) F III
71. 3/25/13 21.6 163.6 Surrounding net 53 (over) F III
72. 3/25/13 21.6 164.5 Surrounding net 54 (over) F III
73. 3/25/13 21 127.1 Surrounding net 55 (over) F III
74. 3/25/13 21.1 127.2 Surrounding net 56 (over) F III
75. 3/25/13 20.9 168.8 Surrounding net 57 (over) F III
76. 3/25/13 20.9 167.8 Surrounding net 58 (over) F III
77. 3/25/13 20.8 141.6 Surrounding net 59 (over) F III
78. 3/25/13 20.9 142 Surrounding net 60 (over) F III
79. 3/25/13 19 134.9 Surrounding net 61 (over) F III
80. 3/25/13 19.1 135 Surrounding net 62 (over) F III
81. 3/25/13 21.5 187.8 Surrounding net 63 (over) F III
82. 3/25/13 21.4 187.7 Surrounding net 64 (over) F III
83. 3/25/13 21.4 183.2 Surrounding net 65 (over) F III
84. 3/25/13 21.4 183.3 Surrounding net 66 (over) F III
85. 3/25/13 21.9 183.5 Surrounding net 67 (over) F III
86. 3/25/13 21.8 183.4 Surrounding net 68 (over) F III
87. 3/25/13 21 130 Surrounding net 69 (over) F III
88. 3/25/13 21.1 127 Surrounding net 70 (over) F III
Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers
18
89. 3/25/13 20.7 174 Surrounding net 71 (over) F III
90. 3/25/13 20.7 175 Surrounding net 72 (over) F III
91. 3/26/13 19.3 148.8 Surrounding net 73 (over) F III
92. 3/26/13 19.4 148.5 Surrounding net 74 (over) F III
93. 3/26/13 20.6 178.8 Surrounding net 75 (over) F III
94. 3/26/13 20.6 178.7 Surrounding net 76 (over) F III
95. 3/26/13 21.1 124.9 Surrounding net 77 (over) F III
96. 3/26/13 21 125 Surrounding net 78 (over) F III
97. 3/26/13 21.9 181.2 Surrounding net 79 (over) F III
98. 3/26/13 21.8 182 Surrounding net 80 (over) F III
99. 3/26/13 21.2 145 Surrounding net 81 (over) F III
100. 3/26/13 21.3 145.9 Surrounding net 82 (over) F III
Country : Myanmar Sampling area : Kawthaung
Species : Rastrelliger kanagurta Total number of samples : 100
Technical Officer In Charge : U Tun Than (Fisheries Officer)
Agency : Department of Fisheries
E-mail address : - Contact no. : -
Vial no.
Date of sampling
Standard length (mm/cm)
Body weight (g)
Type of gear Gill raker count*
Sex (M/F)
gonad Stage ( I to V)
1. 3/23/13 20 179.7 Purse seine 51 F II
2. 3/23/13 20 185.8 Purse seine 49 M II
3. 3/23/13 19.5 179.1 Purse seine 51 F IV
4. 3/23/13 19.8 172.2 Purse seine 56 M III
5. 3/23/13 18.8 157.2 Purse seine 56 M II
6. 3/23/13 18.5 145.3 Purse seine 54 F IV
7. 3/23/13 18.8 146.4 Purse seine 53 M III
8. 3/23/13 18.5 132.5 Purse seine 52 M I
9. 3/23/13 17.5 122 Purse seine 52 M I
10. 3/23/13 17.5 104.6 Purse seine 38 F II
11. 3/23/13 18 122.2 Purse seine 50 M II
12. 3/23/13 17.8 125.7 Purse seine 51 M I
13. 3/23/13 17.5 121.6 Purse seine 51 M I
14. 3/22/13 17.2 106.7 Purse seine 53 M I
15. 3/22/13 20 170 Drift net 53 F II
16. 3/22/13 20 166.6 Drift net 51 F I
17. 3/22/13 19.8 161.3 Drift net 50 F II
18. 3/22/13 19.3 140.4 Drift net 54 F II
19. 3/22/13 19.5 156.5 Drift net 53 F II
Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers
19
20. 3/22/13 18.3 132.8 Drift net 54 F I
21. 3/22/13 21 232.5 Purse seine 51 F IV
22. 3/22/13 20.5 188.9 Purse seine 53 M III
23. 3/22/13 19.4 165.4 Purse seine 53 M III
24. 3/22/13 19.8 187.3 Purse seine 54 M III
25. 3/22/13 19 139.7 Purse seine 50 F I
26. 3/23/13 21.5 251 Purse seine 54 F IV
27. 3/23/13 21.7 239.6 Purse seine 56 F IV
28. 3/23/13 21.2 207.8 Purse seine 52 M IV
29. 3/23/13 20 174.4 Purse seine 52 F IV
30. 3/23/13 19.4 185.2 Purse seine 53 M IV
31. 3/23/13 21.8 218.9 Purse seine 54 F III
32. 3/23/13 21.8 212.7 Purse seine 55 M IV
33. 3/23/13 22 235.2 Purse seine 54 F III
34. 3/23/13 21.5 222.5 Purse seine 53 M III
35. 3/23/13 20.3 188.6 Purse seine 56 M IV
36. 3/23/13 23.3 251.2 Purse seine 56 F III
37. 3/23/13 21.7 227.9 Purse seine 56 F IV
38. 3/23/13 21 195 Purse seine 56 M IV
39. 3/23/13 21.1 204.4 Purse seine 56 M IV
40. 3/23/13 20.6 195.3 Purse seine 54 F III
41. 3/23/13 20.7 180.3 Purse seine 56 M III
42. 3/23/13 21.2 193.1 Purse seine 55 M IV
43. 3/23/13 21.3 203.7 Purse seine 55 F III
44. 3/23/13 19.6 160.5 Purse seine 58 M III
45. 3/23/13 19.5 159.5 Purse seine 55 M III
46. 3/23/13 18.3 139.6 Drift net 56 F I
47. 3/23/13 18.2 130.1 Drift net 53 M I
48. 3/23/13 18.5 137.1 Drift net 55 M III
49. 3/23/13 19.2 155.1 Drift net 52 F I
50. 3/23/13 18.8 136.6 Drift net 56 F I
51. 3/24/13 20.8 187.3 Drift net 57 M III
52. 3/24/13 20.2 171.2 Drift net 51 F III
53. 3/24/13 19.8 150.6 Drift net 56 F II
54. 3/24/13 18.5 124 Drift net 57 M I
55. 3/24/13 17.8 122.1 Drift net 51 F II
56. 3/24/13 19 131.4 Drift net 53 M II
57. 3/24/13 18.3 116.4 Drift net 53 F II
58. 3/24/13 17.5 104 Drift net 53 F III
Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers
20
59. 3/24/13 18 121.2 Drift net 55 F III
60. 3/24/13 16.8 92.7 Drift net 56 F III
61. 3/24/13 18.5 132.8 Drift net 52 M III
62. 3/24/13 18.3 126.1 Drift net 51 F II
63. 3/24/13 18.5 119.9 Drift net 52 F III
64. 3/24/13 18.1 118.4 Drift net 52 M II
65. 3/24/13 18.1 112.4 Drift net 54 M III
66. 3/24/13 19 159 Drift net 52 M III
67. 3/24/13 19.2 142.6 Drift net 54 F III
68. 3/24/13 19 144.9 Drift net 54 M III
69. 3/24/13 18.5 132.6 Drift net 56 M II
70. 3/24/13 17.8 120.7 Drift net 52 M I
71. 3/24/13 19.8 172.7 Drift net 55 F II
72. 3/24/13 18 119.3 Drift net 56 F I
73. 3/24/13 18.2 128.6 Drift net 52 F I
74. 3/24/13 17.5 107.2 Drift net 37 M II
75. 3/24/13 18 123 Drift net 37 M II
76. 3/25/13 20.1 197 Drift net 36 M III
77. 3/25/13 20 176 Drift net 56 F III
78. 3/25/13 19.8 187.2 Drift net 54 F II
79. 3/25/13 19.4 159.3 Drift net 54 F III
80. 3/25/13 19.8 171.1 Drift net 54 F III
81. 3/25/13 19.5 162.4 Drift net 55 F III
82. 3/25/13 20.2 191.1 Drift net 55 M III
83. 3/25/13 21.7 220.1 Drift net 57 M II
84. 3/25/13 20.2 178.2 Drift net 54 M III
85. 3/25/13 18.4 146.8 Drift net 58 F III
86. 3/25/13 19.8 181.5 Drift net 54 F III
87. 3/25/13 20 187.9 Drift net 53 F IV
88. 3/25/13 19.5 169.7 Drift net 53 M III
89. 3/25/13 19.8 176 Drift net 53 M II
90. 3/25/13 19.5 170.4 Drift net 54 M II
91. 3/25/13 18.7 149.4 Drift net 56 F I
92. 3/25/13 18.8 144.4 Drift net 52 F I
93. 3/25/13 19.3 157.2 Drift net 52 M II
94. 3/25/13 18.3 138.1 Drift net 55 F I
95. 3/25/13 19 145.6 Drift net 53 F III
96. 3/25/13 19 152.2 Drift net 53 M II
97. 3/25/13 18.5 142 Drift net 56 M I
Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers
21
98. 3/25/13 19 154.4 Drift net 51 M III
99. 3/25/13 19.2 151.2 Drift net 55 M II
100. 3/25/13 19.5 164.7 Drift net 53 F III
Country : Maldives Sampling area : Male ‘
Species : Rastrelliger kanagurta Total number of samples : 68
Technical Officer In Charge : Mohamed Ahusan
Agency : Marine Research Centre, Maldives
E-mail address : [email protected]
Contact no. : +960 3322242
Vial no.
Date of sampling
Standard length (mm/cm)
Body weight (g)
Type of gear
Gill raker count*
Sex (M/F)
Gonad stage ( I to V)
1. 2/10/13 18.5 112.99 44
2. 2/10/13 25.5 316.97 44
3. 2/13/13 19.8 146.13 43
4. 2/13/13 18.5 112.06 48
5. 2/13/13 18.5 112.4 43
6. 2/13/13 19.8 135.3 45
7. 3/13/13 25.5 303.36
8. 3/13/13 25.0 288.1
9. 3/13/13 24.3 271.55
10. 3/13/13 25.5 324.17
11. 3/13/13 25.5 301.85
12. 3/13/13 25.3 299.64
13. 3/13/13 24.5 287.78
14. 3/13/13 N/A
15. 3/13/13 N/A
16. 3/13/13 N/A
17. 3/13/13 N/A
18. 3/13/13 N/A
19. 9/1/13 20.5 187.25
20. 9/1/13 21.0 215.24
21. 9/1/13 20.5 185.3
22. 9/1/13 21.9 243.18
23. 9/1/13 21.2 215
24. 9/1/13 21.0 202
Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers
22
25. 9/27/13 N/A
26. 9/27/13 N/A
27. 9/27/13 N/A
28. 9/27/13 N/A
29. 9/27/13 N/A
30. 9/27/13 N/A
31. 9/27/13 N/A
32. 9/27/13 N/A
33. 9/27/13 N/A
34. 9/27/13 N/A
35. 9/27/13 N/A
36. 9/27/13 N/A
37. 9/27/13 N/A
38. 9/27/13 N/A
39. 9/27/13 N/A
40. 9/27/13 N/A
41. 9/27/13 N/A
42. 9/27/13 N/A
43. 9/27/13 N/A
44.. 9/27/13 N/A
45. 9/30/13 N/A
46. 9/30/13 N/A
47. 9/30/13 N/A
48. 9/30/13 N/A
49. 9/30/13 N/A
50. 9/30/13 N/A
51. 9/30/13 N/A
52. 9/30/13 N/A
53. 9/30/13 N/A
54. 9/30/13 N/A
55. 9/30/13 N/A
56. 9/30/13 N/A
57. 9/30/13 N/A
58. 9/30/13 N/A
59. 9/30/13 N/A
60. 9/30/13 N/A
61. 9/30/13 N/A
62. 9/30/13 N/A
63. - -
Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers
23
64. 9/30/13 N/A
65. 9/30/13 N/A
66. 9/30/13 N/A
67. 9/30/13 N/A
68. 9/30/13 N/A
69. - -
70. 9/30/13 N/A
71.
72.
73.
74.
75.
76.
77.
78.
79.
80.
81.
82.
83.
84.
85.
86.
87.
88.
89.
90.
91.
92.
93.
94.
95.
96.
97.
98.
99.
100.
Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers
24
Appendix II List of fourteen primers identified at NBFGR with optimal annealing conditions which can be used for genetic analysis of R. kanagurta
SI no
Locus Primer sequences 5’ 3’ Repeat motif
Ta (°C) Product size
No. of alleles*
1 Raka1 F: GCTTGACTGTGTTGGAAAGAGC AAAG 58 164-292 10
R: AAAGACAGGAGCACGGAAGC
2 Raka2 F:TCATTGACTTTATTTCTGGCACG AATAG 58 192-332 9
R:AAAGCCCTGATGTCAAGATGG
3 Raka10 F: GAATATCTGGTAATGAGAACTAAATGAGC TGCG 64 292-344 7
R: CAAGCAAATACTATACTACAATGACTGG
4 Raka12 F: TGGCTTCTGTAGTGTCAATTTGC ATCT 64 284-380 10
R:CATTCAGCTTGGTAAATGCCG
5 Raka26 F:CTACATGTCCAGCTGCAGGG ATT 62 183-198 10
R:GCAGATGATAACTCAATATGTGTTGG
6 Raka46 F:GAGGATATGCAGTGTCAGGAGG ATT 60 228-243 9
R: TTTATGTATCCATTATGGTCCAGG
7 Raka48 F:TCTTAATCTGCGCTAGTGGGC AATC 58 180-224 10
R:TTTGGCAATGAAACTATGAAGTCC
8 KSJ18 F: GCTGGTCATTTGTATCTTTGA (GT)17 55 206-240 10
R: TGGCTGCCTTTTGAATAA
9 KSJ26 F: GGAGCATTTGACAACACTTAC (GT)13
AT(GT3
58 216-246 9
R: AGTCAGTTTTGGTGGATGAG
10 SA2068 F: CAAGACATGACAGAGTAGGACATTGAC (GGA)9 56 147-177 9
R: AGATTGGGAGTTTGTAGGGGTAATA
11 SA2657 F: TGTCAGAGATGTAGCACATACGG (CA)19 56 240-324 14
R: AGCATTATCTGGTGCTGTAAGGA
12 SA2770 F: AGAAATGAAAAGGGCTTTAAGGA (CA)22
56 240-324 15
R: ACTGAGCTGCTTAAAATGCAAAA
13 SCA8 F: TCAGCTGTTCATTCCCATAGCCCA (CA)21
59 140-174 13
R: ATGAAGGAACAATGAGCCTCCAGC
14 SCA30 F: TGGCTGTCGGTCACTCTGCCTC (GA
/CA)23
59 114-130 7
R: ACACACACGGGTACACACAGGG
*Fifteen individuals were used for primer screening
Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers
26
Appendix III Number of R. kanagurta genotyped by loci and sample site.
Sampling area
Primers Number of samples done
(Number of complete samples)
RAKA1 RAKA2 RAKA10 RAKA12 RAKA26 RAKA46 RAKA48 KSJ
18
KSJ
26
SA
2068
SA
2657
SA
2770
SCA8 SCA30
Kuantan 100 100 91 80 82 100 100 100 94 100 96 100 100 100 1343
Kudat 100 96 83 92 85 100 100 100 97 100 96 100 100 100 1349
Yangon (Rakhine) 100 92 98 98 89 100 81 100 100 100 96 100 100 100 1354
Kawthaung (Tanintharyi)
100 98 91 90 97 100 88 100 100 100 100 100 99 100 1363
Male’ 68 63 54 49 57 68 68 68 66 68 67 67 68 68 899
Total 468 449 417 409 410 468 437 468 457 468 455 467 467 468 6308
Genetic stock structure identification of Indian mackerel in the BOBLME region using microsatellite markers
27
Appendix IV Genotype data for R. kanagurta samples collected from South China Sea, Maldives and Myanmar.
Annex4.xls