UNIVERSITY OF HAWAI'I LIBRARY

CARDIAC AND PULMONARY RESPONSE OF MICE TO POLLUTION

A THESIS SUMBITTED TO THE GRADUATE DMSION OF THE UNIVERSITY OF HAW AI'I IN PARTIAL FULFILLMENT

OF THE REQUIREMENTS FOR THE DEGREE OF

MASTER OF SCIENCE

IN

MOLECULAR BIOSCIENCES AND BIOENGINEERING

AUGUST 2008

By Ria Nag

Thesis Committee

Ralph V Shohet, Chairperson John G Maresh

David Christopher

We certify that we have read this thesis and that, in our opinion, it is satisfactory

in scope and quality as a thesis for the degree of Master of Science in Molecular

Biosciences and Bioengineering.

2

First and foremost, I would like to thank and dedicate my thesis to Dr. Ralph V Shohet, my

advisor, for his constant and persistent guidance with my research, in spite of his busy

schedule. I truly value his advice and interest in my project.

Next I would like to thank my wonderful mother without whose sacrifices and support, I

would have never been able to come this far.

Next I would like to thank Dr. John G Maresh, who consistently helped my research and

also agreed to be a part of my Master's defense committee.

I would like to acknowledge and thank my committee member Dr. David Christopher and

the graduate chair of MBBE department, Dr. Dulal Borthaknr for their valuable comments

and suggestions.

I am also thankful to Dr.Gordon Okimoto for helping me in the Ingenuity Pathway

analysis.

I am also grateful to all my lab members for their help and support. I have sincerely

enjoyed working with all of them over the last two years at the Centre for Cardiovascular

research.

I am grateful to my friends for their understanding and support.

I am grateful to my family for their encouragement, care, concern and love.

3

Table of Contents

ACKNOWLEDGEMENTS ............................................................................................. 3

LIST OF T ABLES ............................................................................................................ 5

LIST OF FlGU"RES .......................................................................................................... 6

LIST OF ABBREVIATIONS .......................................................................................... 7

ABSTRACT ....................................................................................................................... 8

CHAPTER 1. INTRODUCTION .................................................................................. 10

CHAPTER 2. MATERIALS AND METHODS .............................•............... 15

2.1. Animals. 15 2.2. DEP exposure 15 2.3. RNA extraction 15 2.4. RNA analysis 16 2.5. Microarray analysis. 16 2.6. Real time PCR 17 2.7. Immunohistochemistry 18

CHAPTER 3. RESUL TS ......................................................•..•.........•......•.•................... 19

3.1. Microarray analysis. 19 3.2. Real time PCR 19 3.3. Immunohistochemistry 20

CHAPTER 4. DISCUSSION ......................................................................................... 44

BIBLIOGRAPHY ..............•..................................•......................................................... 48

4

List of Tables

Table 1. PCR primers ................................................................... 18

Table 2. List of genes dysreguJated in heart ........................................ 26-29

Table 3. List of genes dysreguJated in lung ........................................ 30

Table 4. delta Ct of genes dysreguJated in heart .................................... 36

Table 5. List of references for the interactions shown in figure 14 and 15 .... .46

5

List of Figures

Figure I. Particulate matter air pollution size distribution 14 Figure 2. Hierarchical clustering of genes dysregulated in heart 21-23 Figure 3. Hierarchical clustering of genes dysregulated in lung 24 Figure 4. Delta Ct of Cpe 31 Figure 5. Delta Ct of Ftll 31 Figure 6. Delta Ct ofTxnip . 32 Figure 7. Delta Ct of Echl 32 Figure 8. Delta Ct of VI dr. 33 Figure 9. Delta Ct ofSaa3. 33 Figure 10. Fold changes of various genes in heart 34 Figure II. Fold changes ofSaa3 in lung. 35 Figure 12. Immunohistochemistry ofCpe in heart 37 Figure 13. Biological mechanisms of cardiovascular diseases. 38 Figure 14. Mechanism to regulate hypertensive effects ofDEP 40 Figure 15. Mechanism of enhanced atherosclerosis due to DEP 42

6

List of Abbreviations:

DEP:Diesel engine particulate

PM:particuiate matter

UFP:ultra fine particulate matter

IPA:Ingenuity pathway analysis

PCR:Polymerase chain reaction

Ct:coefficient of threshold

RNA:ribonucleic acid

cDNA:complementary DNA

WT: wild- type

Apo E: apolipoprotein E

7

Abstract

Background: Epidemiological studies have identified air pollution as a contributing factor

in both pulmonary and cardiovascular disease, but the mechanisms whereby air pollution

accelerates these diseases are not fully known. One common component of air pollution is

the particulate fraction of diesel engine exhaust, generated from a variety of transportation

and industrial sources. High levels of exposure to diesel exhaust are also an important

occupational hazard for workers in transportation and industry. Methodology: As a model

of exposure to this key component of air pollution, a suspension of standardized diesel

engine particulate (DEP) was instilled into the trachea of anesth~ed mice. All mice were

subjected to a single dose of 100 Ilg ofDEP. 24 h and 5 days after treatment, the mice

were euthanized. Then their heart and lungs were rapidly collected and frozen, as were

tissues from control animals, treated with PBS. RNA was extracted and pooled from

quadruplicate samples, and analyzed by hybridization to highly representative microarrays

containing the Operon V3® set of murine long oligonucleotides. Transcripts that appeared

to be highly dysregulated in dye-reversed microarray experiments (with an absolute value

of fold-change> 2) were tabulated and considered for confirmation by real-time peR of

RNA from individual animals. In addition heart tissues were evaluated by

immunohistochemical methods for protein expression patterns. Because

hypercholesterolemia is a known accelerating factor in the progression of atherosclerosis,

simultaneous exposures of Apo E (-f-) mice to DEP were included, allowing an assessment

of the combined effect of pollution and hypercholesterolemia. Results: 24 h after DEP

exposure, 110 cardiac transcripts were dysregulated ( > 2 fold) in anyone experiment. 24

transcripts were observed to be dysregulated i.e., either up or down regulated, by greater

8

than 2 fold in lung after both 24 hours and 5 days after DEP exposure. Cardiac expression

ofVldlr, Txnip, Ft1I, Echl, and Cpe (Very low density lipoprotein receptor, Thioredoxin

interacting protein, Ferritin light chain I, Delta3,5-delta2,4-dienoyl-coa isomerase,

Carboxypeptidase E) were each found to be differentially dysregulated in Apo E(-I-) strain

vs. wild type at 24 h; increased pulmonary expression of Saa3 (serom amyloid A3) was

observed in lung. The change in abundance of each of these transcripts was confirmed by

semi-quantitative Real Time PCR. Conclusion: Up-regulation of Cpe( carboxypeptidase

E, a pro-hormone and neuropeptide processor) expression was observed in Apo E-l-mice

heart by microarray, real time PCR and immunohistochemistry experiments. Differential

up-regulation ofVldlr, Txnip, Ft1I, Echl and Saa3 was observed in Apo E-I- mice in the

heart and lung respectively, by microarray and real time PCR. Thus the study predicts

some key genes (including those related to cardiovascular disease, inflammation, immune

response and progression of atherosclerosis) that can be involved in the pathology of

cardiac and pulmonary disorders due to acute exposure ofDEP under hypercholesterolemic

conditions.

9

Chapter 1: INTRODUCTION:

Occupational exposure to diesel exhaust is prevalent within transportation(Davis et a1.,

2007), mining(Monforton, 2002)and heavy industIy. Diesel exhaust is a major component

of present day air pollution, especially affecting people who live in urbanized areas with

high vehicular traffic such as those living near freeways, shipping yards etc(Krivoshto et

a1., 2008). Especially susceptible subgroups include children (Bateson and Schwartz,

2008)and elderly(pope et a1., 2002). Air pollution likely contributes to asthma(Bateson and

Schwartz, 2008) in children and may exacerbate cardiac and pulmonary disorders that are

preexisting in the elderly popuiation(Goldberg et a1., 2001).

Air borne particulate matter consists of a heterogeneous mixture of solid and liquid

particles suspended in air. Particles vary in size(Fig.l). Larger particles are produced from

crustal material through windblown air or grinding processes(Brook et a1., 2004). Larger

particles are also composed of important bioaerosols like endotoxin, fungal spores and

pollen grains. DEP mostly consists of particulate matter below 2.5 micron in

size(pM2.s)(Fig 1)7. Ultrafine particles(UFP) less than 100nm in diameterS are also

prevalent in diesel exhaust. PM2.S and UFPs are primarily derived from combustion

process9• National Ambient Air Quality Standards set by the EPA for Particulate Matter

(PM2.S) is 35 ).tglm3 for a 24 period. Coarser and larger particles show greater deposition in

the upper respiratory tract including the extra thoracic and upper tracheobronchial regions,

while smaller particles tends to get deposited in the deep lunglO• UFPs have a high surface

to mass ratio and thus show a greater deposition in the alveoli II. UFPs are considered to

10

have higher biological toxicity. They can pass on to the circulatory system and be

disseminated systemicallyl2.

DEP is chemically composed of mainly hydrocarbons, polycyclic aromatic

hydrocarbons(pAH), acids, aldehydes, quinones and metals including iron, copper,

vanadium, zinc and nickel adsorbed onto large carbonaceous cores with large surface

areasI3. 14. DEP also contains nitrates and suiphateslO.

Incremental rises in PM are associated with increased mortality and morbidity due to

cardiac and pulmonary disorders IS . Studies have shown that more deaths are caused by

particulate matter exposures due to cardiac disorders than pulmonary disordersI6. 17. DEP

exposure causes oxidative DNA damage and aggravates pulmonary diseases including

asthma and lung cancerl8. However the exact mechanism of carcinogenic effects ofDEP is

unknownI9.20. Polyaromatic hydrocarbons in diesel can form DNA adducts, which can

lead to tumorigenicity and mutagenici~I.22. DEP exposure can lead to oxidative stress

and inflammation resulting in release of reactive oxygen species (ROS) from

macrophages23. Transition metals present in DEP can also produce ROS23.

DEP exposure can mediate progression of atherosclerosis and induce vascular

inflammationIO.24. Systemic inflammation can activate platelets and blood clotting factors

like fibrinogen and hence enhance blood coagu!abilitylO.24.

Hypercholestrolemia further exacerbates the effect of pollution. The combined effects of

pollution and hypercholesterolemia can induce vascular inflammation, mitochondrial

damage and formation of atherosclerotic lesio~s.

11

However the exact mechanisms that lead to cardiac and pulmonary disorders due to DEP

exposure is unknown26•

cDNA micro array studies have been perfonned to study the transcriptional response of

murine lung tissue to the combined effect of lipopolysaccharide and DEp2'. cDNA

microarray studies perfonned with rat lung indicated that DEP exposure induces lung

carcinogenesis2'. In vitro studies using Human umbilical vein endothelial cells(HUVEC)

have also been done to study to transcriptional response to carbon black, a component of

DEp28. However the response to pollution observed in vitro studies under controlled and

modified culture conditions may not represent the same as that which occurs in vivo. The

in vitro system lacks the detoxifYing ability of the organism's antioxidant system and the

filtration capacity of the organism's respiratory system29• The endocrine and paracrine

effects present in vivo, are absent in vitro 29. Therefore, an evaluation of the in vivo

transcriptional response to diesel exhaust is necessary to fully understand the adaptive and

pathological, cardiac and pulmonary responses to diesel exhaust.

Exposure of animals to experimental pollutants has been perfonned by inhalation30 • The

standard inhalation systems are of two types, either nose-only or whole-body chambers.

However it is difficult to achieve high lung particle burdens in a short period of time with

the standard inha1ation systems30• Intratracheal instillation is an accepted method of

exposure which confines the test material and accurately delivers a defined dose to the

lower respiratory tract, bypassing the defenses of the upper respiratory tract 1. Instillation

12

greatly reduces the amount of equipment that must be decontaminated after exposure to

highly toxic or carcinogenic materials30.

The aerosol concentrations required for inba1ation exposure to deliver the same effective

dose as instillation are difficult to achieve and may not be well tolerated by the animals30.

A very large amount of test material, maintenance and post exposure cleaning of large

exposure chambers is required for inba1ation exposures which makes inhalation

experiments more expensive and cumbersome30. Test material can deposit in the upper

respiratory tract or on the fur, making oral ingestion oflarge amounts of material a

confounding effect which can interfere with a study 30.

Microarrarray technology is a tool for screening a large number of target genes that are

potentially differentially expressed between biological samples. A microarray has

thousands of cDNA sequences or oligonucleotides, arrayed on a glass slide with high speed

robotics and has enabled comprehensive gene expression profiling of pathophysiological

states, including toxicological exposures. The microarrays serve as gene targets for

hybridization to cDNA or RNA probes prepared from cells or tissues. Comparative analysis

of the relative abundance of specific genes expressed is possible by labeling the RNA from

the treated and untreated animals with two or more fluorophores to prepare probes for

simultaneous hybridization with separate detection of fluorescent signais32.

Quantitative real-time RT -PCR is a highly specific and sensitive technique that provides

precise quantification and validation of the microarray results. Inununohistochemistry or

western blot analysis further validates transcriptional analysis at the level of protein

expression.

13

......- UFP (PM , ,)

lf1fraftbC plrtldC5

PM 2.5

FiIlQ~

PM 10

PM lll-B

C(lCIO fnIc(ion

Fig 1 :Particulate matter air pollution size distribution.(Brook et aI. , 2004)

14

Chapter 2: Materials and Methods:

2.1.Animals:

ApoE knockout crossed with Tie 2 GFP mice were used as murine model of

atherosclerosis. The ApoE deficient animal, develops diffuse atherosclerosis on a high

cholesterol diet 33.34. Tie 2 GFP mice were used as wild type mice(Jackson Labs, Bar

Harbor, ME).

2.2.DEP exposure

Male wild type and Apo E deficient, mice were anesthetized and exposed intratrachea1ly to

a single dose of 100 J.lg of Diesel exhaust particles (DEP) purchased from the US National

Institutes of Standards and Technology, suspended in saline. Controls consisted of

littermates exposed to saline alone. Animals were humanely euthanized by CCh

asphyxiation at the completion of exposure periods. All studies were performed according

to a study protocol approved by the University of Hawaii Institutional Animal Care and

Use Committee.

2.3RNA extraction

Following 24 hours and 5 day after exposure, the heart and lungs were dissected, frozen

and the total RNA was extracted using Ttizol (Invitrogen, Carlsbad CA). RNA was purified

15

further using MicroRNEasy system (Qiagen,) according to the manufacturer's protocol.

The Qubit system (Invitrogen) was used to fluorometricaIly quantify the resultant RNA.

The integrity of the total RNA prep was assessed by visualization of intact 28S and 18S

ribosomal RNA (rRNA) bands after 1 % agm:ose gel electrophoresis of the RNA prep.

2.4.RNA Analysis

5 ug aliquots of pooled total RNA from the lungs of 4 animals which were either all DEP

exposed or control animals were generated for each experiment and then subjected to one

cycle of amplification using the Message Amp kit (Ambion, Austin, TX) according to

manufacturer's instructions. This produced approximately 5 ug of amplified cRNA after

one round of amplification. 2 ug of aRNA from each from the lungs ofDEP exposed and

control mice were labeled with Cy3 and Cy5 fluorophores with the Perkin Elmer ASAP

RNA Labeling Kit, according to the manufacturer's instructions. 30ug of total RNA from

the heart of 4 animals which were either all DEP exposed or control animals, was labeled

using Micromax direct labeling kit (perkin Elmer) according to the manufacturer's

instructions.

2.5Microarray analysis:

Labeled RNA was hybridized overnight to microscope slides containing the Operon V3

long oligo array. Following stringency washing, slides were scanned using the Molecular

Devices 4000B (CA). Replicate hybridizations were performed (with Cy3-Cy5 dye­

swapped) and were analyzed with Genepix and Acuity software from Molecular Devices.

16

Ingenuity pathway analysis(IPA):

IPA enables understanding of the complex biological systems at the core of research, by

searching the scientific literature for insights relevant to one's experiment and building

dynamic pathway models. This extends one's understanding of the research by

identification of key genes associated with each pathway.

2.6.Real-time PCR confirmation for the dysregulated genes in microarray analysis:

Oligonucleotide amplimers were designed from the cDNA sequences that were predicted to

cross an intron, where possible. Sequences are available in Table 1. These primers were

used to amplify product from cDNA representing 5 ng oftotal RNA. PCR was run in

triplicate for each tissue from each animal separately with SYBR@ green fluorophore

(Molecular Probes, Portland, OR) in an Opticon™ device (MJ Research, Waltham, MA).

A standard two-phase reaction (95°C 15 sec, 60°C 1 min) worked for all amplifications.

The relative expression level for each gene was interpolated from a standard curve

generated from a series of cDNA dilutions at cycle times where Ct, the threshold intensity,

was clearly exceeded. In each real-time PCR run, the abundance ofCyclophilin A was

17

assessed in parallel, and fold changes for genes of interest were calculated by normalization

to cyclophilin as a loading control.

Table 1. peR primers

Gene Forward Primer Reverse Primer

Echl CTG GAG GOA GTT GOT GOA ATG GOG CTG CAT GAG TTC GOA G

Ft11 GAA CCG CCT GGT CAA CTT G TCC TGG GTT TTA CCC CAT TCA

T

Txnip ACC ACT TTC TCG GAT GTT GGA GGA AAG ACA ACG CCA GAA

GOT

Vldlr GGCAGCAGGCAATGCAATG GOG CTC GTC ACT CCA GTC T

Cpe TAT AAA CTT ACA GCC TCC OCT AAA GAC TCA AGC TCA AAG

CCT TCCACC

SAA3 GTTCACGOGACATGOAGCAGAGGA GCAGGCCAGCAGGTCGGAAGTG

2.7.Immunohistochemistry

18

Tissues were dissected and fixed in fonnalin overnight. F onnalin-fixed tissues were

sectioned and used for immunohistochemistry studies according to a standard antigen

retrieval method using citric buffer (PH 6.0). The rabbit anti-Cpe C-tenn described by Y. P.

Loh es] was used for the analysis. Cpe was detected with anti rabbit bioitnylated secondary

antibody, followed by the addition of a chromogen substrate.

Chapter 3: Results

3.1.Microarrayanalysis

The results of the microarray experiments as shown in fig 2 and 3, was submitted to the

OED database (Series OSE 11286). Microarray analysis showed dysregulation by greater

than 2 fold in at least one of the arrays, in the expression of 110 genes in the heart (fig

2a,2b and 2c) of ApoE-I- and wild type mice sacrificed 24 hours after DEP exposure.

Dysregulation in the expression of 24 genes, by greater than 2 fold in at least one of the

arrays, was observed in the lungs of (Fig 3) ApoE-f- or wild type mice, sacrificed 24 hours

and 5 days after DEP exposure. Most of these genes were differentially dysregulated in

hearts and lungs of ApoE-I- mice.

Ingenuity Pathway analysis was done with these 110 genes using the fold change observed

in ApoE -f- mice to identifY pathways that could be associated with the pathology. The lPA

results and the existing literature knowledge base were studied extensively. However

several interactions shown between different genes, could not be validated by the existing

literature.

3.2.Rea1 Time PCR analysis.

19

Up regulation of expression of five genes from the list of 110 genes observed to be

dysregulated in the microarray experiments with heart and SAA3 or serum amyloid A3

gene in lung, was confirmed by Real Time PCR for three groups of mice, which are

Apo E (-1-) mice sacrificed 24 hr after exposure, wild type mice sacrificed 24 hr after

exposure and wild type mice sacrificed 5 days after exposure. Each group represents 2 set

of mice, one set was exposed to DEP and other set exposed to saline alone. Each set

consisted of 3 mice. The genes confirmed to be up regulated by Real Time PCR in heart

are Cpe or Carboxypeptidase E (Fig 4), FtlI or Ferritin light chain 1 (Fig 5), Txnip or

Thioredoxin interacting protein (Fig 6), Echlor delta3,5-delta2,4-dienoyl-coa isomerase

(Fig 7), Vldlr or very low density lipoprotein receptor (Fig 8). The gene confirmed to be up

regulated by Real Time PCR in lung is SAA3 or Serum Amyloid A3 (Fig 9). The known

function ofCpe is pro-hormone and neuropeptide processing, that ofFtll of Ferritin light

chain 1 is uptake of intracellular iron, that of Txnip is inhibition of thioredoxin ,an anti

oxidant, that ofVldlr is lipid metabolism and that ofEchI is peroxisomal beta-oxidation.

SAA3 is produced in response to inflammation. P values were calculated using T- test. Up

regulation of these five genes in the heart and SAA3 in the lung was statistically significant

in Apo E(-f- ) mice with P values less than 0.05. Comparison of Real time PCR and

microarray experiments, in fig 10 and fig II, show significant concordance of the Real

time PCR and microarray data.

3.3.lmmunohistochemistry:

The heart sections obtained from Apo E (-f-) mice, sacrificed 24 hr after DEP exposure and

stained with anti Cpe antibody ,showed distinct staining of endothelial cells lining the

20

capillaries compared to the wild type mice, sacrificed 24 hr after DEP exposure and the

wild type and Apo E-!- mice exposed to saline a lone(Fig 12). Thus epe was significantl y

up regulated in the Apo E-!- mice exposed to DEP at the proteome level.

Wt ApoE-!-

>-3.91 < 3.91

77 0 ti M300016301 Olfr167\0lfactory receptor M300020840 Olfr49010lfactory receptor M300003789 Zfp521zinc finger protein 11 M300015309 Mdpklmyotonic dystrophy protein kinase M300009336 Dsgbllriken full-length product M300001278 Mertklproto-oncogene M200015801 Similar to complement component 8 M300003603 Itsnlintersectin M300010515 Dscamllldown syndrome protein M200013720 Siat8cl sialyltransferase M300011417 Hoxa\3lhomeobox protein M200001877 Mpolmyeloperoxidase M300003902 Strnlstriatin

M200000316 Racllras-related c3 botulinum M200003081 Poly(a) binding protein, cytoplasmic 4 M300011228 Ubclubi uitin b.

V v 0 :(Jen$i Ii e 0 M300022012 Rpl7alribosomal protein 17a M300007364 Aldo 1 Ifructose-bisphosphate aldolase a M200012637 Clulclusterin precursor

Fig 2a: Hierarchical clustering of genes dysregulated in heart.

2 1

Wt Apo E-/-

>-3.91

M300000786 Crip21lim only protein hlp. M200006376 Cycllcytochrome cl M200005333 Ndr21ndrg2 protein M300017648 Hspd1160 kda heat shock protein M200000293 Psmellproteasome activator Ml00003706 Got21 Aspartate aminotransferase M300009674 Gapdlglyceraldehyde dehdrogenase M200002982 Mybpc3lmyosin-binding protein M300010220 Rps21repeat family 3 gene. M200009398 Acaa2lacetyl-coenzyme a acyltransferase2 M30001l435 Hrclhistidine rich calcium binding protein M200000229 Prn Imajor rion rotein precursor

6 Cr . • M300004749 Hadhal hydroxyacyl-coenzyme a dehydrogenase M200004326 Succinate dehydrogenase cytochrome b560 M200014444 Ttnltitin M200005294 Pfkmlphosphofructokinase M200003252 Suil-rsllsuppressor of initiator codon M300000229 Aktl I rae-alpha serine-threonine kinase M200012720 Eif5al translation initiation factor M200005738 Usmg41upregulated during skeletal muscle growth M200013095 Pgam21phosphoglycerate mutase 2 M300006675 Ranlgtp-binding nuclear protein M200006686 Ndufvllnadh dehydrogenase M200007653 Pdhall ruvate dehydro enase

300013259 Anf\atrial natriuretie fado MJ00021383 Ftl1\ferritin light chain

00 Eehl iso M200003369 Calse

i e

< 3.91 Fig 2b: Hierarchical clustering of genes dysregulated in heart (continued)

22

23

Fig 2: Heat maps of hierarehieal clustering of 110 genes dysreguated by greater than 2

fold in anyone array in heart. Each column in the heat maps represents an average oflog

base 2 fold change in two arrays, one being the dye reversal of other. Each row represents

dysregulation in one gene in different experiments. Red represents up regulation of a gene

and green represents down regulation of a gene. Greater the color intensity, greater is the

dysregulation. First column represents arrays for wild type animals and second column

represents Apo E( -1-) animals. All animals were sacrificed 24 hours after DEP exposure.

Genes highlighted in blue are those which have been confirmed by real time peR or which

have been implicated in cardiovascular disorders.

24

Apo E-I-24m

>-2.49

Wt 24m

Wt 5 day

M200006584 Mtch 1 \mitochondrial carrier! M300013829 1190001g19 riken unknown M300005554 Mtch2 \mitochondrial carrier2 M200012115 Paics\multifunctional rotein MJ 19653 AtpSl\atp synthase H-Il M300002130 Spnb2\spectrin beta chain M300013409 Ndufa7\nadh dehydrogenase M300005675 1700030g11 riken unknown M200001019 Pt~rotein-tyrosine hosphatase I 00001810 Gad 45 \DNA damage indueible rote" M300003643 Krt2-17\keratin, tylle ii MJ00006375 Xree2\dna-repair prote"

200003295 Saa3\ serum am);'J'0""i.".,.."" 300005305 Len1\Li lin

M200012164 Pou6fl\pou domain, class 6, M300000276 Ccnel \glls-specific cyclin el.

<2.49

Fig 3: Heat maps of hierarchical clustering of 24 genes dysreguated by greater than 2

fold in any one array in lung. Each column in the heat maps represents an average of log

base 2 fo ld change in two arrays, one being the dye reversal of other. Each row represents

dysregulation in one gene in di fferent experiments. Red represents up regulation of a gene

and green represents down regulation of a gene. Greater the color intensity, greater is the

dysregulation. First column represents arrays for Apo E(-I-) animals while second and thi rd

column represents wild type animals. Animals representing the first and second columns

were sacrificed 24 hours after DEP exposure. Animals representing the thi rd columns were

sacrificed 5 day after DEP exposure. Genes high lighted in blue are those which have been

confi rmed by real time PCR or have been implicated in lung inJlanunation or DNA damage

25

id Ref Seq ApoE wt Description

M200000229 NM 011170 2.07 1.26 Major prion protein precursor (prp)

M200000293 NM 011189 2.49 1.26 Proteasome activator complex

M200000316 NM 009007. 2.12 1.45 Ras-related c3 botulinum toxin

M200000803 NM 016772 1.59 1.49 Ech 1 ,delta3,5-delta2,4-dienoyl-coa

M200001610 NM 013703 2.32 1.38 Vldlr/very low-density lipoprotein

M200001877 NM 010824 -2.61 1.60 Myeloperoxidase precursor

M200002493 NM 001083 2.75 1.46 Gpx3,ldutathione neroxidase 3

M200002982 NM 008653 2.93 1.35 Myosin-binding protein c, cardiac-

M200003081 NM 148917 1.86 1.34 Poly a binding protein, cytoplasmic

M200003096 NM 008095 2.35 1.56 Nipsnap2 protein (glioblastoma

M200003252 NM 011508 2.27 1.19

M200003369 NM 009814 1.16 1.27 Calsequestrin, cardiac muscle

M200003706 NM 010325 2.86 1.32 Aspartate aminotransferase,

M200004055 NM 134114 -1.19 -1.02 -M200004326 NM 025321 2.32 1.19 Succinate dehydrogenase

M200004522 NM 029320 -5.93 -7.91 Progesterone-induced blocking

M200005294 NM 021514 2.41 1.20 6-Phosphofructokinase, muscle

M200005333 NM 013864 2.63 1.28 Ndrg2 protein

M200005407 NM 010726 2.26 1.48 Phytanoyl-coa dioxygenase,

Upregulated during skeletal muscle M200005738 NM 031401 2.52 1.17 growth 4; dna segment. chr 3. M200005930 NM 024197 2.87 1.36 -M200006140 NM 029272 2.10 1.43 -M200006376 NM 025567 2.56 1.26 Cytochrome c1, heme protein,

M200006686 NM 133666 2.35 1.08 Nadh dehydrogenase (ubiQuinone)

M200006822 NM 010956 2.41 1.30 Odgh, oxolrlutarate dehvdroe:enase

M200007215 NM 029553 -2.92 -4.46 Ttc 8

M200007653 NM 008810 1.86 1.85 Pyruvate dehydrogenase e 1

M200007765 NM 145555 -1.90 -6.47 -M200007835 NM 007744 2.37 1.52 Catechol o-methyltransferase,

M200009398 NM 177470 2.50 1.29 Similar to acetyl-coenzyme a

M200011473 NT 039716.7 -2.06 -2.49 -M200011815 NM 029796 2.11 1.17 Leucine-rich alpha-2-g1ycoprotein;

Table 3a:List of genes dysregulated in heart in the microarray experiments.

26

id RefSe(! ApoE wt Description

M200011884 XM 136059 -1.97 -2.52 -M200012637 NM 013492 3.23 1.32 Clusterin precursor

Eukaryotic translation initiation M200012720 NM 181582 2.68 1.24 factor 5a (eif-5a)

M200013095 NM 018870 2.40 1.00 Phosphoglycerate mutase 2

M200013720 NM 009182 -2.30 -3.37 sialyltransferase 8c

M200014444 NM 028004 2.18 1.17 Ttn

M200015455 NM 023719 1.08 2.24 Txnip/thioredoxin interacting

M200015801 NM 133882 -2.65 -6.16 Similar to complement component8

M300000229 NM 009652 2.64 1.22 Rae-alpha serine/threonine kinase

M300000786 NM 024223 2.78 1.28 Lim only protein hlp.

M300000950 NM 008084 2.22 1.44 Glyceraldehyde 3-phosphate

M300001050 NM 026065 1.57 1.28 Mitochondrial 28s ribosomal

M300001278 NM 008587 -2.61 -1.93 Proto-oncogene tyrosine-protein

M300001556 NM 026561 -1.87 -3.06 -M300002717 XM 909282 2.09 1.34 --M300002773 NM 028079 -2.72 - Aminopeptidase 0

M300003603 NM 010587 -2.57 -5.66 Intersectin 1 (eh and shl domains

M300003789 NM 144515 -3.19 -2.78 Zinc finger protein 118.

M300003810 NM 028711 -3.08 -3.77 -M300003902 NM 011500 -7.58 Striatin.

M300004221 NM 0010019 -2.25 -2.52 MegflO

M300004747 NM 145558 1.97 1.18 --M300004748 NM 145558 2.24 1.30 -M300004749 NM 178878 2.37 1.30 Hydroxyacyl-coenzyme a

M300005806 -- 2.03 1.33 -M300006675 NM 009391 2.32 1.00 GTP-binding nuclear protein ran

M300007364 NM 007438 2.26 1.33 Fructose-bisphosphate aldolase a

Dsgb 1 ,riken full-length enriched M300009336 NM 181682 -3.19 -2.98 librarv nroduct

M300009392 NM 0010332 -2.20 -2.39 -M300009674 NM 008084 2.87 1.31 Glyceraldehyde 3-phosphate

M300010220 XM 001477 1.71 1.16 Repeat family 3 gene.

M300010515 -- -1.47 -2.28 Down syndrome cell adhesion

M30001056l - -2.59 -1.86 -Table 3b: List of genes dysregulated in heart in the rirlcroarray experiments (continued). 27

id Ref Seq ApoE wt Deseription

M300011169 NM 013494 2.57 1.34 Carboxypeptidase e (epe)

M300011228 NM 019639 2.19 1.41 Ubiauitin b.

M300011417 NM 008264 -2.47 - Homeobox protein hox-a13 (hox-

M300011435 NM 010473 2.55 1.29 Histidine rich calcium binding

M300012302 XR 033501 2.36 1.26 -M300012479 XM_0014734 2.18 1.15 -M300013259 NM 008725 2.37 2.30 AnfIatrial natriuretic factor

M300013949 - 2.35 1.27 -M300014163 NM 008084 1.88 1.43 Glyceraldehyde 3-phosphate

M300015075 - -2.33 -5.55 -M300015309 XM 975992 -3.18 -2.78 Myotonic dystrophy kinase-related

M300015416 XR 031431 2.90 1.45 -M300015691 NM 023794 -2.01 -4.30 Etv5

M300016301 NM 146935 -1.72 -1.86 Olfactory receptor mor272-1.

M300016366 - 2.21 1.39 -M300016476 - 2.27 1.49 -M300016674 XR 034022 2.38 1.42 -M300016913 XR 004619 2.78 1.25 -M300017071 - -3.13 -2.54 -M300017314 - 2.21 1.31 -M300017603 NM 134229 -2.28 Vomeronasa11 receptor, el0.

M300017606 XM_0014755 2.59 1.28 -M300017648 NM 010477 2.31 1.24 60 kda heat shock protein,

M300017677 -2.15 -5.23 -M300018019 XR 034578 2.33 2.20 --M300018499 XR 033633 -1.76 -2.87 -M300018809 XR 031588 -2.61 -2.17 -M300019015 NM 177172 -1.94 -2.30 -M300019117 NM 198864 -1.63 - Slitrk3

M300019421 NM_00I0095 -3.54 -3.37 Armcx5

M300019792 NM_00I033 -2.28 -4.86 Doerl

M300019807 - 2.15 1.33 -M300019909 XR 031557 -4.86 -9.96 -M300019975 XR 030908 2.77 1.24 -

Table 3c: List of genes dysregulated in heart in the microarray experiments (continued). 28

id Ref Seq ApoE wt Description

MJOO020569 NM 177036 -1.48 -3.22 --M300020734 -- -5.59 -2.98 -MJOO020785 NM 183136 -1.58 -2.93 Spink8

M300020840 NM 146498 -3.27 -3.42 01fr490

MJOO021055 XR 030953 1.93 1.47 -MJ00021 058 XR 033211 -2.08 -3.31 -M300021383 NM 010240 2.08 2.22 Ferritin light chain 1 (ferritin 1

M300021855 - 2.20 1.30 -M300022012 NM 013721 2.37 1.40 Ribosomal protein l7a; surfeit 3.

M300022 I 80 XR 031166 1.66 1.23 -M300022324 XR 033550 2.65 1.21 --

Table 3d: List of genes dysregulated in heart in the microarray experiments (continued).

Table 3a,3b,3c: List of genes dysregulated in the heart in microarray experiments and their

fold changes in Apo E-/- and wild type animals 24 hours after experiment. First column

represents mouse operon oligo V3 id. Second column represents Ref sequence id. Third

column represents fold changes in Apo E-/- animals. Fourth column represents fold changes

in wild type animals. Fifth column represents description of the gene.

29

id RefSeq ApoE 24Hwt 5Dwt Name

M200001019 NM 011201 0.89 0.08 0.14 Ptpn1 \protein-tyrosine phosphatase

M200002810 NM 011817 1.05 0.05 0.26 Gadd45g\Growth arrest and dna-

M200003295 NM 011315 2.49 1.34 1.45 Serum amyloid a-3 protein

M200005010 NM 144865 -0.82 -0.52 -0.33 Bc020184unknown

M200006584 NM 019880 -0.65 -0.42 -0.60 Mtch1 \Mitochondrial carrier

M200012115 NM 025939 -0.64 -1.21 -0.75 Paics\Multifunctional protein

M200012164 NM 010127 0.63 0.63 0.27 Pou6fl \Pou domain, class 6,

M300000234 - 0.83 0.14 0.26 Unknown

M300000276 NM 007633 0.81 0.51 1.18 Ccne1\glls-specific cyclin e1.

M300002130 NM 009260 -0.57 -0.10 -0.32 Spnb2\Spectrin beta chain, brain

M300003643 NM 019956 0.91 0.20 0.35 Krt2-17\Keratin, type ii

M300004679 -- -1.04 -0.63 -0.97 A230078iOIrilau]known

M300005305 - 1.50 0.41 1.13 Lcn2\ Lipoca1in 2

M300005554 NM 019758 -0.77 -0.80 -0.63 Mtch2-pending\mitochondrial

M300005675 - -0.66 -0.36 . -2.39 1700030g11rik

M300006375 NM 020570 1.24 0.61 0.20 Xrcc2\DNA-repair protein xrcc2

M300010426 NM 153164 -0.63 -0.37 -0.30 Unknown

M300012476 - 1.27 0.41 0.73 Ai607873unknown

M300012513 -- 0.54 0.48 0.34 D830019j24rilau]known

M300013409 NM 023202 -0.73 -0.33 -0.33 Ndufa7\NADH dehydrogenase

M300013829 NM 025347 -0.71 -0.61 -0.71 1190001 g 19rik\yippee-like

M300014069 - -0.98 -0.59 -0.58 Unknown

M300018419 -- -0.65 -0.44 -0.54 Unknown

M300019501 -- -1.03 -0.68 -0.54 Unknown

M300019653 NM 013795 -0.98 -0.93 -0.30 Atp51\A TP synthase, h+ . . . .

Table 3d: LIst of genes dysregulated m Lung m the lUlcroarray expenments. First column

represents mouse operon oligo V3 id. Second column represents Ref sequence id. Third

column represents fold changes in Apo E-/- animals 24 hr after experinIent. Fourth and fifth

column represents fold changes in wild type animals 24 hr and 5 day after experiment,

respectively. Fifth column represents description of the gene.

30

P vaiue<O.OO5 0.5

0 t -0.5 -1

U -1.5

.!! -2 .. i' -2.5

i -3 -3.5

-4 -4.5

Con DEP ApoE-I- 24 hr

Cpe

P vaiue<O.05

Con DEP Con DEP wt24hr wt5 day

Fig 4: delta Ct of each mice of different experiments in heart for Cpe gene.

Ferritin light chain 1

P vaiue<O.05 P vaiue<O.05 P vaiue<O.05 3

2 J.. " 1 ! 1. ....

~ 0 S -.. -1 i'

-2 1 -3

-4

Con DEP Con DEP Con DEP ApoE-I- 24 hr wt24hr wt5 day

Fig 5: delta Ct of each mice of different experiments in heart for ferritin light chain 1 gene.

31

Txnip

3 - P value<O.OO5 P value<O.OO5 P value<O.05

2 ,. 1

0 -... U -1 ~ i -2

-3

-4 l -5

-6

Can DEP Can DEP Can DEP ApoE-I- 24 hr wt24hr wt5 day

Fig 6: delta Ct of each mice of different experiments in heart for Txnip gene.

Con DEP Can DEP Can DEP ApoE-I- 24 hr wt 24 hr wt 5 day

Fig 7: delta Ct of each mice of different experiments in heart for Echl gene.

32

Vldlr

P value<O.OO5 P value<O.05 0

! -1 J -2 ....

... r u

i -3

'i' -4

-5

~ -6

Con DEP Con DEP Con DEP ApoE-I- 24 hr wt24hr wt5 day

Fig 8: delta Ct of each mice of different experiments in heart for Vldlr gene.

tl ;§ Q

"CI I

3 2 1 0

-1 -2 --3 -4-

-5 -6 -

P value<O.05

\

1

8AA3

P value<O.05

! -1

Con DEP Con DEP Con DEP ApoE-I- 24 hr wt 24 hr wt 5 day

Fig 9: delta Ct of each mouse of different experiments in lung for 8AA3 gene.

33

ApoE(--I--) mice 24 hrs after DEP exposure

6 ,--------------------------------, .. ~ 5 -~--I-----------------------~~----------~ '" -= '" 4

::s! .£ 3 N

" ~ 2 ..c ~ 1 ..l

o +-'--Echl

Fig lOa

Cpe Ferritin Txnip Vdlr light

chain I

wt mice 24 hr after diesel exposure

o Real time PCR

• microarray

6 .-----------------------------------. " ~ 5 +-----------------------------------------~ '" -= '" 4 t-------------------------------------rd----------,I '0 0 Real time PCR ~3 1-----------------------------------------I N

~ 2 +---------------------'" ..c 01) I ..:

o +-'--Echl

Fig lOb

Cpe Ferritin Txnip light chain

I

Vdlr

Fig 10: Comparison of fold changes of various genes in Apo E-I-(Fig lOa) and wi ld type

mice(Fig lOb), 24 hours after DEP exposure in microarray and real time PCR experiments

in heart.

34

8

7 " OJ) c 6 " ..c " 5

't:l

~ 4 " '" " 3 .c

~2 ..=!

1

0

Upregulation in SAA3 in lung

Apo 24 hr wt 24 hr wt 5day

o Real time PCR

• micro array

Fig II: Comparison of fo ld changes of SAA3 in Apo E-/- mice, 24 hours after DEP

exposure and wild type mice, 24 hours and 5 days after DEP exposure, in microarray and

real time peR experiments in lung.

35

Animal Ech Cpe Ferritin Txnip Vldlr SAA3

Con ApoE 24 Hr 1 3.1 3.14 3. 18 5. 16 5.04 2.47

2 3.9 3.82 1.70 3.98 4.67 5.02

3 2.6 2.77 3.08 4.90 5.66 3.06

DEP ApoE 24 Hr I - -0.53 -0.83 -0.62 -0.50 -1.33

2 3.2 3.24 2.65 4.68 5.12 3.52 , - 0.32 -0.72 -0.28 1.63 -2.37 .)

Con wt 24 hr I - 0.49 -0.5 7 -0.30 2.01 -1.91

2 - -0.26 -0.81 -0.29 1.88 -1.62

3 - -0.39 -0.1 2 -0.01 -0.19 -0.38

DEP wt 24 hr I - 0.18 -0.70 -0.29 1.84 -1.97

2 - 2.20 -0.19 0.63 2.40 2.88

3 - 1.77 -0.60 0.42 3.23 5.51

Con wt 5 day I - 1.78 -0.26 0.53 2.8 1 4.18

2 - -0.24 -0.22 -0.11 -0.41 -1.32

3 - 1.92 -0.35 0.53 2.81 4.19

DEP wt 5 day I - 1.42 -1 .32 -1.93 1.71 0.25

2 - 1.62 -1.76 - 1.54 1.82 -0.84

3 - 1.1 5 -1.54 -1.74 1.77 -0.9 1

Table 4 : Delta Ct of each animal for each gene in different experiments.

36

Immunohistochemistry of Cpe protein:

" ....... . .. J...i.l ~

4"" ~ .. "" .. ' . Apo EIi·)DEP ~.-f '~ ( ~ .. . " ,"

Fig 12: Immunohistochemisry of heart tissue sections with antibody against Cpe. The

sect ions were obtained from Apo E(-I-) mice or wi ld type mice, sacrificed 24 hr after DEP

or sali ne exposure. Fig l3a is a section from wild type mice exposed (0 saline. Fig 13b is a

section from wild type mice exposed to DEP. Fig l3c is a section from ApoE(-I-) mice

exposed to saline. Fig \3d is a section from Apo E(-I-) mice exposed to DEP. The arrows

point towards capi ll aries. The dark area pointed by the arrow in (he Fig l 3d indicates

localization of Cpe in the capi llaries.

37

Chapter 4: Discussion

Exposure to diesel, carbon black, PM and UFP induces oxidative stTess and production of

reactive oxygen species(ROS). Oxidative stTess increases the expression of genes for

cytokines, chemokines, and other proinflammatory mediators by mediating activation of

specific transcription factors like nuclear factor-kappa B and activator protein-l 36 DEP can

also induce apoptosis or necrosis of respiratory epithelial ce lls and macrophages. This is

due to the oxidant effects of DEP on mitochondria37. As a result, the host defenses to

respiratory infection decreases37 Sensory neurons are stimulated when they come in contact

with irritant particles like PM present in diesel, releasing several neuropeptides. These

neuropeptides can act on epithelial cells, smooth muscle cells and immune cells. This

initiates a host of airway inflammatory events, including vasodi latation, mucus secretion

and release of cytokines38 lnterleukin 8 is known to promote inflammation due to DEP

exposure39 TNF-alpha is known to regulate expression ofEch l4o, IL 841.

Progression of atherosclerosis due to DEP exposure can occur via a number of mechanisms

that involve enhanced formation of foam cells, recruitment of monocytes into the arterial

wall, stimulation of prothrombotic ti ssue factors, decreased NO synthase activity, and

expression of adhesion molecules42 The possible mechanisms linking PM with

cardiovascular disease is shown below.

38

Pulmonary Reflexes

Autonomic Nervoul

Heart Rate Rhythm

Arrhythmia

Progression and Plaque Instabllllt!v.l

Plaque Rupture

• Myocardial Infarction

Fig 13: Possible biological mechanisms linking PM with cardiovascular disease.Col

Aminopeptidase 0 was also found to be down regulated by DEP exposure in the present

study. Aminopeptidase 0 is involved in Angiotensin III formation, which is one of the main

effector peptides of the brain renjn-angiotensin system (RAS) responsible for rise in blood

pressure43 Interestingly epidemiological studies have shown to cause rise in blood pressure

due to DEP exposures' Thus down regulation of Aminopeptidase 0 maybe a compensatory

mechanism to prevent rise in blood pressure.

ANF or ANF (Atrial Naturetic Factor) is a marker for heart failure. It is expressed as a

response to increased blood pressure to reduce blood pressure by promoting

vasorelaxation44 Cpe, or carboxypeptidase E, is a pro-hormone and neuropeptide processor

that can process atrial natriuretic factor (ANF) and other regulatory peptides and is

39

supposed to be involved in synthesis of Atrial Naturetic Factor45• ANF-(1-128) is later

cleaved in situ by carboxypeptidase E to generate ANF-(1-126)46. Cpe(-I-) null mice are

obese and diabetic47• Cpe was found to be upregulated in mice upon exposure to tobacco

smoke 29. Mutations in Cpe gene has been shown to increase severity of coronary

atherosclerosis in humans and the frequency distribution of this mutation is different in

smokers compared to normal population48• Studies have shown PM exposure causes

increased cardiac ischemia and arrhythmias, increased blood pressure, decreased heart rate

variability, and increased circulating markers of inflammation and thrombosis8• DEP

exposure caused significant decrease of heart mte and blood pressure after 24 hours in mts

due to probable production of reactive oxygen species(ROS) 49. Thus it can be proposed

that DEP exposure leads to production of reactive species and increase of blood pressure,

which in turn leads to increased expression ofCpe, as observed io this study. This leads to

increased processing of pre-pro ANF peptide, which decreases blood pressure (Fig 14).

Comt(Catechol-O-methyl tmnsferase) and Mdpk (myotonic dystrophy protein kioase) were

also found up regulated in the present study due to DEP exposure in heart. Oxidative stress

leads to angiotensin II-dependent stimulation of sympathetic nervous system leadiog to

increased catecholamine production and blood pressure50• Comt is responsible for

inactivation of catecholamines which iocreases heart mte, blood pressure during stressS1•

Comt is thought to be involved io vasoregulation as a Comt iohibitor has been reported to

increase blood pressure dose-dependentIY2. Overexpression of human Mdpk causes

hypertrophic cardiomyopathy, myotonic myopathy and hypotension traits of myotonic

dystrophy 53. Interesting\y genes iovolved io heart contmction like Mybpc3(Myosio-binding

protein C, cardiac-type), Ttn (titin), Hrc(histidine rich calcium binding protein) and

40

Calsequestrin were also up regulated in the present study due to DEP exposure in heart. Up

regulation of Calsequestrin can lead to cardiac hypertrophy and decreased contractility54.

Almnopeplldi:lse ct ...

R . An·lt . th ..........

emn 910 ensln pa way ....

1 ~""?"::""" catecholamine production ...... : ....

1 I COM~~~-:~~~DEPEXPOSURE Rise in BIrd pressure .. - - - -

Pre Pro (ANF) (transcript)i Cpe(transcript) i

I Cpe(peptide)

Pre Pr (ANF)(pePtide) -.. ANF

1 blood pressure falls

(naturesis)

Fig 14: Proposed compensatory mechanism to regulate hypertensive effects ofDEP

exposure. Genes in red and green have been found to be up regulated and down regulated

respectively, in the microarray experiments in Apo E mice sacrificed 24 hour after DEP

exposure. The dashed lines indicate unknown mechanisms.

ECHl is involved in peroxisomal beta-oxidation". ROS is generated by activation of the

membrane-bound NAD(P)H oxidase. Ech 1 is down regulated in gp91phox-I-, p47phox-l-

mice, which lack a NAD(P)H oxidase components. ApoE(-I-) mice have higher levels of

aortic ROS production and more atherosclerosis than ApoE-I-1 p47phox-l-mices6• Thus it

41

can be proposed that oxidative stress due to DEP exposure of Apo E( -1-) leads to activation

ofNAD(p)H oxidase and thus increased ROS production and Echl expression. ROS

production enhances atherosclerosis by several mechanisms. Thus it can be proposed that

Echl up regulation has a direct relationship with ROS production and increased

atherosclerosis in Apo E( -1-) exposed to hypercholesterolemia

Ferritin uptakes intracellular iron that is released by free radical species, and this enables

ferritin to prevent endothelial damage from ox_LDLs7• Ferritin increases myocardial

infarction more when coexisting with elevated LDL concentrationS8• Elevated serom

ferritins have been found in patients with serious atherosclerotic sequelaeS7• This may

reflect excessive vascular wall iron content which in turn, may cause vascular inflammatory

damage, mediated by oxidant-producing phagocytesS9• Large amounts of immunoreactive

ferritin are detected in atherosclerotic lesions, specifically in the myofibroblasts,

macrophages, and endotheliums7• Thus it can be concluded that oxidative stress in ApoE-I­

mice as a result ofDEP exposure can cause free radical species to be released and thus

oxidation of LDL. This causes increased ferritin expression for protection against

endothelial damage from ox-LDL.

Txnip or thioredoxin interacting protein is an inhibitor ofthioredoxin, an antioxidant60• Thus

it can be proposed that DEP exposure cases oxidative stress leading to up regulation of

Txnip expression and thus suppression of thioredoxin activity leading to pro-apoptotic and

pro-inflammatory effects. Thus Txnip is a novel biomechanical effector of atherosclerosis.

VLDLR or very low density lipoprotein receptor, may be involved in the formation of both

Smooth Muscle Cell and macrophage derived foam cells, which are a marker for onset of

atherosclerosis61• VLDLR mRNAs were highly induced in atherosclerotic lesions61

• Thus it

42

can be concluded DEP exposure leads can lead to induction ofVldlr expression, and thus

increased atherosclerosis.

i i ~l;»::I~r~;ati:l::~:::: ;E;t-osufe - - - - - ::; ~I- -1xnipt I I .................. I

Racl'· ..... + I I? , ...... O'xidativ str Nrfl ti ·d t path I Echl'+o·- - - "'NAD(P)H oxi~L -:! _ ..... e _ ~.::-t.. tn OXII an WjY

I glycolytic enzymes Uke + +, + I Aida 1 Gapd Pfkm free radical production Ferritin' GP.x3, Thioredoxin

~ I I I , , ,

.I. I Pgam2, Pdhal I I

TCA cycle enzymes & respiratory chain enzymes like Odgh, Ndufvl, Cyc 1,Sdh

0» dation of LDL antioxidation

l VLDr'

U plake of ox-LdL

by mrOPhages and SMC

Foam ceDs formation

ll---------' Apoptosis and endothelial damage, Enhanced atherosclerosis

Fig 15: Proposed mechanism of enhanced atherosclerosis due to DEP exposure. Genes in

red have been found to be up regulated in the microarray experiments in Apo E -/- mice

sacrificed 24 hour after DEP exposure. The dashed lines indicate unknown mechanisms.

The study helps to propose a mechanism by which enhanced atherosclerosis occurs under

hypercholesterolemia, due to DEP exposure (Fig 15). DEP exposure is known to cause

oxidative stress and production of reactive oxygen species and free radicals. DEP exposure

can be predicted to cause peroxisomal proliferation as it has been proposed to be biomarker

for environmental pollution such as exposures to phthalate ester plasticizers, P AHs and oil

43

derivatives, PCBs, certain pesticides, bleached kraft pulp and paper mill effluents, alkyl

phenols and estrogens62• Furthennore peroxisomal proliferation causes persistent oxidative

stress63• Echl has been shown to be induced during peroxisomal proliferationss and after

DEP exposure in the present study. Echl may also effect NADPH oxidaseS6 ,which can

cause increased ROS production. Rae I can mediate NADPH oxidase activation64 and thus

mediate superoxide fonnation. Rael have been found to be upregulated in the present study

due to DEP exposure in heart. Hypercholesterolemia causes Rae to mediate increased

NADPH-derived superoxide production in mice hearts6s• Oxygen species (ROS)-dependent

hyperoxia is thought to induce Phosphoinositide-3-kinase (pI3K)lAkt signaling via NADPH

oxidase66• This pathway in turn may promote cell survival by mediating Nrt2 activation 66.

NADPH oxidase activity is also thought to be involved in the regulation ofNrt2

signalling67• Interestingly Akt was up regulated in ApoE -1-, DEP exposed mice in the

study. Akt is known to prevent apoptosis and thus its up regulation can be proposed to

reduce endothelial damage due to DEP exposure. Nuclear factor erythroid 2-related factor

(Nrt2) activation protects against cell death, induced by oxidative stress and other pro

apoptotic stimuli66• Nrt2 pathway activation starts by Nrt2 translocation and transcription of

genes with ARE (antioxidant response element) like thioredoxin, and ferritin light chain,

that help in anti oxidation 68,69. The present study also shows Gpx3 (glutathione

peroxidase3), an antioxidant to be upregulated due to DEP exposure in heart. Gpx3 is

thought to playa role in the protection of cardiomyocytes from oxidative stress70. Thus Nrt2

can also be predicted to induce Gpx3 transcription as Gpx3 has an ARE and Nrt2 is known

to induce Gpx2 expression, which is another isofonn of GpX70,71. However Txnip inhibits

antioxidation via thioredoxin by binding to the reduced state of thioredoxin and thus

44

preventing it from reducing oxidized proteins like oxidized LDL formed due to oxidative

stress60• Txnip was also up regulated in ApoE -f-, DEP exposed mice. Ferritin is known to

sequester iron and thus prevents iron from catalyzing reactions that result in free radical

formation57• The ROS produced can oxidize LDL to form oxidized LDL which is up taken

by macrophages and smooth muscle cells through the receptor VLDLR61. These cells are

not able to metabolize oxidized LDL, which keeps on accumulating in these cells, resulting

in formation of foam cells, which is the hallmark of onset of atherosclerosis 72.

Several glycolytic enzymes like AIdo1(AIdolase 1), Gapd(Glyceraldehyde 3-phospho

dehydrogenase), Pfkm (Phosphofructokinase), Pgam2 (Phosphoglycerate mutase 2) ,

Pdhal (Pyruvate dehydrogenase alpha I ) were over expressed due to diesel exposure. This

probably is a protective mechanism to reduce ROS production73• AIdo I was also found to

be upregulated by DEP exposure in human macrophage cell culture74•

Up regulation ofTCA cycle enzymes like Odgh(oxoglutarate dehydrogenase) and

respiratory chain enzymes like Ndufvl(NADH dehydrogenase), Cyc I (cytochrome c1) and

Succinate dehydrogenase, was also observed. These enzymes facilitate ofROS

production75,76,77,78.

Several enzymes involved in fatty acid metabolism like Ech l,Acaa 2(acetyl-coenzyme a

acyltransferase2), Hadha( dehydrogenase coenzyme a hydroxyacyl),Phyh (phytanoyl coa

dioxygenase), Got2 (Aspartate Aminotransferase) were upregulated in heart upon DEP

exposure in the present study. Aquatic pollution exacerbates these fatty acid catabolic

pathways in shrimp, possibly due to increase in the energy needs.79•

Serum amyloid A3(SAA3) and Lipoca1in 2(Lcn 2) was over expressed and A TP synthase

was under expressed in the lungs of mice with lung injury, induced by intratracheal injection

45

oflipopolysacchmideso• ATP synthase and Lcn2 were also under expressed and over

expressed respectively, in lungs of mice exposed to DEP, in the present study. Serum

amyloid A3 is an acute-phase protein (APP) gene whose expression increases in response to

inflammatory stimuli in vivoS1• SAA3 is associated with systemic inflammation due to

bronchial asthma prevalence82. Up regulation ofSAA3 was observed during ovalbumin

induced airway inflamrnation83• Thus it can be proposed that inflammation due to DEP

exposure leads to up regulation of SAA3 and Lcn2 and down regulation of A TP synthase,

which leads to l:ung injury.

Gadd45g(growth arrest, dna-damage inducible gene) and Xrcc2 (DNA repair protein) were

found up regulated by DEP exposure in lung. Gadd45 is known to mediate apoptosis during

environmental stress or exposure to DNA damage inducing agents84,ss. Xrcc2is however

involved in DNA repairS6•

This it can be summarized that this study showed increased response of ApoE -/- mice to

DEP exposure compared to wild type after 24 hours ofDEP exposure and reaches almost

norma1levels after 5 days in wild type mice, in terms of fold changes of some key genes

involved in cardiovascular diseases, oxidative stress, vasoregu1ation and atherosclerosis in

heart. In the lung, the genes related to inflammation and lung injury were particularly

dysregulated in ApoE -/- mice. This validates the hypothesis that hypercholesterolemia

exacerbates effects of DEP. Thus the study successfully illustrates the key genes involved in

the pathology of cardiac and pulmonary disorders due to acute exposure of DEP under

hypercholesterolemia conditions, which may become targets for future means of preventive

strategies.

46

Interactions Experimental system Reference Aminopeptidase 0, Renin Human heart,brain,testis ~,

angiotensin system Comt,chatecolamines Rat kidney " Comt, vasoregulation Humans " ANF,vasoreguiation endothelial cell line, CPA47 Cpe,ANF Rat heart, mt atrial granules 4'" , Peroxisomal prolifemtion, mussels

., aquatic pollution Peroxisomal prolifemtion, Liver cells ru

oxidative stress Peroxisomal Rat liver " prolifemtion,Ech 1 NADPH oxidase,Echl Vascular smooth muscle cells ,. NADPH oxidase,RAC Yeast two-hybrid system

.,. NADPH oxidase,Akt,Nrf2 murine pulmonary epithelial cell line, 00

CIO. Nrf2, thioredoxin human neuroblastoma cells •• Nrf2,ferritin Mouse spleen

., Oxidative stress,Gpx3 Mouse heart IU

Nrf2,Gpx2 Mice lungs II

Thioredoxin, Txnip Yeast two-hybrid system ou

Ferritin, atherosclerosis Human patients " Glycolytic enzymes, Cultured rat thymocytes " reduced ROS production TCA and mitochondrial Bovine hearts

,.

enzymes like NADH dehydrogenase,ROS production Oxidized LDL, VLDLR Rabbit aortic intima-medias .1

Table 5: List of references for the intemctions shown in figure 14 and 15.

47

Limitations of the study:

Limitation of the simple instillation model:

Instillation is a less physiological method of exposure than inhalation, and particles

administered by instillation are not likely to deposit in a manner similar to that of an

aerosol. After instillation, particles are increasingly deposited in the basal regions of the

lung. Particle distribution is significantly less homogeneous in lung after an instillation than

after an inhalation exposure30•

Limitation of microarray experiments

However analysis of microarray data is non trivial because of the large data size and many

levels of variation introduced at different stages of the experiments such as RNA

amplification and labeling, hybridization and wash, and slide scanning87• The increasing

use of microarrays in biomedical research, toxicogenomics, pharmaceutical development,

and diagnostics has focused attention on the reproducibility and reliability of microarray

experiments. RNA labeling is thought to be largest contributor to inter laboratory variation.

While some sources of variation have measurable influence on individual microarray

signals, they have negligible influence on sample-to-reference ratios when averaged over

number of experiments88•

48

Bibliography

1. Monforton CA. Industry attacks on science. Am J Public Health. Jul

2002;92(7): 1 052; author reply 1052.

2. Davis ME, BHcharz AP, Hart JE, et al. Occupational exposure to volatile organic

compounds and aldehydes in the U.S. trucking industry. Environ Sci Techno!. Oct 15

2007;41 (20):7152-7158.

3. Krivoshto IN, Richards JR, Albertson TE, et al. The toxicity of diesel exhaust:

implications for primary care. JAm Board Fam Med. Jan-Feb 2008;21(1):55-62.

4. Bateson TF, Schwartz J. Children's response to air pollutants. J Toxicol Environ

Health A. 2008;71(3):238-243.

5. Pope CA, 3rd, Burnett RT, Thun MJ, et al. Lung cancer, cardiopulmonary mortality,

and long-term exposure to fine particulate air pollution. Jama. Mar 6

2002;287(9): 1132-1141.

6. Goldberg MS, Burnett RT, Bailar JC, 3rd, et al. Identification of persons with

cardiorespiratory conditions who are at risk of dying from the acute effects of

ambient air particles. Environ Health Perspect. Aug 2001;109 SuppI4:487-494.

7. Kinney PL, Aggarwal M, Northridge ME, et al. Airborne concentrations ofPM(2.5)

and diesel exhaust particles on Harlem sidewalks: a community-based pilot study.

Environ Health Perspect. Mar 2000; 108(3):213-218.

8. Delfino RJ, Sioutas C, Malik S. Potential role ofultrafine particles in associations

between airborne particle mass and cardiovascular health. Environ Health Perspect.

Aug 2005; 113(8):934-946.

49

9. Duffin R, Mills NL, Donaldson K. Nanoparticles-a thoracic toxicology perspective.

Yonsei MedJ. Aug 312007;48(4):561-572.

10. Brook RD, Franklin B, Cascio W, et aI. Air pollution and cardiovascular disease: a

statement for healthcare professionals from the Expert Panel on Population and

Prevention Science of the American Heart Association. Circulation. Jun 1

2004; 1 09(21 ):2655-2671.

11. Daigle CC, Chalupa DC, Gibb FR, et aI. Ultrafine particle deposition in humans

during rest and exercise. Inhal Toxieol. May 2003;15(6):539-552.

12. Oberdorster G, Sharp Z, Atudorei V, et aI. Extrapulmonary translocation ofultrafine

carbon particles following whole-body inhalation exposure of mts. J Toxieol Environ

HealthA. Oct 25 2002;65(20):1531-1543.

13. Ball JC, Straccia AM, Young WC, et aI. The formation of reactive oxygen species

catalyzed by neutral, aqueous extracts ofNlST ambient particulate matter and diesel

engine particles. J Air Waste Manag Assoc. Nov 2000;50(11):1897-1903.

14. Huggins FE, Huffman GP, Robertson ID. Speciation of elements in NIST particulate

matter SRMs 1648 and 1650. J Hazard Mater. May 29 2000;74(1-2):1-23.

15. Katsouyanni K. Touloumi G, Samoli E, et aI. Confounding and effect modification

in the short-term effects of ambient particles on total morta1ity: results from 29

European cities within the APHEA2 project. Epidemiology. Sep 2001;12(5):521-

531.

16. Dockery DW. Epidemiologic evidence of cardiovascular effects of particulate air

pollution. Environ Health Perspeet. Aug 2001;109 SuppI4:483-486.

50

17. Frampton MW. Systemic and cardiovascular effects of airway injury and

inflammation: ultrafine particle exposure in humans. Environ Health Perspect. Aug

2001;109 SuppI4:529-532.

18. Risom L, Moller P, Loft S. Oxidative stress-induced DNA damage by particulate air

pollution. Mutat Res. Dec 30 2005;592(1-2):119-137.

19. Iwai K, Adachi S, Takahashi M, et at. Early oxidative DNA damages and late

development oflung cancer in diesel exhaust-exposed rats. Environ Res. Nov

2000;84(3):255-264.

20. Mauderly JL, Snipes MB, Barr EB, et al. Pulmonary toxicity of inhaled diesel

exhaust and carbon black in chronically exposed rats. Part I: Neoplastic and

nonneoplastic lung lesions. Res Rep Health E./flnst. Oct 1994(68 Pt 1):1-75;

discussion 77-97.

21. Ichinose T, Yajima Y, NagashimaM, et al. Lung carcinogenesis and formationof8-

hydroxy-deoxyguanosine in mice by diesel exhaust particles. Carcinogenesis. Jan

1997;18(1):185-192.

22. Sato H, Sone H, Sagai M, et al. Increase in mutation frequency in lung of Big Blue

rat by exposure to diesel exhaust Carcinogenesis. Apr 2000;21(4):653-661.

23. Han JY, Takeshita K, Utsumi H. Noninvasive detection of hydroxyl radical

generation in lung by diesel exhaust particles. Free Radic Bioi Med. Mar 1

2001;30(5):516-525.

24. Borm PJ, Kreyling W. Toxicological hazards of inhaled nanoparticles-potential

implications for drug delivery. J Nanosci Nanotechnol. May 2004;4(5):521-531.

51

25. Knight-Lozano CA, Young CG, Burow DL, et al. Cigarette smoke exposure and

hypercholesterolemia increase mitochondrial damage in cardiovascular tissues.

Circulation. Feb 192002;105(7):849-854.

26. Sun Q, Wang A, Jin X, et al. Long-term air pollution exposure and acceleration of

atherosclerosis and vascular inflammation in an animal model. Jama. Dec 21

2005;294(23):3003-3010.

27. Yanagisawa R, Takano H, Inoue K, et al. Complementary DNA microarray analysis

in acute lung injury induced by lipopolysaccharide and diesel exhaust particles. Exp

BioI Med (Maywood). Nov 2004;229(10):1081-1087.

28. Chettab K, Zibara K, Belaiba SR, et al. Acute hyperglycaemia induces changes in

the transcription levels of 4 major genes in human endothelial cells: macro arrays­

based expression analysis. Thromb Haemost. Jan 2002;87(1): 141-148.

29. Maresh JG, Xu H, Jiang N, et al. Tobacco smoke dysregulates endothelial

vasoregulatorytranscripts in vivo. Physiol Genomics. May 112005;21(3):308-313.

30. Osier M, Baggs RB, Oberdorster G. Intratracheal instillation versus intratracheal

inhalation: influence of cytokines on inflammatory response. Environ Health

Perspect. Sep 1997;105 SuppIS:1265-1271.

31. Oberdorster G, Cox C, Gelein R. Intratracheal instillation versus intratracheal­

inhalation of tracer particles for measuring lung clearance function. Exp Lung Res.

Jan-Feb 1997;23(1):17-34.

32. Heller RA, Schena M, Chai A, et al. Discovery and analysis of inflammatory

disease-related genes using cDNA microarrays. Proc Natl A cad Sci USA. Mar 18

1997;94(6):2150-2155.

52

33. Breslow JL. Mouse models of atherosclerosis. Science. May 3 1996;272(5262):685-

688.

34. Nakashima Y, Plump AS, Raines EW, et al. ApoE-deficient mice develop lesions of

all phases of atherosclerosis throughout the arterial tree. Arterioscler Thromb. Jan

1994;14(1): 133-140.

35. Dhanvantari S, Arnaoutova I, Snell CR, et al. Carboxypeptidase E, a prohormone

sorting receptor, is anchored to secretory granules via a C-termina1 transmembrane

insertion. Biochemistry. Jan 8 2002;41 (1 ):52-60.

36. Shukla A, Timblin C, BeruBe K, et al. Inhaled particulate matter causes expression

of nuclear factor (NF)-kappaB-related genes and oxidant-dependent NF-kappaB

activation in vitro. Am J Respir Cell Mol Bioi. Aug 2000;23(2): 182-187.

37. Li N, Sioutas C, Cho A, et al. Ultrafine particulate pollutants induce oxidative stress

and mitochondrial damage. Environ Health Perspect. Apr 2003;111(4):455-460.

38. Veronesi B, Oortgiesen M, Roy J, et al. Vanilloid (capsaicin) receptors influence

inflanunatory sensitivity in response to particulate matter. Toxicol Appl Pharmacol.

Nov 15 2000;169(1):66-76.

39. Salvi SS, Nordenha1l C, Blomberg A, et al. Acute exposure to diesel exhaust

increases IL-8 and ORO-alpha production in healthy human airways. Am J Respir

Crit Care Med. Feb 2000;161(2 Pt 1):550-557.

40. Beier K, Volkl A, Fahimi lID. Suppression of peroxisomal lipid beta-oxidation

enzymes ofTNF-alpha. FEBS Lett. Oct 51992;310(3):273-276.

41. Grund EM, Kagan D, Tran CA, et al. TNF-{alpha} REOULATES

INFLAMMATORY AND MESENCHYMAL RESPONSES VIA MEK, p38, NF-

53

{kappa}B IN HUMAN ENDOMETRIOTIC EPITHELIAL CELLS. Mol

Pharmacal. Feb 5 2008.

42. Bhatt DL, Topol EJ. Need to test the arterial inflammation hypothesis. Circulation.

Jul22002;106(1):136-140.

43. Diaz-Pera1es A, Quesada V, Sanchez LM, et aI. Identification of human

aminopeptidase 0, a novel metalloprotease with structural similarity to

aminopeptidase B and leukotriene A4 hydrolase. J Bioi Chern. Apr 8

2005;280(14):14310-14317.

44. Frost SJ, Whitson PA. Characterization of atrial natriuretic peptide degradation by

cell-surface peptidase activity on endothelial cells. J Cell Biochern. Jun

1993;52(2):227-236.

45. Lynch DR., Venable JC, Snyder SH. Enkephalin convertase in the heart: similar

disposition to atrial natriuretic factor. Endocrinology. Jun 1988;122(6):2683-2691.

46. Thibault G, Lazure C, Chretien M, et aI. Molecular heterogeneity of pro-atrial

natriuretic factor. J Bioi Chern. Nov 5 1989;264(31): 18796-18802.

47. Friis-Hansen L, Lacourse KA, Samuelson LC, et aI. Attenuated processing of

proglucagon and glucagon-like peptide-l in carboxypeptidase E-deficient mice. J

Endocrinol. Jun 2001; 169(3):595-602.

48. Jia EZ, Wang J, Yang ZJ, et aI. Association of the mutation for the human

carboxypeptidase E gene exon 4 with the severity of coronary artery atherosclerosis.

Mol Bioi Rep. Dec 16 2007.

54

49. Nemmar A, Al-Maskari S, Ali BH, et al. Cardiovascular and lung inflammatory

effects induced by systemically administered diesel exhaust particles in rats. Am J

Physiol Lung Cell Mol Physiol. Mar 2007;292(3):L664-670.

50. Campese VM, Shaohua Y, Huiquin Z. Oxidative stress mediates angiotensin 1I­

dependent stimulation of sympathetic nerve activity. Hypertension. Sep

2005;46(3):533-539.

51. Kajimoto K. Hiura Y, Sumiya T, et al. Exclusion of the catechol-o-methyltransferase

gene from genes contributing to salt-sensitive hypertension in dahl salt-sensitive rats.

Hypertens Res. May 2007;30(5):459-467.

52. Jordan J, Lipp A, Tank J, et al. Catechol-o-methyltransferase and blood pressure in

humans. Circulation. Jul23 2002; 1 06(4):460-465.

53. O'Cochlain DF, Perez-Terzic C, Reyes S, et al. Transgenic overexpression of human

DMPK accumulates into hypertrophic cardiomyopathy, myotonic myopathy and

hypotension traits of myotonic dystrophy. Hum Mol Genet. Oct 15

2004; 13(20):2505-2518.

54. Maass A, Leinwand LA. A role for calreticulin in the adult heart? J Clin Invest. May

2001 ;107(1 0):1223-1225.

55. FitzPatrick DR, Germain-Lee E, Valle D. Isolation and characterization of rat and

human cDNAs encoding a novel putative peroxisomal enoyl-CoA hydratase.

Genomies. Jun 10 1995;27(3):457-466.

56. Vendrov AE, Madamanchi NR, Hakim ZS, et al. Thrombin and NAD(P)H oxidase­

mediated regulation ofCD44 and BMP4-Id pathway in VSMC, restenosis, and

atherosclerosis. Cire Res. May 26 2006;98(10):1254-1263.

55

57. Juckett MB, Balla J, Balla G, et al. Ferritin protects endothelial cells from oxidized

low density lipoprotein in vitro. Am J Pathol. Sep 1995; 147(3):782-789.

58. Salonen JT, Nyyssonen K, Korpela H, et al. High stored iron levels are associated

with excess risk of myocardial infarction in eastern Finnish men. Circulation. Sep

1992;86(3):803-811.

59. Smith C, Mitchinson MJ, Aruoma 01, et al. Stimulation oflipid peroxidation and

hydroxyl-radical genemtion by the contents of human atherosclerotic lesions.

BiochemJ. Sep 151992;286 (Pt 3):901-905.

60. World CJ, Yamawaki H, Berk BC. Thioredoxin in the cardiovascular system.J Mol

Med Dec 2006;84(12):997-1003.

61. Hiltunen TP, Luoma JS, Nikkari T, et al. Expression ofLDL receptor, VLDL

receptor, LDL receptor-related protein, and scavenger receptor in mbbit

atherosclerotic lesions: marked induction of scavenger receptor and VLDL receptor

expression during lesion development. Circulation. Mar 24 1998;97(11): 1 079-1 086.

62. Cajamville MP, Cancio I, !babe A, et al. Peroxisome proliferation as a biomarker in

environmental pollution assessment. Microsc Res Tech Jun 1 2003;61(2):191-202.

63. Rao MS, Reddy JK. An overview of peroxisome prolifemtor-induced

hepatocarcinogenesis. Environ Health Perspect. Jun 1991;93:205-209.

64. Dorseuil 0, Reibel L, Bokoch GM, et al. The Rae target NADPH oxidase p67phox

interacts preferentially with Rac2 mther than Rael. J Bioi Chem. Jan 5

1996;271 (1 ):83-88.

56

65. Gregg D, Rauscher FM, Goldschmidt-Clermont PJ. Rae regulates cardiovascular

superoxide through diverse molecular interactions: more than a binary GTP switch.

Am J Physiol Cell Physiol. Oct 2003;285(4):C723-734.

66. Papaiahgari S, Zhang Q, Kleeberger SR., et aI. Hyperoxia stimulates an Nrt2-ARE

transcriptional response via ROS-EGFR-PI3K-AktlERK MAP kinase signaling in

pulmonary epithelial cells. Antioxid Redox Signal. Jan-Feb 2006;8(1-2):43-52.

67. Sekhar KR, Crooks PA, SonarVN, et aI. NADPH oxidase activity is essential for

KeapllNrt2-mediated induction ofGCLC in response to 2-indol-3-yl­

methylenequinuclidin-3-0Is. Cancer Res. Sep 1 2003;63(17):5636-5645.

68. Nakaso K, Yano H, Fukuhara Y, et aI. PI3K is a key molecule in the Nrt2-mediated

regulation of antioxidative proteins by hemin in human neuroblastoma cells. FEBS

Lett. JuliO 2003;546(2-3):181-184.

69. Lee JM, Chan K, Kan yw, et aI. Targeted disruption ofNrt2 causes regenerative

immune-mediated hemolytic anemia. Proc Natl Acad Sci USA. Jun 29

2004;101(26):9751-9756.

70. Iwata K, Nishinaka T, Matsuno K, et aI. Increased gene expression of glutathione

peroxidase-3 in diabetic mouse heart. BioI Pharm Bull. May 2006;29(5):1042-1045.

71. Singh A, Rangasarny T, Thimmulappa RK, et aI. Glutathione peroxidase 2, the

major cigarette smoke-inducible isoform of GPX in lungs, is regulated by Nrt2. Am

J Respir Cell Mol BioI. Dec 2006;35(6):639-650.

72. Kita T, Kume N, Minami M, et aI. Role of oxidized LDL in atherosclerosis. Ann N Y

Acad Sci. Dec 2001;947:199-205; discussion 205-196.

57

73. Hamm-KunzeImann B, Schafer D, Weigert C, et al. Redox-regulated expression of

glycolytic enzymes in resting and proliferating rat thymocytes. FEBS Lett. Feb 10

1997;403(1):87-90.

74. Verheyen OR, Nuijten JM, Van Hummelen P, et al. Microarray analysis of the effect

of diesel exhaust particles on in vitro cultured macrophages. Toxicol In Vitro. Jun

2004; 18(3):377-391.

75. Tretter L, Adam-Vizi V. Alpha-ketoglutarate dehydrogenase: a target and generator

of oxidative stress. Phi/os Trans R Soc Land B Bioi Sci. Dec 29

2005;360(1464):2335-2345.

76. Chen YR, Chen CL, Zhang L, et al. Superoxide generation from mitochondrial

NADH dehydrogenase induces self-inactivation with specific protein radical

formation. J Bioi Chem. Nov II 2005;280(45):37339-37348.

77. Sellem CH, Marsy S, Boivin A, et al. A mutation in the gene encoding cytochrome

clleads to a decreased ROS content and to a long-lived phenotype in the

filamentous fimgus Podospora anserina. Fungal Genet Bioi. Jul2007;44(7):648-658.

78. Messner KR, Imlay JA. Mechanism of superoxide and hydrogen peroxide formation

by fumarate reductase, succinate dehydrogenase, and aspartate oxidase. J BioI Chem.

Nov 8 2002;277(45):42563-42571.

79. Lavarias S, Dreon MS, Pollero RJ, et al. Changes in phosphatidylcholine molecular

species in the shrimp Macrobrachium borellii in response to a water-soluble fraction

of petroleum. Lipids. May 2005;40(5):487-494.

58

80. Sun HC, Qian XM, Nie SN, et aI. SeriaI analysis of gene expression in mice with

lipopolysaccharide-induced acute lung injury. Chin J Traumatol. Apr 2005;8(2):67-

73.

81. Varley AW, Coulthard MG, Meidell RS, et aI. Inflammation-induced recombinant

protein expression in vivo using promoters from acute-phase protein genes. Proc

Natl Acad &i USA. Jun 6 1995;92(12):5346-5350.

82. Jousilahti P, SaIomaa V, Hakala K, et aI. The association of sensitive systemic I

inflammation markers with bronchiaI asthma. Ann Allergy Asthma Immunol. Oct

2002;89(4):381-385.

83. Jaradat M, Stapleton C, Tilley SL, et aI. Modulatory role for retinoid-related orphan

receptor aIpha in allergen-induced lung inflammation. Am J Respir Cri! Care Med.

Dec 15 2006;174(12):1299-1309.

84. Zhang W, Hoflinan B, Liebermann DA. Ectopic expression of

MyDl18/Gadd45/CR6 (Gadd45beta/aIphalgamma) sensitizes neoplastic cells to

genotoxic stress-induced apoptosis. In! J Oncol. Apr 2001; 18(4):749-757.

85. Azatn N, Vairapandi M, Zhang W, et al. Interaction of CR6 (GADD45gamma) with

proliferating cell nuclear antigen impedes negative growth control. J Bioi Chem. Jan

262001;276(4):2766-2774.

86. Loizidou MA. Michael T, Neuhausen SL, et aI. Genetic polymorphisms in the DNA

repair genes XRCCl, XRCC2 and XRCC3 and risk of breast cancer in Cyprus.

Breast Cancer Res Treat. Jan 10 2008.

59

87. Li C, Wong WH. Model-based analysis of oligonucleotide arrays: expression index

computation and outlier detection. Proc Natl Acad Sci USA. Jan 22001;98(1):31-

36.

88. Ach RA, Floore A, Curry B, et al. Robust interlaboratory reproducibility of a gene

expression signature measurement consistent with the needs of a new generation of

diagnostic tools. BMC Genomics. 2007;8:148.

60