cerberus-1 induces stem cell cardiomyocyte...

Supplemental Material

Coordinate Nodal and BMP Inhibition Directs Baf60c-dependent Cardiomyocyte Commitment

Wenqing Cai, Sonia Albini, Ke Wei, Erik Willems, Rosa M. Guzzo, Masanao Tsuda, Lorenzo Giordani, Sean Spiering, Leo Kurian, Gene W. Yeo, Pier Lorenzo Puri and Mark Mercola

Contents: Supplemental Materials and Methods Supplemental Table S1 Supplemental Figures and Legends (Fig. S1-S8) Supplemental References

Cai et al. (Mercola) Supplementary Information

Supplemental Materials and Methods

Mouse ESC culturemESCs [Cripto-/- ESCs (Xu et al. 1998), parental R1 and CGR8 lines, and reporter lines carrying MHC-eGFP (Takahashi et al. 2003), Flk1-eGFP (Ema et al. 2006), Nkx2-5-eGFP (Wu et al. 2006), MHC-puror (Barcova et al. 2007)] were cultured and differentiated as embryoid bodies (EBs) under serum or serum-free conditions as previously described (Cai et al. 2012; Willems et al. 2012). Undifferentiated cells were maintained with 1000 unit/ml LIF (Millipore). Serum-induced differentiation typically yielded approximately 5% cardiomyocytes at baseline by flow cytometry (for both the CGR8 and R1 lines), comparable to the proportion of cardiomyocytes in E9.5 embryos (not shown), and allowing both increases and decreases in yield to be measured. Briefly, undifferentiated ESCs were dissociated into single cells by 0.25% Trypsin (Life Technologies) and then differentiated as embryoid bodies (EBs) in Iscove’s Modified Dulbecco Media (IMDM) supplemented with 10% FBS, 2mM glutamine, 4.5x10 -4 M monothioglycerol, 0.5mM ascorbic acid, 200ug/mL transferrin (Roche), 5% protein-free hybridoma media (PFHM-II; Life Technologies) and antibiotics/antimycotic mixture (Penicillin and Streptomycin, Gibco).

For serum-free differentiation, EBs were cultured in serum-free medium containing 75% IMDM and 25% Ham’s F12 supplemented with 0.05% BSA, 2mM GlutaMax (GIBCO), B27 supplement (GIBCO 12587), N2 supplement (GIBCO 17502), 50 g/ml ascorbic acid and 4.5 x 10 -4 M monothioglycerol (Sigma). EBs were treated with 5 ng/ml Activin A from day 2-3, and then were treated with 15 ng/ml Activin A, 0.5 ng/ml BMP4 from day 3-5. The yield of cardiomyocytes of CGR8 mESCs from the serum free protocol was approximately 17% by flow cytometry. Recombinant BMP4 and Activin A (both from R&D Systems), Dorsormophin (Tocris Bioscience), SB-431542 (Sigma-Aldrich) and IWR-1 (Willems et al. 2011) were used as indicated in the text and legend to Fig. 1E). Alternatively (Supplemental Fig. S8B), EBs were differentiated to cardiomyocytes as described (Kattman et al. 2011).

For puromycin-selection of cardiomyocytes, day 9 differentiated R1 ESCs carrying the MHC-puror gene were treated with puromycin (2 g/ml, Acros Organics) for 24 hours, and then were dissociated into single cells and plated in 12-well plates.

Human ESC cultureH9 human ESCs were maintained and differentiated as described (Willems et al. 2011). Briefly, H9 were cultured on a mouse embryonic fibroblast (MEF) feeder cells on Matrigel coated plate in Knock Out DMEM (Gibco) supplemented with 20% KOSR (Gibco), 8 ng/ml bFGF (Sigma). For EBs differentiation in serum free protocol, H9 were treated with 1 mg/ml Collagenase IV for 5 minutes at 37oC and then were mechanically passaged onto MEFs on Gelatin coated plate. After 4 days, hESC colonies were lifted off with 1mg/ml collagenase IV (Gibco) and directly differentiated in StemPro 34 media (Gibco) with addition of 1% NEAA (Gibco), 2mM glutamine (Gibco), 4.5x10-4M monothioglycerol (Sigma), 0.5mM ascorbic acid. To induce cardiac differentiation, EBs were treated with BMP4, hrActivin A and hrbFGF at indicated stages (color blocks) as depicted in Fig. 5A. For monolayer differentiation, day 4 differentiated EBs were dissociated gently to single cells with TrypLE (Gibco). Single cells were then transferred in gelatin coated 384-well plates (Greiner Inc.) in StemPro 34 with 5ng/ml hrbFGF, IWR (Willems et al. 2011) and SB-431542. T3 (Sigma) was added at day 10 to increase the mCherry fluorescence signal driven by MHC promoter for more reliable analyses. Alternatively (Supplemental Fig. S8A), H9 hESCs carrying MHC-mCherry reporter were grown in mTeSR


on matrigel coated plates, and were differentiated in an efficient protocol as described (Lian et al. 2012). Briefly, hESCs were treated with 7.5M GSK3 inhibitor CHIR 99021 (Stemegent) for 24 hours, and then were threated with 5M WNT inhibitor, IWP4 (Stemgent) for 48 hours at day 3.

Automated quantitative microscopyFluorescence signals were imaged on an InCell 1000 (GE Healthcare) and quantified by automated microscopy (Bushway et al. 2006).

Plasmids, lentiviral infection and siRNA transfectionFor siRNA and plasmid transfection assays, mESCs, or EBs dissociated in 0.25% Trypsin, were plated as monolayer cultures in 12-well plates (Corning) and transfected with plasmid or siRNA using Lipofectamine RNAiMAX per manufacturer’s directions and as indicated in the text. Pre-designed siRNAs were Cer1, Gata4, Tbx5 (Ambion), Baf60c (Dharmafect) and validated negative siRNA (Ambion). Plasmids included expression vectors for Baf60c (Forcales et al. 2011), Gata4 and Tbx5 (Benoit Bruneau, Gladstone Cardiovascular Institute), mCer1-HA (Michael Schneider, Imperial College, London). Plasmid transfection efficiency of mESCs was typically 50-60%, calculated based on proportion of eGFP+ cells following PGK-eGFP transfection.

For lentiviral shRNA infection, 2 X 106 R1, CGR8 cells or mESCs-derived cardiomyocytes were mixed with 4.5 x 106 pfu of virus supplemented with 10g/ml polybrene (Sigma-Aldrich). Lentiviral shRNA constructs were Cer1 shRNA-1, -2, -3 and scrambled sequence shRNA (Michael Schneider, Imperial College, London) (Liu et al. 2013), and Baf60c (sequence: GGGAGGGCTGGATGGATTA ). As indicated in the text, the shRNA lentiviral vectors in certain cases contained an expression cassette for a mOrange reporter, permitting the mOrange+ cells to be isolated by FACS (FACSVantageSE DiVa, BD Biosciences), recovered on MEF feeder cells, and then used for differentiation assays. See Supplementary Figs. S1 for validation of the si/shRNA constructs against Cer1.

RNA extraction and Q-RT-PCR Total RNA was extracted with TRIzol (Life Technologies) and reverse transcribed to cDNA with QuantiTect Reverse Transcription Kit (Qiagen) according to the manufacturer’s instructions. cDNA samples synthesized from 500ng of total RNA were subjected to Q-RT-PCR using the LightCycler 480 SYBR Green I Master kit (Roche) performed with LightCycler 480 Real-Time PCR System (Roche). Primer sequences are listed in Supplementary Table 1. Values are expressed either as 2^DeltaDeltaCt, with DeltaDeltaCt defined as the difference in crossing threshold (Ct) values between experimental and control samples as described (Livak and Schmittgen 2001) or as Log10 2^DeltaCt using Gapdh as a control gene.

FACS and Flow Cytometry EBs were harvested and dissociated by trypsinization and immunostained with phycoerythrin (PE)–conjugated anti-mouse Flk1 (eBioscience) and Alexa Fluor 647-conjugated anti-mouse Cxcr4 (eBioscience). Live cells were sorted into PE+ /Alexa 647-, PE+/Alexa647+, PE- /Alexa 647+ and PE- /Alexa 647- populations by FACS. For Flk1-eGFP+ and eGFP- cells, dissociated single cells were sorted based on eGFP. For Flk1+ and Flk1- cells, dissociated single cells were stained with PE-conjugated anti-mouse Flk1, and live cells were sorted based on PE+. For flow


cytometry, dissociated single cells were analyzed either alive, based on MHC-mCherry/eGFP reporter or the cell surface staining with APC-conjugated anti-human CD172A (eBioscience), or after fixation with 4% paraformaldehyde (PFA) by staining with APC-conjugated anti-mouse CD31 (BD Biosciences) or anti-mouse SMA (Sigma-Aldrich) followed by a secondary Alexa Fluor 680 goat anti mouse IgG staining. Cell sorting was performed with FACS Vantage-Diva sorter (BD Bioscience) and analysis was performed on FACSCanto (BD Biosciences). Data was processed using FlowJo (Treestar Inc.).

Western blotting After centrifugation, pelleted cells were lysed with RIPA buffer supplemented with protease and phosphatase inhibitors (Sigma-Aldrich) on ice and were mixed with 2x sample buffer (Life Technologies). Protein samples were then run on 10% SDS-Tris glycine pre-cast gels (Life Technologies) and transferred onto a 45 µm PVDF membrane. Antibodies specific for HA tag (1:1000, Covance), Baf60c [1:200, (Forcales et al. 2011)] and -actin (1:5000, Sigma-Aldrich) were incubated with the membranes. Detection was by ECL Plus detection kit (Abcam) or with an Odyssey system (LICOR).

ImmunohistochemistryCultures were fixed with 4% PFA (Sigma-Aldrich) on ice for 30 min, blocked, and then incubated with primary antibodies against sarcomeric -actinin (1:200, Sigma-Aldrich), CD31 (1:200, Santa Cruz), sm-MHC (1:100, Kamiya Biomedical Company) and Baf60c [1:200, (Forcales et al. 2011)], followed by Alexa Fluor 488 or 568-conjugated secondary antibodies (1:200, Invitrogen) and counterstained with DAPI (Life Technologies).

ChIP-QPCR assay Chromatin immunoprecipitation was as described (Albini et al. 2013). Undifferentiated and day 6 differentiating mESCs were cross-linked with 1% v/v formaldehyde at room temperature for 15 minutes, and then were neutralized with 0.125M Glycine at room temperature for 5 minutes. Cultures were lysed on ice and followed by sonication to generate 100-500bp fragments. Chromatin extracts were immunoprecipitated overnight at 4oC with protein A Dynabeads (Invitrogen) and specific antibodies including custom-made anti-BAF60c (Albini et al. 2013), anti-H3K4me1 (Active motif), anti-H3K27ac (Active motif) and normal IgG as control. After extensive washes, ChIP complexes were eluted and cross-linking reversed by heating at 65oC for at least 5 hours. And then DNA was extracted using Chromatin IP DNA purification kit (Active motif). For QPCR analysis, 1/20 of the eluted DNA was used per reaction. Protein enrichment was calculated as percentage of input material, and then normalized to IgG control. Primers are the same as those used in chromatin endonuclease accessibility assay.

Chromatin endonuclease accessibility assay Endonuclease accessibility was as described (Simone et al. 2004). Day 6 mESCs were harvested and incubated with RSB buffer (10mM Tris-HCl [pH 7.4], 10mM NaCl, 5mM MgCl2, 0.1% Nonidet P-40, 5mM butyrate, 10mM NaF, and 1 mM NaVO7, supplemented with protease inhibitors and phosphatase inhibitors) for 20 min on ice. The cell pellets were homogenized through 27-gauge syringes, centrifuged at 2,000 rpm at 4oC for 5min, and resuspended in 40 l of fresh RSB buffer. 100U of restriction endonuclease MBOII were added to digest chromatin for 1 hour at 37oC. Reactions were stopped by adding 0.2 g/l proteinase K and 2% SDS for 2 hours at 45oC. Genomic DNA was extracted with phenol-chloroform twice, and resuspended in


distilled water. The precipitated DNA was subjected to Q-PCR to amplify the selected regions. Primers were for -2.8kb enhancer: AGAGAGCGAGGCGTTGTTGAAGAT (forward), AGCTGCAACTATCACCCGGAATGT (reverse); Primers for -9kb enhancer: CGGGGAAGGGAGATAAGATG (forward), CTCTGCTGTGTGGCCTTGTA (reverse). Primers for -15kb region: TGCAGAAGTCACTGGGATG (forward), AGGGTGTTCCAATGTATTCTCTC (reverse).


Supplemental Table S1. Q-RT-PCR primers

Gene (ACCESSION NO.) Forward Primer Reverse PrimerCerberus-like (NM_009887)

Foxa2 (NM_010446)

Nodal (NM_013611)

Lefty1 (NM_010094)

Lefty2 (NM_177099)

Bmp2 (BC100344)

Bmp4 (NM_007554)

Noggin (NM_008711)

MHC (M76601)

Bra/T (NM_009309)

Pax6 (NM_013627)

Flk1 (NM_010612)

Mesp1 (BC012689)

Gata4 (NM_008092)

Mef2c (NM_025282)

Tbx5 (NM_011537)

Tbx1 (NM_011532)

Nkx2-5 (NM_008700)

Isl1 (NM_021459)

CD31 (NM_001032378.1)

cTnT (NM_011619)

VE-Cad (NM_009868)

sm-MHC (NM_013607)

SMA (NM_007392)

Sox17 (NM_011441)

Alk4 (NM_007395)

Alk3 (NM_009758)

Alk6 (NM_007560)

Bmpr2 (NM_00756)

gcagacctatgtgtgga

tggtcactggggacaagggaa

ccagacagaagccaact

ctcgatcaaccgcca

aggttcgcatctgag

ccaagacacatgtgagga

ttcctggtaaccgaatgctga

ccttctgcccggtgctgtac

catgccaatgacgacct

agcttcgtgacggctgacaa

gacctcctcatactcgtg

tgccggcatggtcttctg

aatgcaacggatgattgt

catcaaatcgcagcct

agatacccacaacacaccacgcgcc

ccagctcggcgaagggatgttt

agacgaatgttccccac

aagtgctctcctgctttcccag

cgtctgatttccctgtgtgttgg

tgcacccatcacttaccacc

cagaggaggccaacgtagaag

tgccctcattgtggacaagaa

aagctgcggctagaggtca

gcatccacgaaaccacctat

cgagccaaagcggagtctc

tgctgctatattgacttctgcaa

tttccagccctacatcatggc

aatgtcgtgacactcccattc

ttgggataggtgagagtcgaat

atgagacatgatcgcttt

gcaacaacagcaatagacaac

aagcatgctcagtggct

ccattccgaacactagc

cttgtctagggctaaggt

ccacatacaaagggtgt

cctgaatctcggcgacttttt

acagacttggatggcttacacacc

cctacactcctgtactgcc

cgagtctgggtggatgtag

gtgcttctaaccgcca

aaatcaagccccacatt

agcgtgtaccctattgg

aagcaagctagagtcct

cattatccttcagagagtcgcatgcgctt

ccgacgccgtgtaccgagtgat

gcaggttattggtcagtt

ttgtccagctccactgccttc

aagtcgttcttgctgaagcctatg

cttcatccaccggggctatc

tcgatcagagtctgtagctcatt

tggcacagatgcgttgaatac

agctctctttggaagtccttcat

tccacatctgctggaaggta

tgccaaggtcaacgccttc

agacacgctggtgatagttga

gctccaacttacttcatcgct

cccaatgctgtaccgaggt

tgtttcacaagattgatgtcccc


Smarcd1 (NM_031842)

Smarcd2 (NM_001130187)

Smarcd3 (NM_025891)

SM22 (NM_011526)

Mixl1 (NM_013729)

Baf250a (NM_001085355)

Baf250b (NM_001085355)

Baf180 (NM_001081251)

MlLC2v (NM_010861.3)

MLC2a (NM_022879.2)

MHC (NM_080728.2)

Hnf1b (NM_009330)

Hex (NM_008245.3)

Anf (NM_008725)

hGAPDH (NM_002046.4)

hBAF60C (NM_001003801.1)

hNKX2.5 (NM_001166176.1)

hMHC (NM_002471.3)

hACTN2 (NM_001102)

agaactgacaaagcccctg

gctgggtttgcatgtttacag

ctaggagcccgtgaacaag

agggatcgaagccagtgaag

acgcagtgctttccaaacc

cgtgcggagcttgtctttc

ctccctgcgagtattccag

ctgtagatcctattgctgtgtgc

aggacgagtgaacgtgaaaaat

accgtcttcctcacact

actgtcaacactaagagggtca

agggaggtggtcgatgtca

ggaggctgatcttgact

gcttccaggccatattggag

agccgcatcttcttttgcgtcg

gcgcgcaaagccacgaaa

agtgtgcgtctgcctttc

gggaagcaccaagatgaccgatgc

catcggcgctgaagaaattgt

gggtggatataggacatgggag

aagactgggcttgtaggaatg

ctgttacgtgacctttaatccatc

actgctgccatatccttacct

cccgcaagtggatgtctgg

cctccttctcataggtctgtgg

tgcctgtcataaaacctctttcc

gctttggagccctaatgaaca

gcccctttaagtttctccccaa

cttgtctgcctgggtca

ttggatgatttgatcttccaggg

tctggactgtctggttgaact

gtagggactgcgtcat

gggggcatgacctcatctt

cttctccatggtggtgaagacg

atccgggctccagacggcatc

gttgtccgcctctgtcttc

ttgggtgggttctgctgcaaca

aggccatctttccagctagtat


Supplemental Figures and Legends

Figure S1, related to Figure 1: Cer1 RNA interference with siRNA oligonucleotides and shRNA lentivirus. (A-C) Cer1 knockdown by siRNA. Western blots of lysates from R1 mESCs that had been transfected to express HA-epitope tagged Cer1 and blotted with anti-HA antibody. Cer1 or negative control (scrambled sequence) siRNAs (50 nM) were transfected 1 day before differentiation (see Materials and Methods) (A). Densitometric quantification of the Cer1 protein detected on the Western blots (B). Note that siRNA knockdowns exceeded 90% efficiency. siRNAs (100 nM) were transfected into mESCs at differentiation day 3, and mRNA was analyzed for endogenous Cer1 expression at day 6 (C). Note that siRNA knockdowns exceeded 60% efficiency.

(D) Representative FACS profiles of mOrange+ mESCs after infection with lentiviral constructs to express the indicated shRNA and fluorescent mOrange reporter protein from tandem cassettes. The gates indicated were used to purify the shRNA-expressing mESCs prior to differentiation.

(E-G) Cer1 knockdown by Cer1 shRNA lentivirus constructs. Western blots of lysates from R1 mESCs that had been transfected to express HA-epitope tagged Cer1 and blotted with anti-HA antibody (E). shRNA constructs were introduced as in panel D. Densitometric quantification of the Cer1 protein detected in the Western blots relative to negative control shRNA to luciferase (luc shRNA) (F). Endogenous Cer1 had been detected at differentiation day 4 (G). Both siRNA and shRNA knockdowns exceeded 90% efficiency of recombinant Cer1 and achieved about 50-60% reduction of endogenous Cer1.


Figure S2, related to Figure 1: RNA interference to Cer1 blocks cardiogenesis downstream of the Mesp1+ state.(A-C) shRNA (A) and siRNA (B and C) block induction of MHC, analyzed by Q-RT-PCR at day 8 of differentiation (A) and day 16 (B, C). For B, C, siRNA (100nM) was transfected at day 3 (B) and day 4 (C) into R1 mESCs to probe the time window when Cer1 is required, indicating a requirement after day 3, and before day 6 when Cer1 mRNA levels decline.

(D, E) Transient transfection to overexpress Cer1 did not affect the differentiation of endoderm (Foxa2) and cardiogenic mesoderm (Mesp1) at day 4, as shown by Q-RT-PCR analysis.

(F) Optimal doses of SB 0.1M and DM 0.5 M, mimicking Cer1, synergized to enhance MHC-eGFP reporter expression. The inserted panel expands the Y-axis to show that Cer1 siRNA suppresses the basal level of cardiomyocyte differentiation. However, co-treatment with DM and SB rescued and further enhanced MHC-eGFP expression over Cer1 siRNA-1. Note that the maximal levels attained were similar under Cer1 and neg. ctrl siRNA conditions. The Y-axis plots the integrated intensity of MHC-eGFP fluorescence, as measured by quantitative automated microscopy.

Statistical analysis was performed with unpaired Student’s T test, *P<0.05. Error bars indicate the S.E.M., n=3 for all experiments.


Figure S3, related to Figure 2: Distribution of ligands and receptors of Nodal and BMP signaling pathways in mESCs-derived endoderm and cardiogenic mesoderm populations.(A) Q-RT-PCR profiling of Cer1, Noggin, Nodal, Bmp2 and Bmp4 transcripts in the 4 FACS isolated population defined by Flk1 and Cxcr4 (see Fig. 2A, B).

(B) The same for Nodal (Alk4) and BMP (Alk3, Alk6, Bmpr2) receptor transcripts. Statistical analysis was performed with unpaired Student’s T-test, *P<0.05. Error bars indicate the S.E.M., n=3 for all experiments.


Figure S4, related to Figure 3: Cer1 specifically affects cardiogenesis.(A) Cer1 siRNA had no effect on the fraction of Flk1+/Cxcr4+ cells relative to control (scrambled sequence) siRNA. siRNAs (100 nM) were transfected at one day before differentiation and flow cytometry analysis was at day 4, n=4.

(B) Cer1 siRNA blocked differentiation of cardiomyocytes (marked by cTnT) in unsorted mESC cultures without affecting markers of vascular endothelial (CD31 and VE-Cad) or smooth muscle lineages (sm-MHC and SMA). Q-RT-PCR analysis of markers was at day 16; siRNAs (100 nM) were transfected at day 3 of differentiation.

(C) Conversely, plasmid transfection to overexpress Cer1 increased MHC transcript levels, but did not alter the levels of CD31, VE-Cad, sm-MHC and SMA at differentiation day 8. Transfection was 1 day before differentiation.

Statistical analysis was performed with unpaired Student’s T-test, *P<0.05. Error bars indicate the S.E.M., n=3 unless indicated otherwise.


Figure S5, related to Figure 4: Influence of Smad1, 2 and Wnt on Baf60c reveal selective induction following inhibition of Smad2.(A) Schematic of experimental timeline for treatment with siRNAs, and the Wnt inhibitor IWR-1.

(B) siRNA against Smad2, in contrast siRNA against Smad1, induced Baf60c transcripts. siRNAs were transfected at differentiation day 3.5, and samples were harvested for Q-RT-PCR at day 5.

(C) IWR-1 (2M) treatment between differentiation day 3-5 completely blocked Mesp1 mRNA expression, consistent with a requirement for Wnt signaling at this early phase of cardiogenesis (Kwon et al. 2007; Ueno et al. 2007), and decreased Nkx2-5 and Baf60c transcripts, by Q-RT-PCR.

(D) Conversely, IWR-1 (2M) treatment between differentiation day 5-7 promoted Nkx2-5 and MHC expression, consistent with a requirement for Wnt inhibitors in cardiac commitment (Marvin et al. 2001; Schneider and Mercola 2001), but did not affect Baf60c expression.

Statistical analysis was performed with unpaired Student’s T-test, *P<0.05. Error bars indicate the S.E.M., n=3 for all experiments.


Figure S6, related to Figure 4: Nodal inhibition increased the number of cardiomyocytes in hESCs differentiation.(A) Schematic of experimental timeline of serum-free hESCs differentiation.

(B) Represented flow cytometry profiles of MHC-mCherry reporter fluorescence.


Figure S7, related to Figure 4: Baf60c overexpression has no effect on endothelial and smooth muscle cell differentiation. CD31, VE-Cad and sm-MHC were analyzed by Q-RT-PCR at day 10. Cer1 siRNA was transfected at day as in Fig. 4K.



Figure S8, related to Figure 5: Baf60c cell-autonomously regulates cell fate commitment of Flk1+ progenitors towards cardiomyocytes.(A) BAF60C and GATA4 shRNA knockdown decreased the yield of cardiomyocye in hESCs

under a directed differentiation protocol, see (Lian et al. 2012) and Materials and Methods.

(B) Baf60c siRNA knockdown decreased the yield of cardiomyocye in mESCs under a directed differentiation protocol, see (Kattman et al. 2011) and Materials and Methods.

(C) Schematic of protocol for panel C.

(D) Baf60c and Gata4 siRNA knockdowns decreased mRNA expression of Nkx2-5, MHC and cTnT in FACS-isolated Flk1+ progenitors.



Supplemental References

Albini S, Coutinho P, Malecova B, Giordani L, Savchenko A, Forcales SV, Puri PL. 2013. Epigenetic reprogramming of human embryonic stem cells into skeletal muscle cells and generation of contractile myospheres. Cell Rep 3: 661-670.

Barcova M, Campa VM, Mercola M. 2007. Human embryonic stem cell cardiogenesis. in Human stem cell manual : a laboratory guide (eds. JF Loring, RL Wesselschmidt, PH Schwartz). Elsevier/Academic Press, Amsterdam ; Boston.

Bushway PJ, Mercola M, James I. 2006. High[hyphen (true graphic)]Throughput Screening for Modulators of Stem Cell Differentiation. in Methods in Enzymology, pp. 300-316. Academic Press.

Cai W, Guzzo RM, Wei K, Willems E, Davidovics H, Mercola M. 2012. A Nodal-to-TGFbeta cascade exerts biphasic control over cardiopoiesis. Circulation research 111: 876-881.

Ema M, Takahashi S, Rossant J. 2006. Deletion of the selection cassette, but not cis-acting elements, in targeted Flk1-lacZ allele reveals Flk1 expression in multipotent mesodermal progenitors. Blood 107: 111-117.

Forcales SV, Albini S, Giordani L, Malecova B, Cignolo L, Chernov A, Coutinho P, Saccone V, Consalvi S, Williams R et al. 2011. Signal-dependent incorporation of MyoD-BAF60c into Brg1-based SWI/SNF chromatin-remodelling complex. The EMBO journal 31: 301-316.

Kattman SJ, Witty AD, Gagliardi M, Dubois NC, Niapour M, Hotta A, Ellis J, Keller G. 2011. Stage-Specific Optimization of Activin/Nodal and BMP Signaling Promotes Cardiac Differentiation of Mouse and Human Pluripotent Stem Cell Lines. Cell Stem Cell 8: 228-240.

Kwon C, Arnold J, Hsiao EC, Taketo MM, Conklin BR, Srivastava D. 2007. Canonical Wnt signaling is a positive regulator of mammalian cardiac progenitors. Proceedings of the National Academy of Sciences of the United States of America 104: 10894-10899.

Lian X, Hsiao C, Wilson G, Zhu K, Hazeltine LB, Azarin SM, Raval KK, Zhang J, Kamp TJ, Palecek SP. 2012. Robust cardiomyocyte differentiation from human pluripotent stem cells via temporal modulation of canonical Wnt signaling. Proceedings of the National Academy of Sciences of the United States of America 109: E1848-1857.

Liu Y, Kaneda R, Leja TW, Subkankulova T, Tolmachov O, Barahona M, Minchiotti G, Schwartz RJ, Scheider MD. 2013. A Sox17-Hhex-Cer1 pathway mediates cardiopoiesis in embryonic stem cells. submitted.

Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods (San Diego, Calif 25: 402-408.

Marvin MJ, Di Rocco G, Gardiner A, Bush SM, Lassar AB. 2001. Inhibition of Wnt activity induces heart formation from posterior mesoderm. Genes & development 15: 316-327.

Schneider VA, Mercola M. 2001. Wnt antagonism initiates cardiogenesis in Xenopus laevis. Genes and Development 15: 304–315.

Simone C, Forcales SV, Hill DA, Imbalzano AN, Latella L, Puri PL. 2004. p38 pathway targets SWI-SNF chromatin-remodeling complex to muscle-specific loci. Nat Genet 36: 738-743.

Takahashi T, Lord B, Schulze PC, Fryer RM, Sarang SS, Gullans SR, Lee RT. 2003. Ascorbic Acid Enhances Differentiation of Embryonic Stem Cells Into Cardiac Myocytes. Circulation 107: 1912-1916.

Ueno S, Weidinger G, Osugi T, Kohn AD, Golob JL, Pabon L, Reinecke H, Moon RT, Murry CE. 2007. Biphasic role for Wnt/beta-catenin signaling in cardiac specification in zebrafish and embryonic stem cells. Proceedings of the National Academy of Sciences of the United States of America 104: 9685-9690.


Willems E, Cabral-Teixeira J, Schade D, Cai W, Reeves P, Bushway PJ, Lanier M, Walsh C, Kirchhausen T, Izpisua Belmonte JC et al. 2012. Small molecule-mediated TGF-beta type II receptor degradation promotes cardiomyogenesis in embryonic stem cells. Cell Stem Cell 11: 242-252.

Willems E, Spiering S, Davidovics H, Lanier M, Xia Z, Dawson M, Cashman J, Mercola M. 2011. Small-molecule inhibitors of the Wnt pathway potently promote cardiomyocytes from human embryonic stem cell-derived mesoderm. Circulation research 109: 360-364.

Wu SM, Fujiwara Y, Cibulsky SM, Clapham DE, Lien CL, Schultheiss TM, Orkin SH. 2006. Developmental origin of a bipotential myocardial and smooth muscle cell precursor in the mammalian heart. Cell 127: 1137-1150.

Xu C, Liguori G, Adamson ED, Persico MG. 1998. Specific arrest of cardiogenesis in cultured embryonic stem cells lacking Cripto-1. Developmental biology 196: 237-247.

cerberus-1 induces stem cell cardiomyocyte...

Documents