1

CGRP is Essential for Algesic Exocytotic Mobilization of TRPV1

Channels in Peptidergic Nociceptors

Isabel Devesaa, Clotilde Ferrándiz-Huertasa, Sakthikumar Mathivanana, Christoph

Wolfa, Rafael Lujánb, Jean-Pierre Changeuxc,d, and Antonio Ferrer-Montiela,e,1

aInstituto de Biología Molecular y Celular. Universidad Miguel Hernández. Elche.

Spain. bDept. Ciencias Médicas, Instituto de Investigación en Discapacidades

Neurológicas (IDINE), Facultad de Medicina, Universidad Castilla-La Mancha,

Albacete, Spain. cCollège de France and CNRS URA 2182, dInstitut Pasteur, 47 rue du

Four Paris 7506, Paris, France. eUnidad de Biofísica, UPV/EHU, CSIC, Bilbao, Spain.

1Correspondence should be addressed. Email: aferrer@umh.es

Keywords: Pain transduction; ion channels; sensory neurons; nociception; vesicle

2

SI Appendix

Materials and Methods

All procedures were approved by the Institutional Animal and Ethical Committee of the

University Miguel Hernández de Elche, in accordance with the guidelines of the

Economic European Community, the National Institutes of Health, and the Committee

for Research and Ethical Issues of the International Association for the Study of Pain.

Animals. Animals were kept in a controlled environment (21-23 ºC, 12h light/dark

cycle), and had food and water available ad libitum. Neonatal Wistar rats and wild type

C57BL/6J mice were purchased from in house bred stock (originally from Harlan

Laboratories). αCGRP-deficient mice (B6;129-Calcatm) were generated as described (1).

Tac1-deficient mice (B6.Cg-Tac1tm1Bbm/J) were purchased from The Jackson

Laboratory. Double knockout mice αCGRP and Tac1 genes were in house generated by

crossing homozygous αCGRP and Tac1 null mice to obtain first heterozygous and later

homozygous deficient mice (B6;B6;129-CalcatmTac1tm1Bbm /J).

Genotyping. Mutant genes were determined following previously described protocol

for generation of αCGRP-/- (1) and Tac1-/- (2) mice. Genomic DNA was extracted from

ear biopsies (3). Genotyping of αCGRP-/- mice was made using two PCR reactions and

three oligonucleotides: for endogenic DNA resulting in 420 bp band 5’

CCCCTAATGGCCTTGTGATTG 3’ and 5’ ACCTCCTGATCTGCTCAGCAG 3’; for

exogenic DNA resulting in 290 bp band 5’ ATGGGCGCATCGTAACCCGT 3’ and 5’

CCCCTAATGGCCTTGTGATTG 3’. Genotyping of Tac1-/- mice was made using 5’

AGAATTTAAAGCTCTTTTGCC 3’ and 5’ GCTCATCAGTATGTGACATAGAAA

3’, resulting in 180 bp band for wild type and 130 bp band for the mutant gene.

Primary culture of sensory neurons. DRG from neonatal Wistar rats (3-5 days old) or

adult male 12-15 week-aged mice (strains: CD57BL/6J, αCGRP-/-, Tac1-/-, and αCGRP-

/-xTac1-/- mice), cultured following previously described protocols with some

modification (4, 5). Neonatal rat ganglia were digested with 0.25% (w/v) collagenase

(type IA) in DMEM-glutamax (Invitrogen) with 1% penicillin-streptomycin (P/S)( 5000

U/mL, Invitrogen) for 1 h (37 ºC, 5% CO2). Isolated mouse DRG were incubated with

0.67% (w/v) collagenase type XI and 3% (w/v) dispase (Gibco) in INC mix medium (in

mM): 155 NaCl, 1.5 K2HPO4, 5.6 HEPES, 4.8 NaHEPES, 5 glucose) for 1 h (37 ºC, 5%

3

CO2). After digestion, rat and mouse DRG were mechanically dissociated using a glass

Pasteur pipette. Single cell suspension was passed through a 100 µm cell strainer, and

washed with DMEM glutamax plus 10% fetal bovine serum (FBS)( Invitrogen) and 1%

P/S. Cells were seeded at the required density for each experiment on 12 mm cover-

glass slides, 96 well-plate, 6 well-plate or microelectrode array chambers previously

coated with poly-L-lysine (8.33 µg/ml) and laminin (5 µg/ml). After 2 h, medium was

replaced with DMEM glutamax, 10% FBS and 1% P/S, supplemented with mouse 2.5s

NGF 50 ng/mL (Promega), and 1.25 µg/mL cytosine arabinoside when required (37 ºC,

5% CO2). If it is not specified, all experiments were made 48 h after cell seeding. To

deplete Isolectin IB4+ neurons, rat DRG were cultured in the presence of 10 nM IB4-

saporin or saporin as control (Advanced Targeting Systems) for 72 h. Transfection with

specific targeted siRNA was carried out in antibiotic-free medium 24 h after seeding

according to manufacturer’s protocol. All experiments were made 48 h after

transfection. Lipofectamine 2000 at 5 µg/mL (Invitrogen), Silencer® Negative Control

siRNA#1 at 100 nM, αCGRP Silencer® pre-designed 60 nM (Cat N. 286755, 286754,

50360), and Tac1 Silencer® pre-designed 40 nM (Cat N. 200158, 59627), Silencer®

Negative Control siRNA#1-Cy3 (AM4621) at 100 nM (Ambion Life Technologies,

Invitrogen).

Calcium microfluorography. DRG on coverslips loaded with 5µM fluo-4-

acetoxymethyl ester plus 0.02% pluronic acid (Molecular Probes, Invitrogen) in HBSS

extracellular solution (in mM): 140 NaCl, 4 KCl, 1 MgCl2, 1.8 CaCl2, 5 D-glucose, and

10 HEPES, pH 7.4 for 1 h (37°C, 5% CO2) mounted in a RC-25 chamber (Harvard

Apparatus), were continuously perfused with test solutions at room temperature (RT).

Fluorescence from individual neurons monitored through a 10x air objective (Aixiovert

200 inverted microscope, Carl Zeiss) with an ORCA-ER CCD camera (Hamamatsu

Photonics). Pre-programed protocols applied via computer-controlled pinch valves

(Bioscience Tools, 5 mL/min flux). Fluo-4AM excited at 500 nm and emitted

fluorescence filtered at 535 nm (Lambda-10-2-filter wheel, Sutter Instruments). Images

processed with AquaCosmos package software (Hamamatsu Photonics). TRPV1

channel activity was evoked with 4 sequential 10 s-application of capsaicin at 200 nM

or 300 nM, followed by a 40 mM KCl pulse to distinguish viable neurons. Sensitization

of TRPV1 channel was induced by ATP perfusion (8 min, 10 µM) in HBSS between the

second (P2) and the third (P3) capsaicin pulse. Activity of P2Y2 receptor was elicited by

4

UTP (100 µM, 30 s). Intracellular Ca2+ increase calculated as fluorescence difference

between baseline and the peak reached. An evoked response defined when intensity

overcame 20% of baseline. Fold potentiation of capsaicin-induced responses was

defined as ratio P3/P2 of intensity variation.

Patch clamp recordings. Whole-cell voltage clamp was made in neurons seeded on

coverslips, placed in RC-25 chamber and connected to a external perfusion system at

RT. External solution (in mM): 140 NaCl, 4 KCl, 2 CaCl2, 2 MgCl2, 10 HEPES, 5 D-

glucose, 20 mannitol, pH 7.4 (adjusted with NaOH). Internal pipette solution (in mM):

144 KCl, 2 MgCl2, 10 HEPES, 5 EGTA, pH 7.2 (adjusted with KOH). Membrane

currents were acquired by using EPC10 HEKA Patch amplifier (HEKA Electronics).

Cells were held at a resting membrane potential of -60 mV, and at a sampling rate of 2.5

Hz. Patch glass pipettes with O.D 1.5 mm x I.D. 1.17 mm (Harvard Instruments) made

with Sutter Pippete puller Equipment (Sutter Instruments) with 3-6 MΩ resistance. Data

acquisition and offline analysis with PatchMaster software (HEKA Electronics). Rat

DRG neurons labelled with IB4-alexa 568 (10 μg/ml, 10 min, RT) in external solution

(Molecular Probes, Invitrogen), followed by two 5 min-washes, and visually identified

through x20 air objective (Aixiovert 200 inverted microscope, Carl Zeiss), with an

excitation filter ET545 and an emision filter ET605 (CHR-49004, Laser 2000 SAD).

Neuronal viabiliy determined through typical neuronal Na+-K+ currents. TRPV1

desensitization evoked by three repetitive 10s-pulse of 1 µM capsaicin using perfusion

system (2 mL/min flux). 10 µM ATP was applied for 8 min between P2 and P3 pulse.

Potentiation of TRPV1-mediated currents calculated as ratio P3/P2 current peak.

Capsaicin dose-response was determined in wild type and αCGRP-/-xTac1-/- neurons

with resting membrane potential below -40 mV. For current-clamp recording, cells were

held at 0 pA. Firing threshold was measured first by injecting a series of 100 ms

depolarising current in 10 pA steps from 0 pA to elicit the first action potential. To

further examine the neurons firing properties, a depolarising current injection in 100 ms,

40 pA was delivered to elicit the action potential which was analysed for the following

intrinsic membrane properties: threshold potential (mV), amplitude of action potential

(mV), duration of action potential (ms), overshoot of action potential (mV), amplitude

of AHP (mV).

Microelectrode Array (MEA). Extracellular recordings were made using multiple

electrode planar arrays of 60-electrode thin MEA chips, with 30 μm diameter electrodes

5

and, 200 μm inter-electrode spacing with an integrated reference electrode

(Multichannel Systems GmbH). The electrical activity of primary sensory neuron was

recorded by the MEA1060 System (Multi Channel Systems GmbH,

http://www.multichannelsystems.com), and MC_Rack software version 4.3.0 at a

sampling rate of 25 kHz. TRPV1-mediated neuronal firing activity was evoked by three

repetitive 15s-applications of 500 nM capsaicin, using continuous perfusion system (2

mL/min flux). 10 µM ATP in external solution was perfused between P2 and P3 for 8

min. Data were analyzed using MC_RACK spike sorter and Neuroexplorer Software

(Nex Technologies). An evoked spike was defined when the amplitude of the neuronal

electrical activity overcame a threshold set at -25 μV. The recorded signals were then

processed to extract mean spike frequency.

Immunohistochemistry and immunocytochemistry. Mice were anesthetized with

pentobarbital 50 mg/kg i.p. in saline, and transcardially perfused with saline followed

by 4% paraformaldehyde/4% sucrose (w/v) in phosphate buffer (PB) at 0.1 M, pH 7.4.

Isolated DRG were post-fixed in the same fixative solution for 3 h, and immersed in

sucrose gradient (10%, 20% and 30%) solutions in 0.1 M PB (4h, 4ºC). Tissues were

embedded and frozen in TissueTek OCT mounting medium (Sakura Finetek). DRGs

were serially cut at 14 µm thickness, mounted onto Menzel-Gläser Superfrost

UltraPlus® slides (Thermos Scientific, Gehard Menzel), and kept at -20 ºC until use.

Slides were defrosted for 30 min at RT, washed with PBS, and blocked/permeabilized

with 10% normal goat serum (NGS), 3% BSA, and 0.1% Triton X-100 in PBS for 30

min at RT. For immunocytochemistry, cultured mouse DRG seeded on coverslips

washed with PBS, were fixed with 4% w/v paraformaldehyde for 20 min, washed,

permeabilized with 0.3% Triton X-100 for 5 min at RT, and then blocked with 5% NGS

for 1 h at RT. In both cases, primary antibodies were incubated in 5% NGS in PBS

overnight at 4 ºC. Once washed with PBS-Tween 0.05%, samples were incubated with

secondary antibodies in blocking solution (1 h, RT), and nuclei stained with DAPI (300

nM in PBS, 5 min, RT) (Molecular Probes, Invitrogen). Samples were mounted with

Mowiol® (Calbiochem). Primary antibodies: rabbit anti-TRPV1 (Alomone, 1.6 µg/mL),

guinea-pig anti-TRPV1 (Chemicon, Millipore 1:1000), rabbit anti-Neurofilament 200

(Sigma-Aldrich, 10 µg/mL), Isolectin B4-Alexa 568 (Molecular Probes, 10 µg/mL),

goat anti-CGRP (Abcam, 25 µg/mL), guinea pig anti-CGRP (Peninsula Laboratories,

0.9 g/ml), and rabbit anti-βIII-tubulin (Abcam, 1 µg/mL). Secondary antibodies: goat

6

anti-rabbit Alexa 488 (Molecular Probes 2-10 µg/mL), goat anti-rabbit-TRITC (Jackson

Immunoresearch, 7.5 µg/mL), goat anti-guinea pig Alexa 568 (2-10 µg/mL), Fab2

donkey anti-goat-TRITC (Jackson Immunoresearch, 7.5 µg/mL). Samples visualized

with an inverted confocal microscope (Zeiss LSM 5 Pascal, Carl Zeiss). Number of

positive stained neurons determined by capturing at least 5 images per sample, and then

analysed with Zen lite 2012 software (Zeiss) or Image J software (NIH), under blinded

conditions.

Immunogold electron microscopic detection of TRPV1 in DRG neurons. Neurons

seeded on coverslips were treated with vehicle or 20 M DD04107 in HBSS for 1h (37

ºC, 5% CO2). Next, cells were incubated with 10 M ATP for 30 min in HBSS buffer

(37 ºC, 5% CO2). After washing with cold 0.1 M PB (pH 7.4), cells were fixed with 4%

(w/v) paraformaldehyde, 0.1% (v/v) glutaraldehyde and 15% (w/v) saturated picric acid

in 0.1 M PB for 2 h at RT. After washing with 0.1 M PB and then by 0.05 M Tris-

buffered saline (TBS), cells were blocked with 10% NGS in 0.05 M TBS for 1 h at RT

followed by overnight incubation at 4 ºC with anti-TRPV1 antibody (Alomone, 1.8

g/ml in 1% NGS in 0.05M TBS). Cells were washed with 0.05 M TBS and incubated

with goat anti-rabbit IgG-gold (1:100, Nanoprobes, 2003) in 1% NGS in 0.05 M TBS (1

h, RT). After washing with 0.05 M TBS and PBS, cells were fixed with 1%

glutaraldehyde, prior silver-enhancement with HQ SILVERTM kit (Nanoprobes, 2012).

Cells were rinsed in 0.1 M PB, post-fixed with 1% OsO4 (EMS, 19150), and block-

stained with uranyl acetate (EMS, 22400). Samples were dehydratated in a graded

concentration series of ethanol (50-100%), and embedded in Durcupan resin. After

polymerization, ultrathin sections (70-80 nm) were generated using an ultramicrotome

(Reichert Ultracut E, Leica) and collected on single slot pioloform-coated copper grids.

Ultrastructural analysis was made on a Jeol-1010 electron microscope (Jeol, Japan).

Gold particles were designated as cell-surface-associated only when they were in

contact with plasma membrane, as LDCVs-associated when immunoparticles were in

vesicles with electron-opaque component finally, remaining gold particles associated

with other intracellular compartments were considered to be cytoplasm. Immunogold

particle quantification was carried out using ImageJ. Data were expressed as percentage

of immunoparticles in each compartment. Diameter of LDCVs labelled with TRPV1-

immunoparticle was measured with Image J program, ensuring that non-consecutive

sections were analysed. TRPV1 antibody specificity characterized by HRP

7

immunocytochemistry in transfected HEK cell line and wild type and TRPV1-/- culture

DRG neurons.

Western Blot. After 48h culture of total DRG from 2 mice or neonatal DRG neurons

transfected with target siRNA, cells were washed twice with cold phosphate buffered

solution (PBS), lysed with lysis buffer (50 mM HEPES, 140 mM NaCl, 1 mM EDTA, 2

mM EGTA, 10% glycerol, 1% Triton X-100, 0.5% deoxycholic acid, 1% protein

inhibitor cocktail, pH 7.4), and centrifuged (10,000×g, 15 min). Protein content was

determined in supernatants with BCA method (Pierce, ThermoFisher). Equal amounts

of protein were loaded on 9% SDS-PAGE and transferred onto nitrocellulose

membranes for 45 min at 250 mA. Membranes were blocked 30 min with 5% w/v non-

fat milk in PBS-0.05% Tween 20 (PBS-T), and then incubated with anti-TRPV1

polyclonal antibody (Alomone, 0.08 µg/mL) or anti-actin polyclonal antibody (0.06

µg/mL) in blocking buffer overnight at 4 ºC. After washing with PBS-T, membranes

were incubated with peroxidase-conjugated goat anti-rabbit IgG (1/20000 dilution). The

immunoreactive bands were visualized using an enhanced chemiluminescence system

(ECL Select GE Health Care).

CGRP and SP release. Rat DRG neurons seeded in 96-well plate at 20,000 cells/well

were transfected for 48h with negative or target siRNA. After washing with HBSS, cells

were incubated with 100 µl of 40 mM KCl in HBSS for 10 min (37 ºC, 5% CO2).

Supernatants were collected, and CGRP and SP content were determined using the

commercially available CGRP EIA (Spi-Bio Inc) and SP EIA kit (Cayman Chemical),

according to the manufacturer’s protocol.

ATP-induced thermal hyperalgesia. Male mice from 12-15 weeks aged (WT, αCGRP-

/-, Tac1-/-, and αCGRP-/-xTac1-/-, n=8/genotype) were placed in individual plexiglas

chamber and allowed to acclimate for 30 min, 24 h and 48 h prior to baseline

measurements. The following day, after 30 min habituation, responses to noxious

thermal stimulation were measured by applying a radiant heat stimulus to the hind-paw

(Ugo Basile). The intensity of the radiant light was adjusted to obtain baseline latencies

of approximately 10 s in naïve WT mice with a cut off of 20 s. After baseline

measurement, saline or 100 nmol of ATP in 20 µl saline was injected in the left hind

paw with a 30 gauge needle, and 30 min after injection paw latency was recorded in the

8

injected paw. All behavioural experiments were made under blinded conditions of

treatments and genotypes.

Chemicals. DD04107 (BCN Peptides) freshly prepared at 20 mM in H2O. For Ca2+-

imaging, microelectrode array and electron microscopy, cells were incubated with

compound 20 µM DD04107 in HBSS for 1 h (37 ºC, 5% CO2). For electrophysiological

recordings, non-palmitoylated DD04107 (BCN Peptides) at 100 µM in standard internal

solution prepared from 10 mM stock solution in H2O. Peptide or vehicle were applied

through the patch pipette 10 min before recording. The CGRP receptor 1 antagonist

CGRP8-37 (Tocris Bioscience, R&D Systems) dissolved in 30% acetonitrile (v/v) at 100

µM and further diluted in HBSS at 250 nM. The neurokinin receptor 1 antagonist

CP96345 (Tocris Bioscience, R&D Systems) dissolved in DMSO at 20 mM and further

diluted in HBSS at 10 µM. Both antagonists applied with ATP. When not specified, all

chemicals were obtained from Sigma-Aldrich.

Data analysis. All data are expressed as mean ± SEM, with n as number of registered

cells and N as the number of experiments. The percentage of sensitized neurons was

calculated considering those cells that exhibited a fold potentiation above 1.2. Statistical

analysis was made using 1-way ANOVA or 2-ways ANOVA as required followed by

Bonferroni’s post-hoc test using GraphPad Prism 5.0 (Graph-Pad). MEA data were

analysed by Bonferroni’s post-hoc test as paired values through comparison of the

responses of each electrode along time. *p<0.05, **p<0.01, ***p<0.001.

9

Table S1. Percentage of sensitized capsaicin-responsive neurons.

vehicle DD04107

Control ATP Control ATP

Rat

DRG

saporin 9.1 ± 2.8 53.2 ± 7.7** 10.5 ± 0.5 47.2 ± 5.2**

IB4-saporin 7.2 ± 0.3 24.5 ± 10.3* 11.8 ± 0.2 19.8 ± 5.8

negative siRNA 11.7 ± 2.2 64.3 ± 4.1** nd 60.7 ± 5.6

αCGRP+Tac1siRNA 16.7 ± 3.8 54.9 ± 3.7** nd 59.2 ± 5.5

wild type 16.7 ± 8.3 48.6 ± 5.7* nd 36.3 ± 13.4

Mouse

DRG

αCGRP-/-xTac1-/- 27.0 ± 4.7 46.4 ± 6.2* nd 38.7 ± 10.3

Tac1-/- 10.4 ± 2.5 38.5 ± 6.7* nd nd

αCGRP-/- 12.3 ± 0.4 22.2 ± 4.1* nd nd

Data are expressed as mean ± SEM, n ≥ 3 cultures. One-way ANOVA, followed by Bonferroni’s

post hoc test, paired values for each culture. ATP compared to HBSS buffer treatment (control), **p<0.01, *p<0.05 nd: not determined.

10

Table S2. Percentage of labeled neurons from all isolated DRG.

WT αCGRP-/- x Tac1-/-

TRPV1+ 27.8 ± 1.6 28.1 ± 0.6

IB4+ 32.8 ± 1.9 33.1 ± 1.4

NF200+ 36.0 ± 1.0 36.8 ± 3.8

CGRP+ 54.0 ±7.8 19.3 ± 3.1

TRPV1+ x IB4+ 1.0 ± 0.4 0.5 ± 0.1

TRPV1+ x NF200+ 0.1± 0.1 0.2 ± 0.1

TRPV1+ x CGRP+ 40.8 ± 3.5 1.8 ± 1.4

CGRP+ x TRPV1+ 54.7 ± 3.7 3.7 ± 3.7

Data are expressed as mean ± SEM, n= 5 animals per group.

11

Table S3. Intrinsic electrogenic properties of TRPV1 sensitive DRG neurons in

wild type and αCGRP-/-xTac1-/- mice.

WT αCGRP-/-xTac1-/-

Vm (mV) -45.6 ± 2.3 (13) -44.9 ± 2.2 (21)

CT (pA) 12.5 ± 2.5 (12) 14.7 ± 3.0 (17)

TP (mV) -32.8 ± 1.6 (13) -33.5 ± 1.8 (15)

AP amplitude (mV) 67.0 ± 4.1 (12) 68.6 ± 4.3 (14)

AP overshoot (mV) 23.0 ± 2.6 (11) 19.5 ± 2.5 (14)

AP duration (ms) 21.5 ± 0.4 (13) 21.2 ± 0.5 (13)

AHP amplitude (mV) 9.2 ± 1.3 (13) 8.9 ± 1.6 (14)

Data are expressed as mean ± SEM (n). Vm: resting membrane potential; CT: depolarized

current threshold for evoking the first action potential; TP: threshold potential; AP action

potential; AHP: after hyperpolarization.

12

Table S4. P2Y2 receptor activity on cultured DRG neurons from wild type and

αCGRP-/- mice.

WT αCGRP-/-

% UTP responders 58.3 ± 6.7 59.5 ± 4.7

% UTP and capsaicin responders 67.5 ± 9.1 76.8 ±6.5

% capsaicin responders 44.1 ± 7.3 42.2 ± 8.7

% capsaicin and UTP responders 89.3 ± 4.3 93.7 ± 2.3

UTP intensity 110.1 ± 6.0 139.4 ± 9.0***

UTP intensity in capsaicin responders 119.0 ± 7.1 156.3 ± 10.5***

Capsaicin intensity 173.8 ± 7.5 176.5 ± 9.2

Capsaicin intensity in UTP responders 155.0 ± 12.7 179.2 ± 10.3

Values represent percentage of total neurons that respond to 100 µM UTP for 30 s and/or

capsaicin at 1 µM for 10 s. Intensity values represent mean peak of Ca2+-influx elicited by

UTP or capsaicin normalized to ionomycin 5 µM peak intensity. Data are expressed as mean ±

SEM, n > 100 neurons, N = 3 cultures. Statistical analysis was t-test; ***p<0.01.

13

Figure S1

14

Figure S2

15

Figure S3

16

Figure S4

17

Reference List

1. Salmon AM, Damaj I, Sekine S, Picciotto MR, Marubio L et al. (1999)

Modulation of morphine analgesia in alphaCGRP mutant mice. Neuroreport

10:849-854.

2. Cao YQ, Mantyh PW, Carlson EJ, Gillespie AM, Epstein CJ et al. (1998) Primary

afferent tachykinins are required to experience moderate to intense pain. Nature

392:390-394.

3. Truett GE, Heeger P, Mynatt RL, Truett AA, Walker JA et al. (2000) Preparation

of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris

(HotSHOT). Biotechniques 29:52, 54.

4. Baker MD, Bostock H (1997) Low-threshold, persistent sodium current in rat

large dorsal root ganglion neurons in culture. J Neurophysiol 77:1503-1513.

5. Bonnington JK, McNaughton PA (2003) Signalling pathways involved in the

sensitisation of mouse nociceptive neurones by nerve growth factor. J Physiol

551:433-446.

18

Supplementary Figure Legends

Fig S1. Silencing of aCGRP and Tac1 mRNA in neonatal rat DRG culture. (A)

Representative image of cultured rat DRG neurons transfected with siRNA-Cy3 (100

nM, 48 h). Arrows point to Cy3+ neurons, scale bar represents 100 µm. (B) Efficacy of

Tac1 and αCGRP silencing with siRNAs (100 nM, 48 h) on CGRP and SP protein

release after 15 min incubation with 40 mM KCl or HBSS buffer (control).

Fig S2. Characterization of αCGRP-/-xTac1-/- mice. (A) Genotyping of wild type,

αCGRP-/-, Tac1-/-, and αCGRP-/-xTac1-/- was performed as described in material and

methods. (B) Distribution of TRPV1 positive neurons in all isolated DRG from WT and

αCGRP-/-xTac1-/- mice. Data are expressed as mean ± SEM of percentage of total

TRPV1 expression neurons, n=5 animals per group. (C) TRPV1 total expression in

cultured DRG from WT and αCGRP-/-xTac1-/-, and neonatal rat DRG transfected with

negative or αCGRP+Tac1 siRNA. Actin expression was used as protein loading control.

(D) Capsaicin dose-response from wild type and CGRP-/-xTac1-/- cultured DRG neurons

by patch clamp recordings. Data represent mean ± SEM of current densities, n > 10

neurons, N = 3 cultures.

Fig S3. Size distribution of LDCVs containing TRPV1-immuno-gold particles.

(A,B) Diameters from labelled LDCVs were measured in cultured DRG neurons from

WT (A) and αCGRP-/-xTac1-/- (B) under physiological conditions as described in

material and methods. Data represent distribution of vesicle diameter expressed as

percentage of total LDCVs with TRPV1-immunogold particles and adjusted to a

Gaussian distribution. N = 3 independent experiments, n = 100-150 vesicles.

Fig S4. TRPV1 localizes in Piccolo-positive vesicles. Simple labelling

immunofluorescence shows the distribution of Piccolo (red) and TRPV1 (green) in

DRG neurons of wild type mice. Double immunolabelling (merge) shows the co-

localization of TRPV1 and Piccolo in vesicles close to the membrane plasma (yellow

arrows). Scale bar 10 μm