chapter 13: dna technology. with all our knowledge of dna and genes, is there any way to manipulate...
TRANSCRIPT
![Page 1: Chapter 13: DNA Technology. With all our knowledge of DNA and genes, is there any way to manipulate DNA? Genetic Engineering – form of applied genetics](https://reader036.vdocument.in/reader036/viewer/2022062421/56649e245503460f94b13313/html5/thumbnails/1.jpg)
Chapter 13: DNA Technology
![Page 2: Chapter 13: DNA Technology. With all our knowledge of DNA and genes, is there any way to manipulate DNA? Genetic Engineering – form of applied genetics](https://reader036.vdocument.in/reader036/viewer/2022062421/56649e245503460f94b13313/html5/thumbnails/2.jpg)
With all our knowledge of DNA and genes, is there any way to manipulate DNA?
• Genetic Engineering – form of applied genetics in which
genes/DNA are manipulatedEx. Genetic engineers believe they can improve
the foods we eat. Tomatoes are sensitive to frost. This shortens their growing season. Fish, on the other hand, survive in very cold water. Scientists identified a particular gene which enables a flounder to resist cold and used the technology of genetic engineering to insert this 'anti-freeze' gene into a tomato.
![Page 3: Chapter 13: DNA Technology. With all our knowledge of DNA and genes, is there any way to manipulate DNA? Genetic Engineering – form of applied genetics](https://reader036.vdocument.in/reader036/viewer/2022062421/56649e245503460f94b13313/html5/thumbnails/3.jpg)
DNA Technology
Science involved in the ability to manipulate genes/DNA
Purpose:
1. Treat diseases (Cystic fibrosis)
2. Treat genetic disorders (hemophilia, diabetes)
3. Improve food crops (better tasting veggies, longer shelf life, fungus resistance)
4. Improve human life in general (vaccines…)
![Page 4: Chapter 13: DNA Technology. With all our knowledge of DNA and genes, is there any way to manipulate DNA? Genetic Engineering – form of applied genetics](https://reader036.vdocument.in/reader036/viewer/2022062421/56649e245503460f94b13313/html5/thumbnails/4.jpg)
How is it all done?
Recombinant DNA TechnologySteps in the process:
-I. Isolation of DNA = extraction - II. Copying DNA with PCR
-III. Cutting DNA with restriction enzymes
-IV. Comparing DNA with gel eletrophoreisis
OR – V. use as vectors in recombinant DNA
![Page 5: Chapter 13: DNA Technology. With all our knowledge of DNA and genes, is there any way to manipulate DNA? Genetic Engineering – form of applied genetics](https://reader036.vdocument.in/reader036/viewer/2022062421/56649e245503460f94b13313/html5/thumbnails/5.jpg)
I. Isolate DNA.
• Remove tissue from organism
(You will do this in your DNA extraction lab)
• Store at 4°C
![Page 6: Chapter 13: DNA Technology. With all our knowledge of DNA and genes, is there any way to manipulate DNA? Genetic Engineering – form of applied genetics](https://reader036.vdocument.in/reader036/viewer/2022062421/56649e245503460f94b13313/html5/thumbnails/6.jpg)
PCR – Polymerase Chain Reaction
A genetic copy machine
• The polymerase chain reaction (PCR) is a rapid way of amplifying (duplicating) specific DNA sequences from a small sample of DNA.
![Page 7: Chapter 13: DNA Technology. With all our knowledge of DNA and genes, is there any way to manipulate DNA? Genetic Engineering – form of applied genetics](https://reader036.vdocument.in/reader036/viewer/2022062421/56649e245503460f94b13313/html5/thumbnails/7.jpg)
II. Copy DNA - PCR
• Polymerase Chain Reaction
• Uses DNA sample, DNA polymerase from T. aquaticus (hot springs)
• Think of this process as a molecular
copying machine
![Page 8: Chapter 13: DNA Technology. With all our knowledge of DNA and genes, is there any way to manipulate DNA? Genetic Engineering – form of applied genetics](https://reader036.vdocument.in/reader036/viewer/2022062421/56649e245503460f94b13313/html5/thumbnails/8.jpg)
III. Cutting DNA - Restriction Restriction enzymesenzymes
– Enzymes that can cut at particular locations in the DNA- DNA engineering today is totally dependent on restriction enzymes -Restriction enzymes are endonucleases - Think of them as molecular scissors
![Page 9: Chapter 13: DNA Technology. With all our knowledge of DNA and genes, is there any way to manipulate DNA? Genetic Engineering – form of applied genetics](https://reader036.vdocument.in/reader036/viewer/2022062421/56649e245503460f94b13313/html5/thumbnails/9.jpg)
What are restriction enzymes?
• Bacterial enzymes – used to cut DNA Different bacterial strains express different restriction enzymes
• The names of restriction enzymes are derived from the name of the bacterial strain they are isolated from
• Cut (hydrolyze) DNA into defined and REPRODUCIBLE fragments
• Basic tools of gene cloning
![Page 10: Chapter 13: DNA Technology. With all our knowledge of DNA and genes, is there any way to manipulate DNA? Genetic Engineering – form of applied genetics](https://reader036.vdocument.in/reader036/viewer/2022062421/56649e245503460f94b13313/html5/thumbnails/10.jpg)
Names of restriction endonucleases
• Titles of restriction enzymes are derived from the first letter of the genus + the first two letters of the species of organism from which they were isolated.
• EcoRI - from Escherichia coli • BamHI - from Bacillus amyloliquefaciens• HindIII - from Haemophilus influenzae • PstI - from Providencia stuartii • Sau3AI - from Staphylococcus aureus • AvaI - from Anabaena variabilis
![Page 11: Chapter 13: DNA Technology. With all our knowledge of DNA and genes, is there any way to manipulate DNA? Genetic Engineering – form of applied genetics](https://reader036.vdocument.in/reader036/viewer/2022062421/56649e245503460f94b13313/html5/thumbnails/11.jpg)
Source microorganism Enzyme Recognition SiteEnds produced
Arthrobacter luteus Alu I AGCT BluntBacillus amyloiquefaciens H Bam HI GGATCC Sticky
Escherichia coli Eco RI GAATTC Sticky
Haemophilus gallinarum Hga I GACGC(N)5 Sticky
Haemophilus infulenzae Hind III AAGCTT Sticky
Providencia stuartii 164 Pst I CTGCAG Sticky
Nocardia otitiscaviaruns Not I GCGGCCGC Sticky
Staphylococcus aureus 3A Sau 3A GATC Sticky
Serratia marcesans Sma I CCCGGG Blunt
Thermus aquaticus Taq I TCGA Sticky
![Page 12: Chapter 13: DNA Technology. With all our knowledge of DNA and genes, is there any way to manipulate DNA? Genetic Engineering – form of applied genetics](https://reader036.vdocument.in/reader036/viewer/2022062421/56649e245503460f94b13313/html5/thumbnails/12.jpg)
Restriction enzymes recognize a specific short nucleotide sequence
• For example, EcoRI recognizes the sequence
• 5‘- G/ A A T T C -3'
• 3'- C T T A A /G -5'
![Page 13: Chapter 13: DNA Technology. With all our knowledge of DNA and genes, is there any way to manipulate DNA? Genetic Engineering – form of applied genetics](https://reader036.vdocument.in/reader036/viewer/2022062421/56649e245503460f94b13313/html5/thumbnails/13.jpg)
Examples of restriction enzymes and the sequences they cleave
•Palindromes – same base pairing forward and backwards
![Page 14: Chapter 13: DNA Technology. With all our knowledge of DNA and genes, is there any way to manipulate DNA? Genetic Engineering – form of applied genetics](https://reader036.vdocument.in/reader036/viewer/2022062421/56649e245503460f94b13313/html5/thumbnails/14.jpg)
Let’s try some cutting:
• Using this piece of DNA, cut it with Eco RI
• G/AATTC
• GACCGAATTCAGTTAATTCGAATTC
• CTGGCTTAAGTCAATTAAGCTTAAG
• GACCG/AATTCAGTTAATTCG/AATTC
• CTGGCTTAA/GTCAATTAAGCTTAA/G
![Page 15: Chapter 13: DNA Technology. With all our knowledge of DNA and genes, is there any way to manipulate DNA? Genetic Engineering – form of applied genetics](https://reader036.vdocument.in/reader036/viewer/2022062421/56649e245503460f94b13313/html5/thumbnails/15.jpg)
What results is:
• GACCG AATTCAGTTAATTCG AATTC
• CTGGCTTAA GTCAATTAAGCTTAA G
Sticky end Sticky end - tails of DNA – easily bind to other DNA strands
![Page 16: Chapter 13: DNA Technology. With all our knowledge of DNA and genes, is there any way to manipulate DNA? Genetic Engineering – form of applied genetics](https://reader036.vdocument.in/reader036/viewer/2022062421/56649e245503460f94b13313/html5/thumbnails/16.jpg)
Blunt & Sticky ends
• Sticky ends – Creates an overhang. BamH1
• Blunts- Enzymes that cut at precisely opposite sites without overhangs. SmaI is an example of an enzyme that generates blunt ends
![Page 17: Chapter 13: DNA Technology. With all our knowledge of DNA and genes, is there any way to manipulate DNA? Genetic Engineering – form of applied genetics](https://reader036.vdocument.in/reader036/viewer/2022062421/56649e245503460f94b13313/html5/thumbnails/17.jpg)
IV. Gel Electrophoreisis• V. Analysis of DNA
DNA fingerprinting – – Banding pattern of the fragments of cut
DNA on a special gel medium (agarose)
![Page 18: Chapter 13: DNA Technology. With all our knowledge of DNA and genes, is there any way to manipulate DNA? Genetic Engineering – form of applied genetics](https://reader036.vdocument.in/reader036/viewer/2022062421/56649e245503460f94b13313/html5/thumbnails/18.jpg)
Purpose for DNA fingerprinting • Comparing banding
patterns to determine hereditary relationships between people
• Comparing banding patterns of 2 different species to determine evolutionary relationship
• Compare samples of blood or tissue for forensic purposes (who done it?)
![Page 19: Chapter 13: DNA Technology. With all our knowledge of DNA and genes, is there any way to manipulate DNA? Genetic Engineering – form of applied genetics](https://reader036.vdocument.in/reader036/viewer/2022062421/56649e245503460f94b13313/html5/thumbnails/19.jpg)
•Very accurate method of accessing DNA – 99.99%•Odds – 1 in 1,000,000,000• Does not work with identical twins•Use strands of DNA that have a lot of VNTRs
![Page 20: Chapter 13: DNA Technology. With all our knowledge of DNA and genes, is there any way to manipulate DNA? Genetic Engineering – form of applied genetics](https://reader036.vdocument.in/reader036/viewer/2022062421/56649e245503460f94b13313/html5/thumbnails/20.jpg)
How is it done?• VNTR analysis – variable number tandem repeats - we
each have non-coding segments on our DNA. Fragment lengths varies with each person
1. Extract DNA sample from blood or tissues
2. Cut DNA using restriction enzymes. Separate fragments by gel electrophoresis – separates DNA fragments by the # of base pairs (length of the fragment) and charge
3. Place DNA sample into wells in the agarose gel – molecular sieve
4. Run a current through the gel. The DNA (negatively charged) will migrate from (-) to (+)5.The larger fragments will not migrate that far. The small fragments will go the furthest
5. Stain gel and bands in a dye or use a radioactive probe to analyze the banding
![Page 21: Chapter 13: DNA Technology. With all our knowledge of DNA and genes, is there any way to manipulate DNA? Genetic Engineering – form of applied genetics](https://reader036.vdocument.in/reader036/viewer/2022062421/56649e245503460f94b13313/html5/thumbnails/21.jpg)
![Page 22: Chapter 13: DNA Technology. With all our knowledge of DNA and genes, is there any way to manipulate DNA? Genetic Engineering – form of applied genetics](https://reader036.vdocument.in/reader036/viewer/2022062421/56649e245503460f94b13313/html5/thumbnails/22.jpg)
Now that you have the desired gene or piece of DNA, what do you do with it?
• V. Recombinant DNA– Transfer of isolated gene to another
organism with the purpose of having the organism transfer the gene to another.
– Use bacterial plasmids
![Page 23: Chapter 13: DNA Technology. With all our knowledge of DNA and genes, is there any way to manipulate DNA? Genetic Engineering – form of applied genetics](https://reader036.vdocument.in/reader036/viewer/2022062421/56649e245503460f94b13313/html5/thumbnails/23.jpg)
1. The same restriction enzyme used to cut the desired gene, is used to splice the plasmid
2. Donor gene (desired gene) is then spliced or annealed into the plasmid
3. Plasmid is then returned to bacterium and reproduces with donor gene in it.
4. Bacterium with donor gene can transfer donor genes to organisms it infects.
![Page 24: Chapter 13: DNA Technology. With all our knowledge of DNA and genes, is there any way to manipulate DNA? Genetic Engineering – form of applied genetics](https://reader036.vdocument.in/reader036/viewer/2022062421/56649e245503460f94b13313/html5/thumbnails/24.jpg)
![Page 25: Chapter 13: DNA Technology. With all our knowledge of DNA and genes, is there any way to manipulate DNA? Genetic Engineering – form of applied genetics](https://reader036.vdocument.in/reader036/viewer/2022062421/56649e245503460f94b13313/html5/thumbnails/25.jpg)
How this works to help humans • Looking at the gene that produces insulin for the
treatment of diabetes:1. Isolate insulin gene from a healthy human2. Using a restriction enzyme, cut out insulin
producing gene3. Cut bacterial plasmids with same restriction enzyme4. Introduce human insulin producing gene to
bacterial plasmid5. Bacterial plasmid takes up gene - recombinant DNA6. Bacterial plasmid reproduces and starts expressing
insulin produce gene7. Insulin is produced and harvested from bacteria.
![Page 26: Chapter 13: DNA Technology. With all our knowledge of DNA and genes, is there any way to manipulate DNA? Genetic Engineering – form of applied genetics](https://reader036.vdocument.in/reader036/viewer/2022062421/56649e245503460f94b13313/html5/thumbnails/26.jpg)
• What has been produced is Recombinant DNA - DNA with genes from other organisms
• Transgenic organisms have introduced DNA from another species in them
![Page 27: Chapter 13: DNA Technology. With all our knowledge of DNA and genes, is there any way to manipulate DNA? Genetic Engineering – form of applied genetics](https://reader036.vdocument.in/reader036/viewer/2022062421/56649e245503460f94b13313/html5/thumbnails/27.jpg)
Practical Use of DNA technology
• Pharmaceutical products – insulin, HBCF (human blood clotting factor)
• Genetically engineered vaccines – to combat viral infections (pathogenic – disease causing) – your body recognizes foreign proteins, produces antibodies. Introduced viral proteins will trigger an immune response and the production of antibodies
• Altering viral genomes – makes them no longer pathogenic – now a vaccine
![Page 28: Chapter 13: DNA Technology. With all our knowledge of DNA and genes, is there any way to manipulate DNA? Genetic Engineering – form of applied genetics](https://reader036.vdocument.in/reader036/viewer/2022062421/56649e245503460f94b13313/html5/thumbnails/28.jpg)
• Increasing agricultural yields –– New strains of plants – GMO – Genetically Modified GMO – Genetically Modified
organismorganism. Try this one!!– Insect resistant plants – Insert gene that digests larvae
when larvae try to eat the plant – Not always specific to harmful species!! – Monarch problem
– Disease resistance – Fungal resistance in tomatoes, corn, soybean
– Herbicide resistance - *Round Up won’t harm the good plants, only the bad plants (weeds) – cheaper and less labor extensive than weeding
– Getting genes from Nitrogen fixing bacteria inserted into plants – fix their own nitrogen (a must for plants) in N poor soils
– Salt tolerant plants – can grow plants where high concentrations of salt in the air or soil
![Page 29: Chapter 13: DNA Technology. With all our knowledge of DNA and genes, is there any way to manipulate DNA? Genetic Engineering – form of applied genetics](https://reader036.vdocument.in/reader036/viewer/2022062421/56649e245503460f94b13313/html5/thumbnails/29.jpg)
• Improve quality of produce
- Slow down the ripening process – ship when unripened, to market when ripe
- Enhance color of produce
- Reduce hairs or fuzz on produce
- Increase flavor
![Page 30: Chapter 13: DNA Technology. With all our knowledge of DNA and genes, is there any way to manipulate DNA? Genetic Engineering – form of applied genetics](https://reader036.vdocument.in/reader036/viewer/2022062421/56649e245503460f94b13313/html5/thumbnails/30.jpg)
Why GM Foods?Why GM Foods?
![Page 31: Chapter 13: DNA Technology. With all our knowledge of DNA and genes, is there any way to manipulate DNA? Genetic Engineering – form of applied genetics](https://reader036.vdocument.in/reader036/viewer/2022062421/56649e245503460f94b13313/html5/thumbnails/31.jpg)
![Page 32: Chapter 13: DNA Technology. With all our knowledge of DNA and genes, is there any way to manipulate DNA? Genetic Engineering – form of applied genetics](https://reader036.vdocument.in/reader036/viewer/2022062421/56649e245503460f94b13313/html5/thumbnails/32.jpg)
![Page 33: Chapter 13: DNA Technology. With all our knowledge of DNA and genes, is there any way to manipulate DNA? Genetic Engineering – form of applied genetics](https://reader036.vdocument.in/reader036/viewer/2022062421/56649e245503460f94b13313/html5/thumbnails/33.jpg)
Safety and Environmental Issues• All food products are regulated by the:
Food and Drug Administration – FDA• Nat’l Institutes of Health Recombinant DNA
Advisory Committee and the Department of Agriculture (USDA)
• Environmental Protection Agency (EPA)• All set standards for safety procedures and
require permits and labeling (not in US though). Look for a 8 before the product code. 84011 – GMO banana
• Problem with transgenic foods is that an introduced gene may produce a protein that someone may be sensitive to. FDA does not require that on a label
![Page 34: Chapter 13: DNA Technology. With all our knowledge of DNA and genes, is there any way to manipulate DNA? Genetic Engineering – form of applied genetics](https://reader036.vdocument.in/reader036/viewer/2022062421/56649e245503460f94b13313/html5/thumbnails/34.jpg)
Gene Therapy • Treatment of a genetic
disorder (like cystic fibrous) by correcting a defective gene that causes a deficiency of an enzyme.
• Nasal spray that carries normal enzyme gene. Body makes enzyme and patient breathes normally. Regular treatments necessary
• Has not been proven to be successful in the long term
![Page 35: Chapter 13: DNA Technology. With all our knowledge of DNA and genes, is there any way to manipulate DNA? Genetic Engineering – form of applied genetics](https://reader036.vdocument.in/reader036/viewer/2022062421/56649e245503460f94b13313/html5/thumbnails/35.jpg)
Hello Dolly!
CLONING