CHARACTERIZATION OF MALARIA PARASITES, IN VITRO SELECTION OF ANTIFOL RESISTANCE AND ITS

DETECTION BY POLYMERASE CHAIN REACTION

THESIS SUBMITTED TO THE UNIVERSITY OF DELHI

FOR THE DEGREE OF

D O C T O R O F P H I L O S O P H Y

DECEMBER. 1 9 9 4

L A T H I K A N A I R

DEPARTMENT OF ZOOLOGY

UNIVERSITY OF DELHI

DELHI - 11 0 0 0 7

• 2 DEr'^mo

T5327

CERTIFICATE

T h e w o r k e m b o d i e d in t h i s t h e s i s i s o r i g i n a l a n d h a s b e e n c o n d u c t e d

in t h e D e p a r t m e n t of Z o o l o g y , U n i v e r s i t y of D e l h i , D e l h i . T h e w o r k

h a s n o t b e e n s u b m i t t e d in p a r t o r fu l l , to t h i s o r to a n y o t h e r U n i v e r s i t y

for a n y d e g r e e o r d i p l o m a .

D a t e i^l^ec. 3^ L a t h i k a N a i r

Head ' Prof. R. N. Saxena

Department of Zoology University of Delhi Delhi-110007

l/V^VkM^ Supervisor Dr. V. K. Bhasin

Department of Zoology University of Delhi Delhi -110007

ACKNOWLEDGEMENTS

/ take this opportunity to express my gratitude and sincere thanks to all those who have

helped me during the tenure of my research work.

It is with deep sense of gratitude and indebtedness that I take this momentous opportunity to

express my sincere regards to my supervisor Dr V.K.Bhasin for his , constant encouragement,

support, fruitful scientific and academic discussions which often provided a new insight into the

research problem. I am greatly obliged to him for his infinite patience, understanding, easy ap-

proachability, punctuality and unflinching moral support in face of odds which helped to finally

shape this thesis.

I express my gratefulness to the Head, Department of Zoology, Delhi University and other

faculty members in providing me with the necessary infrastructure and giving timely help and

guidance.

I am much obliged to Dr Fred Kironde oflCGEB (International Centre for Genetic Engi­

neering and Biotechnology) for his magnanimity in providing help whenever required.

I fall short of suitable words to express my deep sense of gratitude to my parents for their

love and affection, understanding, endless patience, inspiration, encouragement and moral sup­

port I wouldn't have been successful in completing this thesis without their blessings.

The constant encouragement and cooperation all along of Ms. Neera Mehra is thankfully

acknowledged.

My sincere thanks are due to my laboratory colleagues Ms. Swaty Nigam, MsAkhila

Aggarwal and Mr. Vikas Goel for their unstinted support and assistance specially during the final

compilation of this thesis.

I express my warm appreciation to Mr. Shashi Bhushanfor the assistance rendered in labo­

ratory work. I sincerely appreciate the help given by Mr EA. Daniel and Mr Ukilfor the photo­

graphic work. My thanks are due to Mr R. Bhandarifor his assistance.

Fellowship from University Grants Commission, Government of India, is duly acknowl­

edged.

CHARACTERIZATION OF MALARIA PARASITES, IN VITRO SELECTION OF ANTIFOL RESISTANCE AND ITS DETECTION BY

POLYMERASE CHAIN REACTION

GENERAL INTRODUCTION

Introduction to malaria 1-9

Outlineof this study 9-13

SECTION -1

Chapter 1 Antimalarial drugs, their known mode of actions and mechanisms of 14-33 drug resistance - a brief review

Chapter 2 Susceptibility of Plasmodium falciparum isolate and a clone to a few 34-52 antimalarial drugs in vitro

Chapter 3 Chemosensitivity of a chloroquine-resistant P. falciparum isolate to 53-60 quinine-type compounds in vitro

Chapter 4 Cure with cisplatin of murine malaria infection and inhibition in vitro 61-72 of a chloroquine resistant P. falciparum isolate

SECTION - II

Chapter 5 hi vitro selection ofP. falciparum resistant lines to dihydrofolate-reductase 73-94 inhibitors, CTOSS resistance and other related studies

Chapter 6 Characterization of pyrimethamine resistant P. falciparum lines with 95-117 a repetitive oligonucleotide probe and detection of resistance using mutation-specific polymerase chain reaction

REFERENCES 118-140

GENERAL INTRODUCTION

Introduction to malaria

From time immemorial malaria has been one of the most prevalent of hu­

man diseases, affecting particularly the population of tropical regions but also in

the past those of temperate climates. Inspite of decades of efforts at its control,

malaria continues to rank as one of the foremost infectious global diseases. Over

two billion people, half of the world's population, are exposed to the risk of the

disease and about 270 million acquire new infections each year (Peters 1990a).

According to World Health Organization (WHO) malaria kills every year between

1.4 to 2.8 million people, mostly children in Africa (TDR news 1994 ).

Causative agent

Malaria is caused by a protozoan parasite of genus Plasmodium. The genus

belongs to phylum Apicomplexa (formerly Sporozoa), of the animal subkingdom

Protozoa (Mehlhorn and Walldorf 1988). All members of the phylum are parasitic.

Plasmodium species exhibit two types of schizogony (asexual multiplication), an

exoerythrocytic schizogony without pigment formation and an erythrocytic

schizogony with pigment formation, in the chordate host and a sexual stage termi­

nating in sporogony in the female mosquito host. They are found infecting mam­

mals, particularly primates and rodents, birds and reptiles. Systematic position

of malaria parasites is as follows:

Phylum Apicomplexa

Class Sporozoea

Subclass Coccidia

Order Haemosporida

Suborder Aconoidina

Family Haemosporidae

Genus Plasmodium

3

with increase in parasitemia with each cycle, until it is impeded by drugs or the

host defence mechanisms. The gametocytes persist in the circulation for a limited

period of days and degenerate, if not picked up by an appropriate mosquito species

for their further development in the gut of the new host. After arrival in the

midgut of the mosquito the mature viable male gametocyte (microgametocyte)

undergoes an explosive transformation called exflagellation which gives rise to 8

motile microgametes. The microgametes set themselves free in search of a female

gamete (macrogamete), one arising out of each mature viable macrogametocyte.

Fusion of a micro and a macrogamete in the midgut of mosquito results in the

formation of diploid zygote. This stage transforms into an actively moving form

called ookinete stage and penetrates the midgut wall. The successful ookinete

lodge themselves inside the wall and round themselves up to transform into oo­

cysts. Meanwhile reduction division has occurred following recombination and

haploid genome is restored. The oocyst undergoes repeated mitotic divisions fol­

lowed by development and differentiation and release of thousands of infective

sporozoites into the hemolymph of the mosquito. These sporozoites find their way

into salivary glands of the host and are ready for initiating a new infection during

the next bite of the vertebrate host.

Rodent malaria parasite

The first isolation of rodent malarial parasite was reported by Vincke and

Lips (1948) from the African tree rat, Thamnomys surdartes and was named Plas­

modium berghei. Since then numerous species and subspecies of rodent malaria

have been discovered and described. They have been divided into two main series,

the berghei group, consisting of P. berghei, P. yoelii and P. y. nigeriensis and other

subspecies and the vinckei group consisting of P uinckei and P. chabaudi, which

also have several subspecies. About two hundred different strains of P. berghei

have been isolated from various rodent or from the natural vectors. P. berghei has

superseded the bird malarias, P. lophurae and P gallinaceum, in the utility for

experimental work on parasitism, immunology and chemotherapy of malaria.

Dozens of papers on these various subjects are being published every year point­

ing out the importance of rodent malaria in scientific research and most of the

primary screening of some 300,000 compounds developed during the past ten years

was performed using rodent Plasmodium (Landau and Boulard 1978).

Human malaria parasite

P. falciparum, P. vivax, P. malariae and P. ovale are the four species of ma­

laria parasite known to infect humans. Different species predominate in different

geographic regions, although transmission patterns can change with time. For

example, P. vivax was (and remains) the major species transmitted in parts of

India, but in recent years there has been resurgence off! falciparum transmission

in these areas. In Africa, P. falciparum predominates and P. vivax is virtually

absent (most Africans lack the complement of Duffy blood group substances that

define susceptibility to this parasite species) (Miller et al. 1976). P. malariae the

second most common species in Africa is also distributed in other geographic re­

gions. P. ovale is the least common species in Africa.

Disease symptoms and pathogenicity

Malarial paroxysms generally develop within a few days of inoculation of

infective sporozoites. They consist typically of sequential chills, fever and sweat­

ing, sever headache, abdominal pain, nausea and vomiting. Attacks coincide with

parasite multiplication in the red blood cells. As the parasite population in the

blood increases, the symptoms intensify, subsiding only when infection is termi­

nated by appropriate drug treatment or controlled by the host's immune system.

Falciparum malaria is the most dangerous form of the disease. Two important

biological features have been identified and implicated for its lethal potential.

First, asexual blood stage parasites can infect and develop in erythrocytes of all

ages, so there is no intrinsic limit on the potential magnitude of the parasitemia

5

(Wyler 1993). High parasi temia results in severe hemolysis and its a t tendant

complications. In contrast, P. uivax and P. ovale can develop only in young eryth­

rocytes (Pasvol and Wilson 1982), thus placing a relatively a strict limit on the

maximal magni tude of the parasi temia. P. malariae is also restricted to a sub-

population of erythrocytes, probably older ones (Pasvol and Wilson 1982). An­

other distinctive feature of P. falciparum is tha t electron dense extruberances,

called knobs, develop on the surface of erythrocytes containing ma tu re trophozoi­

tes or schizonts (Langreth et al. 1978). These knobs mediate binding of the in­

fected cells to post capillary venules, where the parasi tes undergo their terminal

matura t ion (called deep-vascular schizogony) and where the rup tu re of schizont

infected cells finally occurs. As a result of this sequestration, ma tu re intraeryth-

rocytic forms are rarely detected in blood smears of pat ients with falciparum ma­

laria. The combination of severe anemia (due to hemolysis of large number of

infected erythrocytes) and microvascular congestion tha t resul ts from deep vascu­

lar schizogony gives rise to tissue hypoxia and subsequently organ dysfunction;

the brain, kidneys and lungs are particularly susceptible. Although vivax, ovale

and malar iae infections are not generally life threatening, they can sometimes

cause severe, acute illness.

D i a g n o s i s and d e t e c t i o n of malar ia paras i te

Malar ia diagnosis is confirmed by the detection of the causative agent in

the blood of an infected individual. Microscopic detection of the paras i te has been

the mains tay of diagnosis in epidemiological surveys. The method is sensitive

enough to detect a parasi temia as low as 0.002% in a thick film using as little as

0.2 to 0.5 vil of blood (Bruce-Chwatt and Zuluera 1980). Even 20 to 40 parasi tes

^1 of the blood can be detected (on an average 1 ^1 of blood contains over five

million cells). For the detection of an individual case of malar ia the amount of

information obtainable by conventional light microscopy is remarkable . It allows

simultaneous identification of the plasmodial species and the stage of the parasi te

6

(Field et al. 1963). It also permits rapid estimation of the level of parasitemia, an

assessment of the degree of concomitant anemia and the presence of other blood

parasites- all within less than 30 minutes, including staining time. However, this

technique requires competent, committed and conscientious microscopist for cor­

rect diagnosis. It has often been the experience of may malariologists that due to

human error quite a few cases are erroneously diagnosed, this being more so dur­

ing peak malaria season and specially during the epidemiological surveys. This

shortcoming in the use of simple, inexpensive microscopic method calls for alter­

nate approaches for detection of malaria which not only take care of this problem

but could also tell the susceptibility status of the parasite to the antimalarial drugs.

Utility of various serological and immunodiagnostic methods has been explored

but they have proved to be of limited value as the detection is possible only if the

immune response has risen to a certain level. Also sometimes it is difficult to

differentiate between past and present infections (Bruce-Chwatt 1987). Another

promising approach being pursued to diagnose malaria is based on the use of nucleic

acid probes. Identification of unique characteristic nucleic acid sequences in the

genome of parasite species and presence of these sequences in the blood samples is

determined using complementary nucleic acid sequences, tagged either with ra­

diolabeled or non-radiolabeled compounds, as probes. Hybridization of these probes

to the corresponding sequence of the pathogen is monitored by the signals emitted

by the linked tags. This is a highly specific and sensitive method. This technique,

involving synthetic oligonucleotide probes, has been successfully employed in field

conditions in Kenya where parasitemia of 0.002% of infected erythrocytes could be

detected in 1 ^1 of blood sample (McLaughlin et al. 1987). Most of the work on

probe developments has been on P. falciparum. Recently Snounou et al. (1993)

have reported the use of polymerase chain reaction (PCR) for the identification of

the four human malaria parasite species. They used synthetic oligonucleotide

primer pairs which were complementary to genus and species specific sequences

7

present within the small subunit ribosomal RNA genes of the four human malaria

parasites, for the specific amplification by PCR to detect each malaria species.

Thus the present methods of malaria parasite detection range from microscopic

examination of blood smears, immunodiagnostic/serological approaches, DNA

based probe hybridization to in vitro amplification of specific nucleic acid sequences

of the pathogen. Of these, light microscopic method is the most popular and will

continue to play an important role in confirming the malaria diagnosis even in

near future for its sensitivity and simplicity. However, there exists a lot of scope

for future improvements in the detection techniques.

Malaria control

It is certainly frustrating to observe that inspite of considerable invest­

ments in term of human efforts and money spent during the last two decades or so,

no effective useful vaccine against human malaria has emerged and its control

still depends on breaking any of the several links in the chain of parasite develop­

ment through man and mosquito. Vector control and chemotherapy are the two

most important tools to control malaria.

Vector control

Human malaria is transmitted by various species of Anopheles mosquito.

Malaria transmission occurs in sub-Saharan Africa, parts of Asia, many countries

in Latin America and small transmission foci also exist in Greece, Turkey and the

Middle East (Wyler 1993). It is well known that epidemiology of malaria in any

region is influenced by the geographical, climatological conditions, type of vector

species- its bionomics, flight range, density etc., strains of parasites and immuno­

logical status of the human population. Malaria, therefore, is acknowledged as an

exclusively local phenomenon and any control programme has to be meticulously

designed depending upon the local situation and available resources. Early at­

tempts to control malaria vectors were directed at the immature aquatic stages in

their breeding places and involved either the use of larvicides or aimed at source

H

reduction. It might be a method of choice in some urban areas where houses may

outnumber the breeding places but in most rural areas where the number of breed­

ing places is astronomical this is a difficult approach (Davidson 1982). Then came

the concept of shortening the lifespan of adult mosquito to prevent the completion

of the extrinsic cycle of the malaria parasite. By spraying the resting places of

female mosquitoes with the residual insecticides dramatic results were achieved

in curtailing malaria transmission in early days of malaria eradication programme

(WHO 1971). Unfortunately, with the appearance of resistance to hydrochlorine

insecticides and the concern voiced by the environmentalists, the necessary switch

to use less persistent and more expensive insecticide has been forced in several

parts of the world. This also means that the future vector control must not solely

rely on insecticides but should always be integrated with environmental, biologi­

cal, educational and genetic methods.

Chemotherapy

Antimalarial drugs are employed both for curative and preventive purposes

(WHO, 1990). The use of drugs for prevention of diseases or protection from ma­

laria is referred to as chemoprophylaxis or chemoprevention. Antifolic drugs such

as pyrimethamine and proguanil are essentially prophylactic drugs that prevent

the maturation of the pre-erythrocytic forms developing in hepatocytes from the

sporozoites. Primaquine is more lethal to pre-erythrocytic stages of malaria para­

sites. Most of the therapeutic antimalarial drugs used are curative or suppressive

due to their blood schizontocidal properties. Quinine, a natural compound and

chloroquine, a synthetic affordable drug are the two most popular schizontocides

which had been given spectacular curative results. But in 1960 a new and threat­

ening event occurred in the history of chemotherapy with the emergence of strains

of P. falciparum resistant to the most widely used antimalarial therapeutic drug

chloroquine (Maberti 1960). The menace of resistance to chloroquine is now wide­

spread. It is a cause of concern as more and more strains of parasites from differ-

9

ent par t s of the world are being reported to be resis tant not only to chloroquine

but also to some other antimalarial drugs (Peters 1989). Appearance of these polyre-

sis tant s t ra ins of malar ia parasi tes has created an increasing clinical problem

especially in t rea tment of P. falciparum in several par ts of the world. At one time

it was confidently presumed tha t the disease will be subjugated with accumulated

weaponry against malaria, but experience has shown how sadly misplaced the

judgement was. Today the existence of resistance in mosquitoes to insecticides

and emergence of drug resistance in the parasi tes portray a grim scenario for fu­

ture management unless new, effective tools are invented to combat the menace.

OUTLINE OF THIS STUDY

The search for antimalarial drugs, both na tura l and synthetic, has been

and continues to be the most challenging and, at times, rewarding exercises ever

under taken by biologists and chemists. While most people engaged in the search

for new drugs agree tha t a rational approach based on knowledge of the int imate

biochemical pa thways of the target cells would be ideal as well intellectually sat­

isfying, hiost are reluctantly obliged to concede tha t up to present time, the chances

of success following a more or less empirical search have been far greater. Spec­

tacular advances in molecular biology and biochemistry in recent years , however,

are rapidly changing this situation. New techniques for the study of the biology of

malar ia parasi t ism and for the cultivation of both intraerythrocytic and tissue

stages o^ Plasmodium have opened up new avenues, not only for such fundamen­

tal studies but also for drug screening in vitro, the investigation of the modes of

action of ant imalar ia l drugs and the mechanisms of drug resistance. It is hoped,

therefore, the future research on antimalarial chemotherapy will hinge more on

int imate knowledge of the basic biology of the target organism and less on 'ran­

dom' screening. In the present study basically we have evaluated erythrocytic

schizontocidal properties of some natura l and synthetic compounds, a series of

10

progressively resistant P. falciparum lines to dihydrofolate reductase (DHFR) in­

hibitors have been selected in vitro and mutation-specific diagnostic primers have

been successfully used to discriminate the resistant and sensitive parasites by

polymerase chain reaction (PCR).

In the present work a local Plasmodium falciparum isolate together vi ith

one of its fastest multiplying clones have been used for studies in vitro and for in

vivo experiments a strain of P. berghei has been employed. Chapter 1 contains a

mini review on the antimalarial drugs, their known modes of action and mecha­

nisms of drug resistance with emphasis on antifols and chloroquine.

The characterization of erythrocytic stages of P. falciparum parasites with

regard to their susceptibility profile in vitro to some known natural antimalarial

drugs (quinine and artemisinin) and commonly used synthetic drugs (chloroquine,

amodiaquine, pyrimethamine and cycloguaniljagainst malaria has been described

in Chapter 2. P falciparum parasites have been found to be resistant to chloro­

quine and sensitive to all other natural and synthetic drugs evaluated.

In vitro relative chemosensitivity of erythrocytic stages of the chloroquine

resistant P/aZciparam isolate to quinine-type compounds has been given in Chap­

ter 3. Apart from natural cinchona alkaloids, quinine and quinidine, their hydro­

gen derivatives proved to be more potent erythrocytic schizontocidal compounds.

Some drug combinations show extremely good antimalarial property in vitro. Go­

ing by the 10^^ values of the eight preparations tested the compounds can be ar­

ranged in following order with respect to their schizontocidal activity:

quinidine/hydroquinidine > hydroquinidine > quinine/hydroquinine > quinidine

> hydroquinine/quinine > apoquinine > epiquinine.

Clearly in depth investigations are required for exploiting the full antimalarial

potentials of these cinchona derivatives or mixtures and other combinations.

Antiplasmodium properties of cisplatin (cis-platinum (II) diammine-dichloride),

a neoplastic drug, have been assessed using in vivo and in vitro model systems of

11

malarial parasite (Chapter 4). A well tolerated dose of 6 mg/kg body weight of the

compound cured the mice infected with P. berghei and the amount of cisplatin re­

quired for in vitro inhibition (IC^^) of a chloroquine resistant falciparum isolate was

lower than either chloroquine or quinine. Minimum inhibitory concentration (MIC)

needed to prevent the multiplication of asexual blood parasites in vitro was 30 ng/ml.

Late ring and trophozoite stages of erythrocytic cycle were most susceptible whereas

schizont and early ring stages were least sensitive to the toxic effect of cisplatin. Smaller

multiple doses had been the most effective in curing malaria in mice than a single

large dose. In a few cases, mice treated with a single intraperitoneal large dose of 6

mg/kg body weight, there was a delay in appearance of parasitemia but most of them

recovered completely although slowly. This compound exerts its toxicity mainly by

randomly damaging and cross-linking DNA strands as has been shown by Southern

hybridization using a synthetic oligonucleotide probe, which is a repeat sequence in

the falciparum genome. The report clearly demonstrates the antimalarial potentials

of this compound and suggests a closer evaluation of this and other related compounds,

specially in combination with antimalarial drugs to probe their synergistic proper­

ties.

Proguanil and pyrimethamine exhibit their antimalarial virtues by prefer­

entially inhibiting the DHFR enzyme of parasites. Pyrimethamine has been de­

ployed on a much larger scale than proguanil. These drugs have been extremely

useful in treatment of chloroquine resistant falciparum infection but the limiting

factor has been the quick development of resistance among the parasite popula­

tion against these drugs. Pyrimethamine resistance is known to be widely distrib­

uted in all malaria endemic areas of the globe, including India. Proguanil has not

been (extensively) used in India for over fifty years now. It should, therefore, be of

interest to know the susceptibility of pyrimethamine resistant and sensitive lines

of Indian origin to cycloguanil (the active metabolite of proguanil). These consid­

erations prompted us to perform a series of experiments with a view to assess the

potential usefulness of cycloguanil in circumventing and combating the problem

of pyrimethamine resistance in falciparum, which are presented in Chapter 5. It

has been found that falciparum lines resistant to pyrimethamine are selected much

faster than for cycloguanil resistance. Highly resistant pyrimethamine lines are

predisposed for faster selection to cycloguanil resistance. Resistance acquired to

pyrimethamine is stable. Pyrimethamine resistant parasites acquire a degree of

cross resistance to cycloguanil and to another DHFR inhibitor, methotrexate but

do not show any cross resistance to other groups of antimalarial drugs. Cyclogua­

nil and pyrimethamine induce the formation of gametocytes in non-gametocyte

forming clone. There has been no synergistic activity observed between cyclogua­

nil and pyrimethamine. The deployment of triple drug combination of py­

rimethamine, cycloguanil and sulfadoxine to impede the spread of resistance should

be seriously considered.

Characterization of pyrimethamine resistant P. falciparum lines with a re­

petitive oligonucleotide probe and detection of pyrimethamine resistance using

mutation-specific polymerase chain reaction has been presented in Chapter 6. In

vitro test methods have widely been employed for determining the drug sensitiv­

ity of P. falciparum isolates but there are several limitations that affect their use­

fulness in early diagnosis of resistant falciparum infection. Resistance in P. falci­

parum, to pyrimethamine and cycloguanil is known to be caused by point

mutation(s) in the DHFR encoding sequence of the parasite genome. Feasibility

of alternate assay methods for diagnosis of resistance to DHFR inhibitors based

on genetic characterization and alterations has been explored. Restriction frag­

ment length poljunorphism (RFLP) and Southern hybridization with 21-oligomer

probe, complementary to a repeat sequence existing in falciparum genome have

been successfully applied to demonstrate the ability of this approach to detect

prominent genetic alterations in the genome of highly resistant parasite DNA di­

gested with Taq I or Alu I restriction enzymes. This probe shows that Hind III

13

restriction sites remain unaffected in pyrimethamine resistant lines. The RFLP

studies clearly indicate that pyrimethamine causes point mutations in genome of

the resistant falciparum parasites at places other than the DHFR encoding re­

gion. Low levels of resistance to pyrimethamine escape detection by this tech­

nique. This approach can be used to discriminate highly resistant and sensitive

parasites but because of certain inherent shortcomings of Southern hybridization

this method might not be employed for diagnosis of resistance. Polymerase chain

reaction method has been explored to determine if mutation-specific primers can

be used to diagnose pyrimethamine resistant parasites. Using the recent guide­

lines (Mullis 1994) for primer selection and consulting the falciparum DHFR gene

sequence obtained from the databank (UNDPAVorld Bank/WHO/TDR), the selected

primers have been optimized for the most stringent annealing temperature which

could be employed for effective amplification and detection of pyrimethamine re­

sistance. These initial precautions led us to discriminate the sensitive and resis­

tant P. falciparum cell lines using the counter primer and the two diagnostic prim­

ers employed without compromising the sensitivity of the technique.

4^ W NJ i-"

n -13

n < cr re o 'o

o cr '^ 3

3 O

O n

R ^ 2. cr

o SL

>-' VO 0 0

o •

8 S ^ TO

^ l > U> ^ UJ | s j I—I

N n n cu Ll.

9 TO

o 3

TO

O O

3 3 3 3 o 2 o

3 3 g S Jl ft

" 8 g

1 3 a. « ^ -- 3 C 3 ft

O N o

o h o

ft

c

a

n

n o

ft

o

s a.

I rti

eg

3

3 .

"S

! 0

lO

Blood ^"r'^i" stream \,

in

o

Section -1

Chapter 1

ANTIMALARIAL DRUGS, THEIR KNOWN MODE OF ACTIONS AND

MECHANISMS OF DRUG RESISTANCE - A BRIEF REVIEW

Abstract- Brief historical review of antimalarial drug development and deployment shows tJtat en masse drug deployment for chemoprophylaxis and monotherapy inevitably results in quick selection of drug resistance in Plasmodia. Drug combiruitions survive longer. The chemical structure, biological activity and mode of action of important antimalarials of the century have been discussed. Mechanisms by which parasites become resistant to dihydrofolate reductase (DHFR) inhibitors have been identified to specific point mutations in the DHFR gene of the parasite, thus altering the structure of the enzyme which avoids affinity binding of the drug. Advent of resistance to chloroquine, the most affordable low cost drug, is a cause of concern. Our inadequate knowledge about the subject is updated and highlighted for inclusion in future research agenda among other listed priorities. Old remedies like 'qinghaosu', quinine and other cinchona alkaloids have brought new hopes for the time being.

INTRODUCTION

Around the turn of this century, malariology enjoyed certain vogue, in­

spired largely by : a) the interest of colonial powers in places where malaria was

rampant; b) the explorative expeditions to the tropical locations of the developing

world; and c) the exciting discoveries of Ross, Ehrlich and others. The popularity

and excitement in the study of malaria subsided for next few decades in favour of

prokaryotic infectious diseases. Short supply of the main antimalarial drug of the

time, quinine, was experienced during the two World Wars by the developed coun­

tries. This shortage in the meanwhile had instigated the efforts in malaria re­

search leading, immediately after the Second World War, to two dazzling events

which were to determine and dominate malarial strategy for next few decades.

The first was the success of the residual insecticides in dramatically curtailing

transmission of malaria in many countries and the second was the development of

more than one synthetic antimalarial drugs which became available in rapid suc­

cession. Never before had man stockpiled such powerful arsenals to rid himself of

malaria malady, so old an adversary. This led enthusiastically in 1955 to launch­

ing of malaria eradication programmes globally by the World Health Organization

(WHO), one of the largest international efforts to improve the health in the devel­

oping world, but the initial enthusiasm slowly faded due to several technical as

15

well as socio-economic factors and this venture finally ended in 1970 when WHO

decided to 'throw in the towel'. During this period support for further research

into malaria had dried up throughout the world. In the meantime casualties in­

flicted to the U.S. forces in Vietnam War by drug-resistant parasites prompted the

developed world to know more about the cure and prevention of malaria. This not

only revived but intensified research and funding into several aspects of biology

of parasitism of Plasmodium (causative agent of malaria) including molecular

biology, immunology, vaccinology and chemotherapy. The sudden surge of research

activity on Plasmodia demanded ever increasing supplies of the parasite mate­

rial, infecting man in particular, thus stressing an urgent need to tame the para­

sites in vitro. In 1976 Professor William Trager reported (Trager and Jensen

1976) the first successful continuous cultivation of erythrocytic stages of P. falci­

parum (causing malignant tertian human malaria) and this salutary breakthrough

stimulated further research activity related to malaria parasites. It also provided

a fresh impetus to monitoring of the emergence and spread of drug resistance in

falciparum throughout the world. This article discusses the basic structure and

biological activity of important antimalarial drugs used in the current century

with special emphasis to chloroquine and DHFR inhibitors, their modes of action

and mechanisms of resistance, analysis the causes leading to speedy selection of

resistant parasites, suggests measures to impede the spread of resistance and

future research strategies for development of new antimalarial drugs.

Basic Chemical Structure of Antimalarials

Known antimalarials have been variously grouped. They may be classified

based on the following basic chemical structures (Figure 1.1):

Pyrimidine derivatives: The amino groups at the 2 and 4 positions of the pyrimi-

dine forms the basis of synthetic antimalarials like pyrimethamine and other less

popular compounds.

Quinoline derivatives: Fusion of a pyridine and a benzene ring gives rise to a

16

bicyclic quinoline ring. It forms the basis of a number of synthetic antimalarial

compounds which are derivatives of the 4 or the 8 amino substituted quinoline.

Chloroquine, a 4-aminoquinoline and primaquine, a 8-aminoquinoline are the two

well known examples. Some of the natural cinchona alkaloids also have quinoline

in their structure, quinine for instance is formed by complex substitution at the 4

position of the quinoline ring.

Acridine derivatives: Acridine is a polycyclic compound formed by the fusion of

two benzene rings and pyridine. Mepacrine is an antimalarial drug which is a 9-

amino acridine derivative belonging to this group. It is largely obsolete as an

antimalarial for causing coloration of the skin and transient mental disturbances.

Non-cyclic derivatives: A few groups of antimalarials posses non-cyclic basic struc­

ture and substitution at some positions with benzene ring derivatives. They are

the biguanide and the sulfa compounds. The sulfa compounds may further be

grouped into sulfones and sulfonamides. Proguanil is an antimalarial drug de­

rived from biguanide. Sulfadoxine and dapsone are the derivatives obtained from

the modification of sulfonamide and sulfone, respectively.

Basic Biological Activity of Antimalarials

Antimalarial drugs can also be classified based on their predominant site of

action on the particular stage(s) in the life cycle of malarial parasite. There are

four species of Plasmodium {P. falciparum, P. vivax, P. ovale and P. malariae) usu­

ally known to infect man. Malaria results when the infective stages of the para­

site are injected into the bloodstream of man by an infected female Anopheles

mosquito. The sporozoites immediately take shelter within hepatocytes of the

host for further development. Maturation of all these intracellular protozoan

parasites finally results in the release of pre-erythrocytic merozoites, almost si­

multaneously in P. falciparum and P. malariae, whereas in P. vivax and P. ovale

some of the liver stage parasites may remain dormant for variable duration , for

17

months or years. These dormant stages are called hypnozoites, subsequently

blossoming into pre-erythrocytic merozoites, causing relapse of malaria . The

drugs which prevent the maturation of pre-erythrocytic stages are called tissue

schizonticides and those acting on the hypnozoites are known as anti-relapse drugs.

The pre-erythrocytic merozoites invade the red cells leading to the formation of

daughter merozoites, by schizogony (asexual division), which on release invade

the uninfected erythrocytes. The pathogenicity of malaria is chiefly due to syn­

chronized burst of erythrocytic schizonts leading to malaria symptoms, namely

fever, shivering, hemolytic anemia and sometimes (in infection with P. falciparum)

to cerebral malaria and death. Blood schizontocides are toxic or lethal to intraeryth-

rocytic parasites and thus releive the host of malaria symptoms. Some of the

merozoites on entering the erythrocytes start differentiating into the gametocytes

(sexual forms) instead of undergoing usual asexual multiplication. The mature

gametocytes will develop further only in the female Anopheles. The drugs which

prevent the formation or differentiation of sexual forms are termed as gametocyto-

cidal drugs, Male and female gametocytes form respective gametes which fertil­

ize in the stomach of the insect vector to form the diploid zygote. The zygote

continues its sporogonic development from oocyst to sporozoites. The compounds

interfering with the sporogonic cycle are recognized as sporontocidal compounds,

thus preventing the transmission of malaria. They have also been called anti-

sporogonic chemicals.

Mechanisms of Action and Resistance

The main technical reasons for the failure of malaria eradication programme

had been the development of resistance (exophilly) to residual insecticides by

insect vectors and the emergence of drug resistance in parasites to the antima­

larials. Improvements in malaria chemotherapy should result from better under­

standing of the mechanisms that govern drug action and drug resistance. The two

criterions of chemical structure and biological activity of antimalarials on plasmo-

18

dia have been clubbed for convenience to discuss some of the known modes of

action and resistance to antimalarial drugs.

1. Folate Pathway Blockers

A Mode of Action: Folate pathway blockers includes the antimetabolite drugs

which interfere with folic acid cycle of the parasite, in one way or the other. Re­

duced folic acid derivatives are indispensable cofactors for de novo synthesis of

pyrimidines in plasmodia. In the absence of any salvage pathway for the utiliza­

tion of exogenous pyrimidines, depletion in the pool of reduced folic acid deriva­

tives in the parasite milieu results in blocking of Plasmodium multiplication.

The folate pathway blocker antimalarial drugs can be grouped into two broad cat­

egories, the dihydrofolate reductase (DHFR) inhibitors and the sulfa drugs

which are structurally similar to para-aminobenzoic acid (PABA). Two commonly

used DHFR inhibitor antimalarial drugs are pyrimethamine and proguanil whereas

sulfonamides and sulfones are employed as antimalarials mostly in combination

with pyrimethamine.

Proguanil was developed in Britain during the Second World War. While

evaluating derivatives of pyrimidine, compounds of the chloroguanil series proved

promising, opening the pyrimidine ring further simplified the structure to bigu-

anide (Curdetal. 1945), which were to have good antiplasmodial activity. Thus progua­

nil (chloroguanide) was discovered. The efforts of British group in collaboration

with American scientists further culminated in the development of p5Timethamine

(Falco et al. 1951), first introduced in 1952 for routine human use. Both the drugs

are employed for prophylaxis and suppression of malaria infection in man. They

act on the dividing stages of the parasites but not on the dormant (hypnozoite) or

growing sexual stages ( developing gametocytes). They have the important prop­

erties of low toxicity. Pyrimethamine has added advantages of being effective in

much smaller doses and longer half life with slow excretion rate compared to

proguanil.

19

Proguanil and pyrimethamine act as antimalarial drugs by virtue of their

great affinity for the plasmodial enzyme DHFR (Ferone et al. 1969). The enzyme gets

inhibited following binding of the drug. DHFR catalyzes the conversion of dihy-

drofolate to tetrahydrofolate and occupies a key position in cellular biosynthesis

of purines, pyrimidines and certain amino acids. DHFR is present both in the

parasite and the host cells. The basis of selective action of these drugs is their

differential (greater) binding to the plasmodial DHFR and the extraordinary sen­

sitivity of this action to the nuclear division of the malaria parasite at the time of

development of schizonts in erythrocytes and in the liver tissue (Schellenberg and

Coatney 1967; Gutteridge and Trigg 1971; Inselburg and Banyal 1984; Janse et al.

1986). The affinity of P. berghei (rodent malaria parasite) DHFR for pyrimethamine

is 2000 fold greater than the mouse erythrocyte enzyme (Ferone et al. 1969). Progua­

nil is not active against plasmodia in vitro but one of its metabolite, cycloguanil

is the active intermediate having chemical structure somewhat similar to that of

pyrimethamine (Carrington et al. 1951) (Figure 1.1). The activation of proguanil to

cycloguanil is done by the mixed function oxidase system of the hepatic microsomes

(Armstrong and Smith 1974). It is not known if pyrimethamine and cycloguanil

bind to the same region of the plasmodial DHFR or occupy different sites.

Spectacular successes of sulfonamides as antibacterial drugs in 1930s led

to the evaluation of their antiplasmodial action. In 1937 the antiplasmodial activ­

ity of some of the derivatives was recognized against human malaria (Anand 1979).

The sulfonamides and sulfones exert activity against all actively dividing stages

in the life cycle of plasmodia. Among the human plasmodia P. falciparum is more

susceptible, whereas P. uiuax is less so (Bnice-Chwatt et al. 1981). The earlier devel­

oped sulfa drugs acted slowly for short duration and the need for high and poten­

tially toxic doses were responsible for their shelving, as also more reliable 4-

aminoquinoline compounds became available. However, advent of resistance to 4-

aminoquinolines has revived interest in sulfa drugs as they retain full activity

20

against chloroquine resistant parasites (Peters 1990a) and these drugs act syner-

gistically with the DHFR inhibitors (Bartelloni et al. 1967; Harinasuta et al. 1967).

The mode of action of the sulfonamides and sulfones against plasmodia is consid­

ered analogous. Antimalarial sulfa compounds are structurally similar to para-

aminobenzoic acid and the commonly accepted view is that these drugs are com­

petitively antagonized by PABA and non-competitively by folic acid (Watkins et

al. 1985). PABA is incorporated into the coenzyme folic acid; inhibition of folic

acid synthesis by these drugs has been demonstrated and the enzyme involved

was to be tetrahydropteric acid synthetase. Another study supports the view that

altered permeability of the erythrocyte membrane might be responsible for action

of sulfa drugs as dapsone has been demonstrated to accumulate at the surface of

rat erythrocytes (Canedella and Jarrell 1970), leading to the reduced uptake of glucose

in the erythrocytes and inhibition of glucose consumption by intraerythrocytic

parasite.

B. Mechanism of Resistance: The use of DHFR inhibitors as antimalarials has

been curtailed because of rapid development of resistance by the parasites. Shortly

after the release of each drug, prophylactic and therapeutic failures against Plas­

modium infections were reported (Peters 1970) from various places. Resistance to

DHFR inhibitors by several strains of Plasmodium has subsequently become a

major problem throughout the world. The ease with which resistance to DHFR

inhibitors developed both in the field and laboratory suggested that single muta­

tion in the Plasmodium DHFR segment of the genome might be enough to render

these drugs ineffective(Bishop 1962; Diggens et al. 1970; Peters 1987). The ex­

perimental evidence as to the genetic basis of resistance came from the analysis of

a cross between pyrimethamine resistant and sensitive lines of rodent malaria

resulting in inheritance patterns compatible with the involvement of just a single

gene locus (Walliker et al 1975, 1976; Knowlesi et al. 1981). Kinetic studies further re­

vealed that DHFR from resistant Plasmodium binds less tightly to py-

rimethamine, as there was marked increase in inhibition constant (K.) with re­

spect to this drug (Ferone 1970; Sirawaraporn and Yuthavong 1984; Mc Cutchan et al. 1984;

Walter 1986; Dieckman and Jung 1986), strongly suggesting the altered structure of the

enzyme DHFR in "resistant parasites. An important feature off! falciparum DHFR

is that the activity resides within a bifunctional protein together with thymidy-

late synthetase (TS) (Garrett et al. 1984). Another novel property of the DHFR

from resistant parasites is that it retains its normal enzymatic function but at the

same time inhibits binding of the drug. First complete sequence of DHFR-TS

was published in 1987 (Bzik et al. 1987). There work showed that as in Leishmania

there is a single intronless open reading frame that includes a junction region

linking the DHFR and TS domains. The DHFR domain extends from the N-termi-

nus to amino acid residue 225 approximately, while the TS domain occupies roughly

the final 290 amino acids of the protein leading to the C-terminus at residue 607.

The junction regions thus extends from about residue 225 to residue 320. Many of

the or postulated active site residues in both DHFR and TS are found to be con­

served in the P.falciparum molecule (Bzik et al. 1987; Cowman et al. 1988). The

DHFR-TS gene has been shown to reside on the fourth fastest chromosome in

several strains (Peterson et al,1988; Cowman et al,1988; Snewin et al,1989; Tanaka

et al,1990). Ever since, structure of the DHFR gene from number of resistant

and sensitive falciparum clones/isolates have been compared by sequencing. This

rapid accumulation of sequencing data has been made possible by in vitro ampli­

fication of DHFR region of the genome using polymerase chain reaction (PCR).

Analysis of sequence data of natural resistance in diverse number of geographical

distinct isolates shows that a single point mutation (resulting in Ser. 108 toAsn.

108 ) in the DHFR active site is perfectly linked to pyrimethamine resistance

(Table 1.1). Two ancillary mutations Asn. 51 to He. 51 andCys. 59 toArg. 59 were

found to be associated with increased level of resistance in association with Asn.

108 (Cowman et al. 1988; Peterson et al. 1988; Snewin et al. 1989; Tanaka et al.

22

1990). Experimentally induced resistance in P. falciparum using mutagens in

vitro (Banyal and Inselburg 1986) showed that amino acid changes at entirely

different sites than that seen in naturally resistant pyrimethamine parasites

(Inselburg et al. 1988; Tanaka et al. 1990). This clearly shows that there are

many sites in the DHFR gene where point mutations can alter the structure of

the enzyme, preventing or retarding drug binding, without compromising with

catalytic functions. More studies are needed to ascertain the extent of polymor­

phism of these sites in diverse geographical isolates.

The finding that specific changes in DHFR base pairs are linked to py­

rimethamine resistance indicated that point mutations might also be responsible

for resistance to cycloguanil. Sequence data analysis of cycloguanil resistant

DHFR revealed that parasites with paired Ser. 108 to Thr. 108 and Ala. 16 to Val.

16 mutations were found to be resistant to cycloguanil but showed only a slight

decrease in sensitivity to pyrimethamine. Parasites refractory to both the DHFR

inhibitors had three mutations in common Cys. 59 to Arg. 59, Ser. 108 to Asn. 108

and He. 164 to Leu. 164 ( Foote et al 1990; Peterson et al 1990). Identification of

specific mutations in DHFR segment of genome opens up the possibility of muta­

tion specific oligonucleotide probes, using PCR, capable of differentiating sensi­

tive and resistant parasites (Zolg et al, 1990).

Resistance to sulfas has not been widely recorded with human plasmodia.

For many years these drugs were exclusively used in combination with DHFR

inhibitors mainly pyrimethamine. Of late there have been reports of emergence

of resistance to these combinations from Brazil and Southeast Asia in P. falci­

parum (Brockelman and Tan Ariya 1982). There is, of course, little doubt that

Plasmodia resistant to the combination also are resistant to sulfas alone.

2. Quinoline-Containing Antimalarials (QCA) They essentially include blood

schizonticides (except for primaquine). Cinchona alkaloids (quinine) and other 4-

23

quinolinemethanol (mefloquine); chloroquine (4-aminoquinoline), primaquine (8-

aminoquinoline), are some of the drugs dealt in this section.

Cinchona Alkaloids :

Quinine, one of the major alkaloid components of cinchona bark, has saved

mankind from ravages of dreaded malaria disease for more than 350 years and

continues to cure malaria, any malaria even today ! It acts on the multiplying

asexual stages of the parasite but has no lethal effect on the exoerythrocytic stages,

it is gametocytocidal for P. vivax and P. malariae but toxic only to the developing

gametocytes of P. falciparum. Quinine toxicity to malaria parasite is based on

concentrative uptake of the drug in infected erythrocytes leading to cessation of

motility and haemozoin formation. It stands apart, in an era, when life cycles

(usefulness) of drugs are mostly expressed in decades rather than centuries.

Indiscriminate use of this drug shall definitely lead to selection of resistant strains

of Plasmodium, as had been the case in the past with other drugs. We can not

afford this to happen now, at the time when quinine seems to be the only effective

drug against the multi-drug-resistant (polyresistant) malaria strains. Time de­

mands the strategies to prolong and preserve the antimalarial efficacy of cinchona

alkaloids and derivatives. The question is how and why this drug has survived as

an effective antimalarial for so long. If that is answered then perhaps one might

be able to suggest ways to delay the emergence of resistance to this drug. Mostly

crude bark was used for preparation of powder and infusion. As we know now that

this extract from 'bark to bottle' contained not only quinine but other alkaloids as

well in varying amounts, some of them even more potent than quinine. Even

the 'pure' quinine salts, as quinine sulphate, available contained other cinchona

alkaloids (Smit,1987) to the extent of 16% in 1890, 8.5% in 1970 and 6% in 1986

(Figure 1.2). Clearly the alkaloid mixture used in the past for treatment, survived

in retaining the antiplasmodium virtues for centuries. Even modern medicine

24

advocates drug combination over monotherapy to prolong the Ufe span of the drugs

(Peters 1990c). Quinine is not the most effective of the four major alkaloids found

in cinchona bark. In vitro also some of the cinchona alkaloids and synthetic

derivatives are more potent than quinine (Nair and Bhasin 1993). It has reached

its unique position because it just happened to be the first to be isolated and used

in 'pure' form. Perhaps the solution to the malaria problem even today can be

rediscovered where it was first found - in the bark of cinchona tree. Of late,

increasing failure rates of old and new synthetic drugs has again drawn the at­

tention of research workers to the oldest natural antimalarial drug.

Mefloquine( 4-quinolinemethanol):

Mefloquine may be considered the third generation quinolinemethanols.

The first generation is represented by cinchona alkaloids, the second (less known)

by the compounds in which the cinchona side chain was modified with introduc­

tion of 2-phenyl substituent and the third by mefloquine in which the 2-phenyl

moiety is replaced by a trifluromethyl group (Figure 1.1.). Each generation of

quinolinemethanols brought an improvement in the therapeutic properties of the

representative drugs. Mefloquine is well-tolerated , effective in single dose against

P. falciparum, as its half life is for about 14 days in man, with cure rate of 100%.

It can be used as suppressive prophylactic drug for both vivax and falciparum

malaria. It does not have tissue schizonticidal activity and thus cannot produce

radical cure with relapsing malaria infections. It was first synthesized in 1971

and improved method of synthesis patented in 1978 (Sweeny, 1984) . Parasites

become quickly resistant to the drug specially chloroquine resistant ones. Thus it

has a limited utility for mass use as a single drug for malaria treatment . How­

ever, it can be beneficially employed in drug combinations with caution.

Chloroquine and other 4-aminoquinolines :

25

Presence of quinoline ring in the two antimalarials, quinine and pamaquine,

was known to the Germans by 1930. This prompted them also to explore several

derivatives of 4-aminoquinolines, resulting in the final selection of chloroquine

and sontaquine for further trials in North Africa. Sontaquine was preferred over

chloroquine by the Germans for being less toxic. Supplies of this drug together

with German research data were captured by United States forces in Tunis which

st imulated further studies in USA on these and other 4-aminoquinolines

(Coatney,1963; Peters,1987). Chloroquine was found by US workers to be the most

effective among them and less toxic on volunteers than any other. So the drug

which was synthesized in 1934 in Germany was rediscovered in USA in 1946.

Chloroquine and other 4-aminoquinolines have been found to be highly effective

against the asexual blood stages of all four species of malaria (prior to appearance

of resistant strains). They produce rapid clinical cure and are excellent suppres­

sive agents. Parasitemia disappears within 48-72 hours following standard thera­

peutic regimen. They are gametocytocidal agents against all human malaria para­

sites except mature P. falciparum gametocytes. Since release this inexpensive

drug has been widely used both for treatment and prophyleixis. Its consumption

had been progressively increasing for instance 265,052 kg base was actually con­

sumed in 1978 and the demand rose to estimated 351,229 kg base in 1985, repre­

senting respectively 177 million and 234 million adult therapeutic doses (WHO,

1984).By far the most enormously consumed synthetic antimalarial drug in the

history of mankind. Naturally, therefore, the most extensively studied antima­

larial at the same time surprisingly our knowledge about the mode of action of

this drug is far from complete. One wonders if this deplorable situation is due to

complexity of the subject matter or absence of appropriate technology to resolve

the knots or simply lack of more inquisitive minds to join the endeavour to unfold

the specific mechanism of drug action. Whatever might be the case, it calls for

periodical update about this riddle. If we knew the exact mode of action then per-

26

haps one could tackle more rationally the evolution of resistance to these drugs in

the parasites and design effective strategies to combat or contain the ever in­

creasing menace of resistance to chloroquine. We will restrict our deliberation to

some of the recent discoveries in this field as reviewed by Ginsburg and Krugliak

(Ginsburg and krugliak, 1992^.

Concentration ofQCA in Parasitized Erythrocytes :

QCA have variety of biological effects on plasmodia depending upon their

concentrations. Chloroquine concentration of 10 ' M, for instance, is sufficient to

bind ferriprotporphyrin IX (FP) and form toxic complex; concentration of 10" M or

greater inhibits lysosomal functions and concentration of 10" M or greater permit

drug binding to the major cellular constituents and , presumably, prevent their

functioning (Mc Chesney et al 1984). Most of the discussion on QCA relates to

chloroquine.

Inhibition of Lysosomal Functions:

QCA are amphiphillic weak bases and driven freely across the membranes

towards the acid digestive vacuoles of the malaria infected erythrocytes (Aikawa

1972). Extent of accumulation of the drug is dependent on the pH gradient of the

lysosomal vacuole and the extracellular medium (Yayon et al. 1984). Once inside

the acid vacuoles the QCA bases become protonated and their free permeability

across the membranes is reduced by several folds (De Duve et al. 1974). The pro-

tonation of the influxed bases in the lysosomal compartment causes temporary

alkalinization and is counteracted by the vacuolar proton pump (Geary et al. 1986).

Alkalinization inhibits metabolism in the lysosomes and decline in the pH gradi­

ent decreases the drug influx. It had, therefore, been postulated that drug accu­

mulation causes increase in the vacuolar pH resulting in inhibition of the vacu­

olar enzymes. Protease inhibitor, leupeptin, causes reversible cessation of diges­

tion in the parasite whereas impedance of digestive process due to QCA is nonre-

27

versible (Rosenthal et al, 1988). But there is insignificant change in the pH of

lysosomal vacuoles at the pharmacological level of QCA to cause any inhibition of

lysosomal functions, as has been demonstrated (Ginsburg et al, 1989).

Interaction of QCA with Ferriprotoporphyrin IX :

Intraerythrocytic parasite consumes internalized hemoglobin by proteoly­

sis in the lysosomes. Toxic residue FP or oxidized heme so formed is polymerized

by the parasite into a crystalline nontoxic substance called haemozoin or malaria

pigment. It has been proposed that chloroquine interferes with the formation of

nontoxic compound by complexing with FP , thus lethally poisoning the parasite

(Fitch 1983 ; Fitch 1986). These complexes not only contribute to inhibition of

digestion through their effect on the parasite's acid cysteine protease but also can

disrupt integrity of vesicle membranes resulting in lysis (Orjih et al. 1981; Fitch

et al. 1982). However, QCA treated parasitized cells do not show either morpho­

logical or biochemical disruption of the vacuolar membranes which corroborates

the finding that lytic effect of the complexes is prevented by the serum proteins

(Zhang and Hempelmann, 1987). Also the failure to demonstrate presence of

QCA in the necessary amounts are incompatible with this suggestion. This does

not rule out the possible role of QCA-FP complexes in the antimalarial action. In

fact, since they can be formed only in malaria-infected cells, they are good candi­

dates for accounting for the specific antimalarial actions. Inhibition of heme poly­

merase by QCA has been recently implicated as mode of action ( Slater and Cerami,

1992), also QCA preventing the release of iron from the acidified host cell cytosol,

a possible source of this trace element for the parasite has also been proposed

(Ginsburg and Krugliak, 1992).

Intercalation of QCA with DNA :

Chloroquine, quinine but not mefloquine have been found to inhibit DNA

28

synthesis by intercalating with DNA but at concentrations four orders above the

pharmacological levels of the drugs. Another serious flaw with this hypothesis is

that chloroquine has higher affinity to GC nucleotides (Cohen and Yielding, 1965)

but Plasmodia DNAs are AT rich (Weber, 1988), it is difficult to account for selec­

tive action of chloroquine against plasmodia.

Mechanisms of Chloroquine Resistance:

Advent of chloroquine resistance is one of the principal factors for the present

global resurgence of malaria. Resistance in the parasites may develop either due

to reduced accumulation of the drug or because of alterations in the drug target-

site of the parasite. Drug target has not yet been identified but there is ample

evidence that resistant strains of P. falciparum accumulate less chloroquine

(Krogstad and Schlesinger,1987). Decreased activity of vacuolar proton pump

(Ginsburgand Krugliak, 1989 has been implicated in reduced accumulation of the

drug in lysosomes and not due to the activity of any efflux pump. Acidotropic

chloroquine is driven to lysosomes by pH gradient maintained by hydrogen pump­

ing into the vacuole, slowing of the pump activity causes lowering of pH gradient

which in turn leads to reduced concentration of the drug in resistant parasites.

Drug resistance is associated with amplification of multiple drug-resistant (mdr)

genes and their products in cancer cells (Endicott and Ling 1989). By analogy

with this situation two mdr genes have been identified in P. falciparum (Wilson et

al. 1989) and one of them Pfmdr 1 is markedly homologous to human mdr gene

(Foote et al, 1989). In cancer cells mdr gene products are involved in efflux of the

accumulated drug but in malaria the existence of similar mdr vacuolar pumps

seems doubtful at present, mdr products might be involved in imparting resis­

tance by some other mechanism, also amplification of these genes have not been

found in all resistant falciparum strains. Sequencing of Pfmdrl gene showed that

resistant isolates differ by one to four nucleotides from chloroquine sensitive genes

29

in some strains but were same in others (Foote et al. 1990).

Resistance Reversers :

Compounds like verapamil (Martin et al 1987), diltiazem , vinblastine

(Ginsburg and Krugliak,1992) etc. are known to reverse drug resistance in cancer

cells. They are similarly effective in reversing chloroquine resistance in resistant

falciparum, mostly in vitro. A psychotropic agent, desipramine, is effective in re­

versing falciparum resistance at well tolerated dose in Aotus monkeys (Peters

1990a). Similarly cyproheptadine and several other related antihistaminic agents

have shown the ability to reverse chloroquine resistance against P. falciparum

both in vitro and in vivo. However, clinical applications against malaria is still

far from infancy.

Primaquine (8-aminoquinoline) :

Most widely used tissue schizontocide and antirelapse drug (for vivax and

ovale infections) since its introduction in 1940s. Its gametocytocidal and sporonto-

cidal virtues are important operationally, since a single dose might reduce the

transmission of drug-sensitive and resistant falciparum malaria. Clinically inef­

fective against asexual blood stages. Although primaquine is the safest available

8-aminoquinoline it does have significant toxic effect on individuals with glucose-

6-phosphate dehydrogenase deficiency. Primaquine inhibits parasite mitochondrial

respiration and this is probably the basis of its action. Not enough is known about

its exact mode of action and resistance status to this drug.

3. Artemisinin: Artemisia annua a herb of family Compositae has been used in

malaria therapy in China for over 1000 years but its active antimalarial compo­

nent, artemisinin or 'qinghaosu' was not isolated and characterized until 1972 by

the Chinese scientists. Artemisinin and a derivative, artemether, are capable of

curing patients with severe malaria resistant to most other drugs. Artemether

30

has been found to be more effective in preventing deaths from malaria than intra­

venous quinine - the traditional treatment for severe malaria. It is safe and fast

acting blood schizonticide, a potential life-saving advantage in severely ill pa­

tients. Some of its derivatives have recently been shown to possess better schizon­

tocidal and gametocytocidal properties in vitro (Mehra and Bhasin, 1993). Arte-

misinin has the structure of sesquiterpene lactone with an internal peroxide link­

age. The peroxide moiety appears to be indispensable for chemotherapeutic activ­

ity. The definitive mode of action of this series of drugs is still not known and

resistance to these compounds can be produced in vitro (Inselburg 1985). No doubt

this old remedy brings new hope for the time being if deployed judiciously.

Factors contributing to the selection of drug resistant parasites

In the following section some of the factors which are likely to play an

important role in the emergence and propagation of drug resistance in malarial

parasite are considered.

Mass drug administration: Most forms of mass drug administration employ the

medicament at subcurative doses, thus leading to the selection of less sensitive or

resistant parasites. This is of limited importance while malaria transmission is

interrupted or reduced to a very low level (Wernsdorfer and Kouznetsov 1980).

However, if drug pressure is exerted whilst transmission is intensive and unabated,

selection and subsequent propagation will be rapidly effected. This effect is most

marked under conditions of universal drug pressure as is exerted by the use of

medicated salt (Verdrager 1986 a,b).

Inadequate treatment: A strong correlation between the immune status and drug

response in areas with intensive malaria transmission has been observed espe­

cially in children of different age groups. For many years chloroquine was admin­

istered as a single dose of 10 mg/kg body weight for providing radical cure in semi-

immune subjects for instance in tropical Africa (WHO 1986). When infants and

children not sufficiently immune were treated with the same dose the drug failed

31

to provide radical cure. The dose was thus subcurative and therefore conducive to

the selection of resistant parasites (Gharry et al. 1988; Ramanamirija et al. 1985).

\bctorial factors: Studies in Central and West Africa indicate that the risk of

contracting chloroquine resistant P.falciparum is directly correlated to vector den­

sity and sporozoite rate (Brandicourt and Gentilini 1987). The propagation of

chloroquine resistant P. falciparum was quite slow in the areas of moderate and

low transmission where sensitive P. falciparum continues to prevail in spite of an

early onset of chloroquine resistance in the hyper-endemic lowland regions of Mada­

gascar ( Le-Bras et al. 1987 ).

Population mobility: Migration has been identified as a major contributory factor

to the occurrence and spread of drug resistance (Verdrager 1986 a,b). Migration is

an important determinant in the transportation of the infection to unaffected ar­

eas. Intensity of migration in association with a different intensity of drug use

may also cause major differences in the prevalance of resistant infections within

relatively small geographic areas as was shown in the example of two population

strata in Amazonian Brazil (Kremsner et al. 1989).

Biological advantage of resistant parasites over sensitive ones: Chloroquine resis­

tant P .falciparum differs in certain biological characteristics from chloroquine

sensitive populations. It has proved to be more infective to Anopheles stephensi

and also to produce large number of oocysts; an effect also observed in A. dirus

(Sucharit et al. 1977). Chloroquine may enhance the infectivity of chloroquine

resistant plasmodia to anophelines. This has been shown in P. herghei I A. stephensi

model (Ramkaran and Peters 1969). A marked decrease in sensitivity to chloro­

quine has been observed in P. falciparum isolates after continous growth for long

periods in vitro culture in the absence of drug pressure (Le Bras et al. 1980).

Lessons from P a s t :

History of drug resistance shows that whenever a new antimalarial was

deployed en masse for monotherapy and chemoprophylaxis resistance to the drug

Pyrimidine

CI

CH3 CH3 C2H5

Pyrimethamine Cycloguonil

Quinoline CH-. C,H 2"5

CH3O

NH-CH-CH2-CH2-CH2-N

^2^5

Chloroqulne

H H - C H - C H ^ - C H j - C H j - N H j

CH3

Primaquine

HO-CH CH30

IS1 CH=CH2

Quinine

Acridine

9»3 C,H

NH-CH-CH2-CH2-CH2-N / 2" 5

OCH-. \ C2H5

Mepacrine

Mefloquine

Sulfone

H2N-<Q-S02^Q>-N.

Dapsone

Sulfonamide

Biguanide

z\ r\ / • N H - C - N H - C - N H - C H

\ . NH NH

Proquanil

CH,

/ / V c n ^ u u - / " ^ -H 2 N - f ^;—SO2NH

Sulfodoxine

CHjO OCH^

Figure 1.1 Chemical structures ofantimalurial drujjs

32

appeared quickly. Life span of drug combinations had been longer. Misuse of

drugs has also contributed to the fast selection of resistant parasites, which should

be prevented as far as possible. Antimalarials should only be deployed as one of

the tools in an integrated malaria control programme. 'Think globally and act

locally' should be the guiding principle for any malaria control programme.

Future Agenda :

The current grim situation is a cause of concern to malaria epidemiologists,

indicating the urgent need to identify and develop alternate compounds capable of

curing resistant malaria. If there was more information on relationship between

in vitro antimalarial sensitivity and in vivo response to treatment, dose regimens

of quinine could be improved. Therapeutic concentrations of quinine need to be

defined in different countries where sensitivity of P. falciparum to the cinchona

alkaloids varies. Quinine should not be used alone. One of the most inexpensive

ways of searching new lead antimalarial compounds for drug development would

be to screen the drugs which have been developed for other diseases and evaluate

their antimalarial potentials, either alone or in combination with other drugs.

Searching of novel drugs empirically is expensive in time and resources. Ratio­

nal drug design is feasible if modes of action of drugs is known, so its highly

desirable to demonstrate how the proven drugs function at molecular level. Dis­

covery of the molecular mechanisms causing resistance is of utmost importance in

order to impede, reverse or contain the advent of resistance. Search for antire-

lapse and transmission blocking drugs should be a priority. New drug combina­

tions should be explored to which emergence of resistance is extremely difficult,

this strategy might bear fruits quickly, specially search for synergistic combina­

tions. Efforts should continue for the search of less toxic 'resistance reverser'

combinations. Ability of some oligos to revert DHFR resistant mutants to sensi­

tive lines in vitro by site directed mutagenesis should be tried as a first step.

33

Drugs toxic to plasmodia and capable of evoking immunogenic responses against

parasite will be of special interest. Potent new antimalarial combinations to be

developed should be inexpensive, nontoxic and administered under strict pre­

scription to limit their misuse. There should be separate class of drugs for pro­

phylaxis. Proper drug deployment, marketing and monitoring strategies will have

to be worked out.

Table 1.1 Positionsof amino acid residues that are different in pj'rimetlianiinc and cycloguanil

sensitive tu resistant isolates in the DilFR segment of the P. falciparum genome*.

Susceptibility of the isolate Amino acid residue

Pyrimethamine

S

R

S

HR

R

HR

Cycloguanil

S

S

R

S

R

HR

16

Ala.

Ala.

Vai.

Ala.

Ala.

Ala.

51

Asn.

Asn.

Asn.

He.

Asn.

He.

59

Cys.

Cys.

Cys.

Arg.

Arg.

Arg.

108

Ser.

Asn.

Thr.

Asn.

Asn.

Asn.

164

He.

He.

He.

He.

Leu.

Leu.

S = sensitive , R = resistant, HR = highly resistant

* compiled from the literature

1 8 9 0 1970 1986

D Qunine sulphate

• Cinchonidine sulphate

ESI Dihydroqunine sulphate

Figure 1.2 Composition of'quinine' from past to present

Chapter 2

SUSCEPTIBILITY OF PLASMODIUM FALCIPARUM ISOLATE AND A

CLONE TO A FEW ANTIMALARIAL DRUGS IN VITRO

Abstract: In vitro susceptibility of a local Plasmodium falciparum isolate together with one of its fastest multiplying clone to some known natural antimalarial drugs (quinine and artemisinin) and commonly used synthetic drugs (chloroquine, amodiaquine, pyrimethamine and cycloguanil) has been performed, using the modified 48 hour test method. Erythrocytic stages of the parasites have been found to be resistant to chloro­quine and sensitive to all other natural and synthetic drugs evaluated. Advantages of in vitro bioassay meth­ods for drug susceptibility testing has been discussed. Growth rates of the parasites have been found to be comparable to those of the parasites maintained in cultures in non-endemic areas, implying that serum supplement (obtained locally) employed in the medium for cultivation has no adverse effect on growth and multiplication of the parasites.

INTRODUCTION

The efficacy of drugs against falciparum infections has traditionally been

evaluated by observing the clearance of parasites from the blood stream following

administration of a drug in a subject. If the parasitemia is cleared with no subse­

quent recrudescence the drug is considered effective and the infecting strain re­

garded sensitive to the administered drug. It is obvious from this type of experi­

mental data that some strains of parasites are more sensitive than others to the

drug. Marked differences in susceptibility are sometimes observed, particularly

in strains of diverse geographical locations. However, with the emergence of chlo-

roquine-resistant strains of falciparum in 1960s, need for defining drug resis­

tance in malaria and standardizing procedures for assessing the varied responses

of P. falciparum to chloroquine and other antimalarials was strongly felt. Drug

resistance in malaria is defined by WHO (1967) as the "ability of a parasite strain

to survive and/or multiply despite the administration and absorption of a drug

given in doses equal to or higher than those usually recommended but within the

limits of tolerance of the subject". Although this definition can logically be ex­

tended to include all plasmodial stages, it has generally been restricted to de­

scribe the drug susceptibility of asexual forms, presumably because this stage in

the life cycle of the parasite produces acute clinical symptoms observed during

35

the course of malaria infection. Evaluation of drug resistance procedures in vivo

was proposed by WHO first in 1967 and then slightly modified in 1973 (WHO,

1967, 1973 ). The obvious problems associated with in vivo determination of the

drug susceptibility of P. falciparum has led to the development of simple in vitro

tests which can be easily performed both in laboratory and field conditions

(Rieckmann and Lopez Antunano 1971). The original in vitro microtest method

has been the most successfully applied diagnostic test for chloroquine-resistance

and was designated by the WHO as a standard test in 1979 (WHO 1979). Proce­

dure of Trager and Jensen (1976) for in vitro cultivation of falciparum stages has

given further impetus to modify and develop methods for in vitro determination

of susceptibility not only to chloroquine but also to other antimalarial drugs

(Nguyen-Dinh and Payne 1980). The results of in vitro assessment in most cases

show excellent concordance with the results of their assessment with in vivo sys­

tem. In vitro method has superseded the in vivo procedure for assessment of drug

susceptibility in some situations. Evaluation of the drug susceptibility of P. falci­

parum is now not only confined to those locations where drug resistance is a prob­

lem but test are also carried out in all endemic areas where falciparum infections

exist. Such susceptibility profile of local strains to antimalarials provide a baseline

data against which subsequent changes in the susceptibility of parasites can be

measured. Susceptibility status of local strains of P. falciparum to new drugs

should also be determined in areas where these drugs might be used in future.

Malaria is acknowledged as an exclusively local phenomenon and any control

programme has to be meticulously designed taking into consideration the suscep­

tibility profile and dynamics of resistance (if known) of the local falciparum fauna

to the antimalarial drugs. Over the last few years we have established in vitro

cultures of several P. falciparum isolates originating from Delhi. Clones have

been derived from some of these isolates. Susceptibility profile of some isolates

and clones has been determined in vitro to commonly used antimalarial drugs. In

36

this section sensitivity of an isolate and a clone, which have been employed in all

the subsequent work of the present study, to some antimalarials has been described.

In vitro cultivation procedures and their advantages in drug susceptibilty testing

have been discussed.

MATERIALS AND METHODS

Biological materials

Parasites: The isolate FCD-4 employed in the present study was procured locally

from a malaria infected patient reporting to a malaria clinic of malaria research

centre (MRC), Delhi. About 2 ml of blood was drawn aseptically, with the consent

of patient infected with P. falciparum, by venous puncture into a sterile heparin-

ized vial. The blood sample was transported to the laboratory for in vitro cultiva­

tion of erythrocytic stages within an hour. Soon after, the cultures were initiated

in vitro using candle-jar method of Trager and Jensen (1976). Once the isolate got

established in culture, clones were derived from it using limiting dilution method

(Rosario 1981). Several clones were realized and a few characterized with regard

to their multiplication ability in vitro. A clone F-56, one of the fastest growing

clone obtained was chosen for further studies.

Red blood cells and serum: Human erythrocytes and serum used for cultivation

of parasites were purchased from commercial blood banks. All blood products

used, were certified to be free from malaria, hepatitis, HIV etc. A unit of blood

(about 350 ml) obtained in acid citrate dextrose or citrate phosphate dextrose was

dispensed aseptically in 50 ml aliquots and stored at 4 °C . The stored blood was

used upto four weeks. Erythrocytes of A+ blood group were used in all studies.

For serum, 2-3 units of AB+ blood at a time were collected without any anticoagu­

lant. It was stored at 4 °C atleast overnight to retrieve maximum amount of

serum. The serum was harvested by centrifugation of this stored coagulated blood

and distributed in 40 ml aliquots in sterile flasks. These serum samples were

37

kept at -20 °C till further use. Prior to use the stored serum was thawed and heat

inactivated by keeping it for 30 min at 56 "C.

Reagents

Medium: For one litre of medium 10.4 g of powdered RPMI-1640 with L-glutamine

but without bicarbonate (obtained from Sigma) was dissolved in 900 ml of glass

redistilled water. TD this 5.94 g of HEPES buffer and 40 mg of gentamicin were

added (RP-C). The above components were thoroughly mixed with the help of a

magnetic stirrer and the final volume adjusted to 960 ml. This medium was imme­

diately filter sterilized through 0.45n presterilized millipore filter under negative

pressure, aseptically in a flow hood. The sterilized medium was dispensed in 100

ml volumes into sterile screw cap bottles for storage in refrigerator. Each bottle

was numbered and dated. The pH of the buffered medium was made to 7.2 just

before use by adding sterilized 5% sodium bicarbonate solution at the rate of 4.2

ml per 96 ml (RP+C) medium. The RP+C medium was supplemented with 10%

(v\v) heat inactivated serum to be used as complete medium (RPS) for cultivation.

Complete medium could be stored at 4 °C upto one week in closed bottles. The RP-

C was consumed within four to five weeks.

Cryoprotectant: It was prepared by adding 70 ml glycerol to 180 ml of 4.2% sorbi­

tol in 0.9% NaCl and filter sterilized to be used as cryoprotectant solution for

freeze-storing of parasites.

Thioglycollate medium: Thioglycollate medium, 29.8 g (powder) was mixed in 1

litre of glass distilled water and heated slowly so as to dissolve it completely. This

solution was dispensed in 10 ml volumes into glass tubes with cotton plugs and

autoclaved at 15 lbs for 20 min. Tubes were stored at 4 °C for subsequent testing of

bacterial contamination in medium or blood products.

Drug solutions The stock solutions concentration and methods of preparation of

the * various drugs employed in this study are tabulated below.

38

Drug Source Concentration of Stock Solvent

Chloroquine Amodiaquine Pyrimethamine Cycloguanil Quinine Artemisinin

Sigma Chemicals Sigma Chemicals Sigma Chemicals ICI Pharmaceuticals* WHO* WHO*

40 mg/ml base 10-2 M 10-2 M 10-2M 10 mg/ml 1 mg/ml

Water Water Lactic acid Ethanol Sulfuric acid DMSO

gifts from these agencies

Each of these stock drug solutions was filter sterilized through 0.2 mm

cellulose acetate millipore sterile disposable syringe filter and stored at - 20 °C.

Test or working solutions were prepared by appropriately diluting the stock solu­

tions with complete medium (RPS). All the test solutions were kept at 4 °C.

PROCEDURES

Maintenance of P. falciparum parasites in vitro

Sterility test: All media, blood and glassware must be sterile for culture work.

The glasswares were autoclaved and baked. The sterility of the glassware was

ensured by the pressure and heat indicator tapes. To test the sterility of media

and blood products, 1ml of test solution was mixed with the sterile thioglycoUate

medium. The tube was incubated at 37 °C for 4 days. If thioglycoUate solution

remained clear, the tested product was considered free of bacterial contamination.

Red cell preparation (washed erythrocytes): Human erythrocytes obtained from

blood bank were centrifuged at 2500 rpm for 5 min. Supernatant and buffy coat

were aspirated out. The pellet was resuspended in 5-10 volume of RP+C medium

and spun again to remove any residual anticoagulant. The cells were washed

twice this way and finally the pellet of red cells was resuspended in an equal

volume of complete medium (RPS) to give 50% cell suspension.

Cultivation of parasites in vitro: Parasites were cultivated using the Petridish

candle jar method of Trager and Jensen(1976). The parasite material was drawn

into a sterile syringe from a flow vessel, in which stock cultures of parasites were

39

routinely maintained in the laboratory (Trager 1979). The material was trans­

ferred to a graduated centrifuge tube and centrifuged at 2000 rpm for 10 min.

Supernatant was discarded and packed cells were resuspended in equal volume of

complete medium. Thin blood smear was made from this 50% infected cell sus­

pension. The slide was fixed in methanol and stained in 5% Giemsa's stain pre­

pared in 0.067 M phosphate buffer. The slides were air dried and microscopically

examined under oil immersion magnification (1000 X). Differential parasite count

was made to determine the extent of dilution required, if any. Parasite material

was diluted with 50% suspension of non-infected erythrocytes. Cultures were ini­

tiated with less than 1% of infected erythrocytes. Appropriately diluted parasite

material of 50% cell suspension, 2 ml of which was mixed with 10 ml of complete

medium (RPS) so as to give a final suspension or hematocrit of 8%. This material

(about 12 ml) was dispensed in a glass Petridish (10 cm in diameter). The Petridish

was placed in a desiccator equipped with a stopcock. The gas phase was generated

by burning a white candle in the desiccator jar holding the Petridishes until the

flame extinguished; the stopcock was closed immediately. The candle jar, holding

parasite material in Petridishes, was placed at 37 °C in an incubator. The me­

dium was removed daily by gently tipping the Petridish and aspirating off the

medium. All this was done under sterile conditions in a flowhood. The dishes were

then replaced in the candle jar. Culture growth was routinely monitored every 48

hour from thin blood smears stained in Giemsa solution. Differential parasite

count was made by counting atleast 5000 erythrocytes. If parasitemia was found

to be more than 5% subcultures were prepared.

Cryopreservation: Cultured parasite material was periodically stored in liquid

nitrogen for recultivation. Parasites were cryopreserved by a modified method of

Rowe et al. (1968). Cryopreservation of parasite materialwas done when num­

ber of parasites per 100 red cells exceeded 5 in a Petridish and majority of para-

40

sites were in ring stage. The parasite material was transferred to a graduated

centrifuge tube and centrifuged at 1500 rpm for 10 min. Supernatant was dis­

carded and the packed cells mixed gently with an equal volume of cryoprotectant

and 1ml each of this suspension was transferred into sterile, screw-capped plastic

cryovials. These vials were immediately dipped in liquid nitrogen and stored in

liquid nitrogen cryocan.

Resuscitation of parasites: Cryopreserved parasites were revived by bringing the

cryovial from liquid nitrogen to a 37 °C water bath (momentarily loosening the

cap to vent any compressed nitrogen). On thawing, contents of the vial were trans­

ferred to a centrifuge tube, spun at 1500 rpm for 5 min, supernatant discarded

and packed cells suspended in an equal volume of 3.5% sterile sodium chloride

solution. The saline suspension of cells was recentrifuged to discard the saline,

packed cells washed twice with complete medium and finally made to 50% cell

suspension with complete medium. To this, equal volume of freshly washed unin­

fected 50% suspension of erythrocytes was mixed. The mixture was made to 4%

hematocrit by adding complete medium supplemented with 15% heat inactivated

pooled serum in a glass Petridish (5 cm diameter) and parasites grown by candle

jar method.

Susceptibility test method

Erythrocytic schizontocidal activity of each compound at graded concentra­

tions was evaluated in vitro using the modified 48 hr test method of Nguyen-Dinh

and Payne (1980). The parasite material was drawn from stock continuous cul­

ture, centrifuged and pelleted cells suspended in 2.5 volume of 5 % sorbitol and

incubated at room temperature for 7 min. Mostly the ring stage parasites sur­

vive this treatment. The sorbitol treated parasites were washed thrice with RP+C

medium. The pellet was finally resuspended in an equal volume of complete

medium to give 50% suspension of infected erythrocytes. This infected material

was appropriately diluted with 50% washed, uninfected erythrocytes so as to get

41

the final parasitemia of less than 1% (zero hour) to be used as seeding material

for susceptibility tests. Aliquots of 20 ^1 of this seed material was added to each of

the series of wells, in 24 well sterile plastic tissue culture plates, holding 480 ^1

of complete medium with or without drug. The final erythrocyte suspension in

these experimental wells was thus 2%. The experiment was done in duplicate for

each drug concentration. After thoroughly shaking the multiwell plates to ensure

resuspended and uniform settling of erythrocytes, the plates were placed in candle

jar and incubated at 37 °C. After 24 hours of incubation, medium in each well was

replaced with or without drug. Drug was included at same concentration as ini­

tially and plates returned to candle jar. Cultures were under continuous drug

pressure for 48 hour, at the end of this period a thin blood film from each of the

well holding control and drug treated parasite material was made. Slides were

stained with 5% Giemsa solution and number of parasites counted by enumerat­

ing atleast 5000 erythrocytes. Percentage inhibition of parasites in relation to

control was calculated. MIC, ICg,, and IC j, values were determined from semilog

plot of percentage inhibition against drug concentration.

RESULTS

In vitro cultivation of P. falciparum

A vial each of cryopreserved material of P. falciparum isolate FCD-4 and

clone F-56 was retrieved from the liquid nitrogen storage container to initiate in

vitro cultures of these parasites separately. Once the parasites started multiply­

ing to an extent of atleast four fold in an erythrocytic cycle (from starting para­

sitemia of less than 1%) they were further maintained in a routine medium (RP+C)

supplemented with 10% serum (RPS). This usually took not more than 6 days of

culture, if properly cryopreserved material was used for resuscitation. Freeze pre­

served material when initiated into culture retained synchronous multiplication

for first one or two schizogonic cycles and subsequently grew asynchronously. An

42

erythrocytic cycle is of about 48 hours duration. During this period intraerythro-

cytic parasites undergo morphological changes leading to the formation of ring,

trophozoite and schizont stages. Rupture of a schizont releases merozoites, the

only extracellular form, which reinitiates the erythrocytic cycle on invading an

uninfected red cell. A representative Giemsa stained thin blood film preparation

from cultured parasite material showing various asexual and sexual stages is pre­

sented in Figure 2.1. The ring stage is the youngest intraerythrocytic stage of the

parasite occupying approximately one fifth of the red cell area. Host red cells at

this stage were least modified with regard to morphology or membrane permeabil­

ity. A typical 'signet' ring stage occupied first 18-24 hours of an erythrocytic cycle

before being transformed into the trophozoite stage. A growing trophozoite could

be seen as a small round mass of blue cytoplasm with one red chromatin dot or

area and a small clump of brown pigment. The more mature or nucleus dividing

stage is called schizont which looks like a large trophozoite containing more than

one chromatin dot. Each nucleus with cytoplasm surrounding it is called merozo-

ite, may be seen in a schizont. Fully formed merozoites released from a mature

schizont can be seen in the Figure 2.2. Occasionally developing sexual stages,

called gametocytes and often multiple infection of red cell can also be found in

cultures. Atypical distribution of different erythrocytic stages in a culture started

from ring stages after first and second schizogonic cycle is depicted in Table 2.1.

Table 2.1. A differential parasite count made at the end of first and second schizogonic cycles of in vitro cultivated parasites in multiwell plates with starting hematocrit of 4%, showing typical profile of erythrocytic stages in the cultures.

Schizogonic cycle

0 hour First Second

R*

36 110 259

T

0 18 48

FCD-4 S

0 29 86

TP

36 157 393

%P

0.72 3.14 7.86

R

32 138 414

T

0 26 87

F-56 S

0 27 111

TP

32 191 612

%P*

0.64 3.82 12.24

R= rings, T= trophozoites, S= schizonts, TP= total parasites, %P= % parasitemia

43

Usually a parasite produces by asexual multiplication (schizogony) 8 to 24

merozoites. But only some of these merozoites succeed in invading and multiply­

ing further. This determines the rate of multiplication and to monitor the growth

of parasites, thin smears were made after every 48 hours for two consecutive cycles

from each of the well holding either FCD-4 or F-56 culture material. Parasitemia

was enumerated from the stained slides by counting about 5000 erjrthrocytes. Mul­

tiplication factor (MF) and parasite multiplication rate (PMR) were determined

using the following formula (Brokelman et al. 1985):

For the first schizogonic cycle MF = N (day 2) / N (day 0)

where N is the number of parasites per 5000 erythrocytes on the. day indicated.

Thus the MF from day 2 to day 4 was = N (day 4) / N (day 2)

Because multiplication is exponential (theoretically for first few cycles), a loga­

rithmic transformation was used as follows:

Log MF = log N (day 4) - log N (day 2)

Log MF has been referred as the parasite multiplication rate (PMR). Results re-

g£irding MF and PMR for the isolate and clone are presented in Table 2.2.

Table 2.2 In vitro parasite multiplication as determined by multiplication factor

(MF) and parasite multiplication rate (PMR) in multiwell tissue culture plates,

(refer to the text for explanation of MF and PMR)

Parasite Erythrocytic schizogonic cycle First Second

MF PMR MF PMR

FCD-4 4.36 0.64 2.5 0.4

F-56 5.96 0.78 3.2 0.5

44

Parasites were periodically cryopreserved for subsequent use from culture

plates having more than 7-8% parasitemia with majority of parasites in the ring

stage. This type of freeze-stored material revived fast, mostly within 4 to 6 days of

resuscitation cultures could be grown in a routine medium supplemented with

10% serum.

In vitro susceptibility to antimalarials

The response of the parent isolate FCD-4 and one of its derived clone F-56

to the various antimalarials evaluated in vitro were as follows:

Chloroquine: Figure 2.3 shows the drug dose response for chloroquine in the

isolate FCD-4 and clone F-56 after 48 hours of incubation. The ICg and ICg val­

ues of chloroquine were found to be 0.018 jAg/ml and 0.07 ng/ml for FCD-4 and

0.015 ng/ml and 0.027 jig/ml for clone F-56.

Amodiaquine: Susceptibility of the parasites to various concentrations of

amodiaquine is illustrated in Figure2.4. Interpolation of the drug dose response

curve to determine concentrations that caused 50% and 90% inhibition of parasite

growth gave values of 6.8 x 10-» M and 5.4 x 10-« M for FCD-4 and 1.7 x 10" M and

7.4 X 10'® M for clone F-56, The clone was found to be slightly more sensitive to

this drug since complete inhibition of clonal parasites was achieved at a concen­

tration of 10'* M whereas in the isolate it was observed at 10'' M of drug concen­

tration.

Pyrimethamine: Sensitivity of the isolate FCD-4 and clone F-56 to graded con­

centrations of pyrimethamine in vitro is presented in Figure 2.5. Drug concentra­

tion of 10"* M or more uniformly affected the morphological appearance of sch-

izonts, as seen from 96 hours Giemsa stained blood films in both the parent isolate

FCD-4 and clone F-56. Schizonts showed fragmented chromatin dots of unequal

size scattered over a large area. Normal merozoite formation was prevented re­

sulting in the inhibition of parasite multiplication. In control wells 7 to 8 fold

increase in parasitemia was observed by the end of 96 hours. The IC^^ and IC^^

values of the drug derived from the drug dose response curve were 1.5 x lO'* M and

4.6 X 10-» M for FCD-4 and 1.5 x 10» M and 3.6 x lO- M for F-56. Apparently lactic

acid used for drug preparation at concentrations present in the test solutions had

no effect on parasite multiplication. This confirms the finding of Richards and

Maples (1979).

Cycloguanil: Parasite counts made at the end of 96 hours of the experiment

revealed that multiplication of the parent isolate FCD-4 and clone F-56 was com­

pletely inhibited in vitro at 5 x 10"* M and 5 x 10' ° M concentration of cycloguanil.

Percent inhibition of parasite growth in relation to control was plotted against log

concentration of drug to determine ICg , and ICg , values. The isolate FCD-4 and

clone F-56 showed marked sensitivity to cycloguanil. The IC^ , and IC^ , values

derived from the drug dose response curve (Figure 2.6 ) were 8.4 x 1 0 " M and 6.8

X lO-io M for FCD-4 and 7.2 x 1 0 " M and 2.7 x 10' ° M for the clone F-56. Inhibitory

effect of the drug on parasite growth was observed even at very low concentra­

tions. The morphological appearance of cycloguanil sensitive parasites was very

similar to that observed in the case of pyrimethamine. These abnormal parasites

appeared enlarged and contained fragmented red staining nuclear material. Good

growth of parasite was observed in control wells at the end of 96 hours.

Quinine: The effect of quinine on erythrocytic stages of the clone F-56 and isolate

FCD-4 in vitro is illustrated in Figure 2.7. The IC^ , ICg and MIC values of the

drug for the parasites derived from the drug response curve are 0.02 v^ml, 0.052

Hg/ml and 0.06 ng/ml for clone F-56 and 0.01 ng/ml, 0.047 ^g/ml and 0.06 ng/ml for

the isolate FCD-4.

Artemisinin: The response of clone F-56 to graded concentrations of artemisinin

is presented in Table 2.3. Complete inhibition of erythrocytic multiplication was

obtained at a concentration of 10 ng/ml of the drug. The concentrations of the drug

that caused 50% and 90% inhibition of parasite growth with respect to control

derived from the tabulated data (Table 2.3 ) are 0.0019 ng/ml and 0.0058 ng/ml

46

respectively.

Table 2.3 In vitro susceptibility of a P. falciparum clone, F-56 to artemisinin.

The parasites were under drug pressure for 48 hours. Starting parasitemia was

less than 1% and hematocrit 4%. Slides were enumerated for parasitemia at the

end of 48 hours.

Drug concentration (tig/ml)

0 (control)

0.01

0.005

0.001

0.0005

0.0001

% parasitemia

2.66

0

0.37

2.07

2.37

2.71

% inhibition

0

100

86.09

22.18

10.9

0

DISCUSSION

One of the most widely used applications based on continuous cultivation of

erythrocytic stages of falciparum malaria (Trager and Jensen 1976) has been the

in vitro determination of susceptibility of parasites to various antimalarial drugs

around the world, more so in endemic locations. The popularity of these methods

is obviously because of several advantages they offer over in vivo procedures. The

'standard' WHO Field Test (1973) for instance which is used to determine the sus­

ceptibility off! falciparum infection in the subject requires 3 days of drug admin­

istration and 7 days of follow up period to ascertain the sensitivity of infecting

parasites. Low levels of resistance can not be detected by this in vivo procedure.

4/

Modified 'extended' Field Test requiring 28 days of follow up is employed t o deter­

mine the gradation from sensitive (S) to R I, RII or R III (high) level of resistance

to chloroquine. Prolong follow up period with precautions for preventing any re­

infection during this duration are limiting factors to carry out this test, particu­

larly in endemic locations. The in vitro methods of determining the sensitivity of

an isolate require much less time and can be easily completed in 2 to 3 days using

very little blood from the infected person. The response of falciparum infection to

drug treatment may differ from one individual to another depending upon the

immune status of the individual (Powell et al. 1964; Waliker and Lopez Antunano

1968). The hosts immune and other factors do not affect the outcome of results in

vitro evaluation, thus permitting a more accurate evaluation of the intrinsic in­

hibitory properties of the drug on the parasites. However, serum supplement used,

specially those procured from endemic regions, might interfere with correct as­

sessment of the inhibitory properties of the drug, as serum from various endemic

regions are known to contain antibodies capable of retarding the growth of cul­

tures in vitro (Chulay et al. 1981; Jensen et al. 1982). To overcome this possibility

each serum unit should be screened for the presence of malaria specific antibodies

or the serum used should be heat inactivated to nullify the influence of these

serum factors on the cultures. All through the present study the latter option was

employed. This minimized the interference of serum factors in drug response

studies of the parasite. Another drawback with in vivo evaluation is concerning

uncertainty of complete absorption and retention of the drug in the subject. As­

sessment of complete uptake and presence of the correct amount of the drug in the

blood of infected person requires use of time consuming, elaborate methods like

HPLC. Applications of in vitro techniques have thus greatly improved the overall

efficiency and precision of drug sensitivity tests. It is now possible to process and

evaluate large number of compounds on different strains of falciparum simulta­

neously, thus providing broader range of information with respect to susceptibil-

48

ity to various drugs. This has been made possible also because these techniques

are relatively inexpensive compared to experimental animal model systems which

require more space, equipment and manpower. In vitro cultures have made it

possible to study clonal populations of parasites and this will contribute towards

better understanding of genetic analysis of drug action and considerably facilitate

molecular/biochemical studies on the mechanism of drug action. In vitro systems

permit study of structural-activity relationship of compounds with great precision

and relative ease, thus allowing the selection of lead compounds with greatest

intrinsic antimalarial activity very rapidly. Evaluation of potential drug interac­

tion for synergism, antagonism or indifference has been made simpler by in vitro

methods, enabling the selection of favourable combinations. By employing multi­

drug resistant strains in culture it is now possible to look for compounds which

are not cross-resistant with existing antimalarial drugs. Finally it is possible in

vitro studies to evaluate parent compounds and known or putative metabolites of

the parent compounds separately, especially since only small quantities of each

are needed. There are also important limitations associated with the use of in

vitro methods. The most frequently cited limitation is the inability to detect the

potential antimalarial activity of those compounds which require in vivo metabo­

lism to an active state, for example the antimalarial drug proguanil which is inac­

tive in vitro system. Similarly certain compounds which require some form of host

interaction such as enhancement of host immunity may prove to be inactive when

assessed in vitro. Another limiting characteristic of in vitro method is the artifi­

cial time course chosen for drug exposure, which is usually at a constant level of

concentration for a relatively short period of time. Certain drugs which have been

identified as effective antimalarials may ultimately prove to be toxic to the host or

might have very little safety margin. Many compounds will also prove to be in­

soluble in the media used for culturing the parasites in vitro. Others will be sub­

ject to artifacts peculiar to in vitro systems such as adherence to the glass or plas-

49

tic dishes in which the experiments are carried out. The above considerations

lead to the conclusion that though the availability of in vitro culture techniques is

important for antimalarial drug research, they are neither a substitute nor a re­

placement for in vivo or basic biochemical methods. A well-designed drug develop­

ment programme must carefully integrate these varied approaches, recognising

their respective advantages, limitations and their mutual potential contributions

towards the goal of identifying and characterising useful new antimalarial drugs.

Parasite multiplication factor in our study was comparable with the iso­

lates and clones being cultivated elsewhere even in non-endemic areas. There

were no crisis forms observed in cultures which have been reported from some

holoendemic regions. The presence of malaria specific antibodies in the blood have

been implicated for the presence of crisis form (Reese et al. 1981; Jensen et al.

1982, 1984). There had been no excessive conversion rate of asexual forms to

sexual stages in the culture as has been the case in most endemic regions employ­

ing hyperimmune serum (Jensen et al. 1984). All these observations peculiar to

parasite growth and multiplication in the malaria endemic regions are contrary to

the observations made in our cultures which confirm that the blood component

used by us for cultivation were free from most of the factors involved in generating

these characteristics. Oduola and coworkers (1992) have also found that plasma

from semi-immune persons is suitable for continuous cultivation and drug suscep­

tibility testing of P./b/ciporum.

The first simple in vitro test for assessing the drug susceptibility of P. falci­

parum parasites drawn from venous blood of an infected individual was developed

by Rieckmann et al (1968). The test relied on a basic observation that parasites

could survive in vitro system for short duration of atleast 30 hours. This fact was

exploited in measuring the extent to which maturation of ring forms to schizonts

was inhibited after incubation of parasitized blood in various drug concentrations

for a period of 24 hours. This short term culture system provided a quick and

reliable diagnostic tool to differentiate chloroquine resistant and ^^Hi^^'esiso­

lates both in laboratory and field conditions (Rieckmann and Lopez Antunano l571; '""'*

Valera and Shute 1975; Palmer et al. 1976; Ebisawa et al. 1976; Sucharit et al.

1977). Usefulness of this method culminated in the development of a test kit for

monitoring the sensitivity of P. falciparum isolates to chloroquine by the WHO

(1979). Using this kit one could even assess the level of resistance ranging from

sensitive to highly resistant R III forms of the parasites. This test has also been

used for other antimalarials. The main shortcoming of this macro-method is that

it requires about 10 ml of venous blood which is not readily given by the patient,

more so if the subjects are children. Development of microtechnique using capil­

lary blood specimen (Rieckmann et al. 1978), which can be obtained by a finger

prick, has made the susceptibility test easier and can be performed by drawing

little blood from even young children. Period of incubation in the micromethod

can be extended to 48 hours without change of medium, so that one can even ob­

serve reinvasion of the merozoites (Rieckmann 1980; Yisunsri and Rieckmann

1980). This technique has replaced macro test specially in the field with the de­

velopment of inexpensive battery operated out door incubators (Eastham and

Rieckmann 1981). Considering the benefits of incubating parasites under drug

pressure for longer duration in determining the susceptibility of falciparum iso­

lates, Nguyen-Dinh and Trager (1980) described a new 48 hour test system. In­

fected red blood cells, either from cultures or from clinical specimens (Nguyen-

Dinh et al. 1981) were diluted in a 50% suspension of fresh red blood cells in

culture medium to obtain a parasite density of 0.1%-0.8%. The resulting parasit­

ized erythrocyte suspension was then further diluted in culture medium, with or

without drug added, to a 2% erythrocyte suspension. A similar test method of 72

hours has been described by Kramer and Siddiqui (1981) with 5% erythrocyte

suspension. In the present study a modified 48 hour test method of Nguyen-Dinh

and Payne (1980) has been employed in determining the susceptibility of para-

sites to antimalarial drugs in vitro, because this test method is reliable, reproduc­

ible and results are not modified by slight variations in starting parasitemia, eryth­

rocyte suspension, blood group of the red cells used, age of the erythrocytes, inocu­

lum size etc.

According to Nguyen-Dinh and Trager (1980) for a strain sensitive to chlo-

roquine complete inhibition of growth occurs at 0.01 |xg/ml and for a resistant

strain at 0.1 ng/ml. From IC^^ and ICg,, values derived from the drug response

curve it can be inferred that both the parent isolate and the clone evaluated are

resistant to chloroquine, the isolate being more resistant since at a concentration

of 0.06 ng/ml complete inhibition is observed in the clonal parasites whereas only

86% inhibition was observed in the parent isolate. In control wells in which para­

sites were incubated in drug free medium good growth was obtained with 4 to 5

fold increase in parasitemia in 48 hours, which is comparable with the growth

observed by Nguyen-Dinh and Trager (1980). Amodiaquine and chloroquine are

both derivatives of 4-amino-7-chloroquinoline and differ only in the nature of the

group attached to the 4 amino position, amodiaquine has a substituted benzene

ring at the position, while chloroquine has a branched chain aliphatic substitu-

ent. The parasites evaluated have been found to be sensitive to amodiaquine while

extremely resistant to chloroquine. Similar observations have been made by other

workers (Thaithong et al. 1983; Watkins et al 1984; Looareesuwan et al. 1985) in

strains of P. falciparum from different geographical regions, and also it has been

observed that isolates found to be resistant to chloroquine develop resistance to

amodiaquine sooner or later (Draper et al. 1988). Response of parasites to both

the DHFR inhibitors evaluated was found to be similar. This is perhaps expected

since both pyrimethamine and cycloguanil are known to act by affinity binding to

the dihydrofolate reductase of the parasite which occupies a position in the cellu­

lar biosynthesis of the malaria parasites (Ferone et al. 1969). Smalley and Brown

(1982) estimated that parasites obtained from clinical samples growing in 10" M

52

pyr imethamine or more are likely to be resis tant atleast to some degree in 24 hour

test. Concentration of 1 x 10 ® M of pyrimethamine in a 48 hour test in vitro by

Richards and Maples (1979) has been reported to be both inhibitory and cidal. As

the morphological criterion has been used to determine the effect of the compound

on P. falciparum, sometimes it becomes difficult to differentiate between the cidal

and inhibitory effect on the parasi tes in a stained slide. In order to el iminate this

ambiguity, the parasi tes were further cultivated for next 48 hours in drug free

medium and percentage inhibition of parasi tes calculated at 96 hours . The 10^^

and ICgQ values determined both at the end of 48 and 96 hour experiments clearly

indicate tha t isolate (FCD-4) and clone (F-56) tested are highly sensitive to py­

r imethamine and cycloguanil. Information on the relationship between in vitro

schizontocidal activity and in vivo response to t rea tment are lacking for quinine

and artemisinin. Quinine is being used in India for emergency medicament of

malar ia but so far no reports have emated regarding t rea tment failure with this

drug, indicating the sensitivity of the parasi tes to quinine. Mean plasma level of

1.5 ng/ml of quinine base is reached in a person 4 hours after ingesting a single

dose of 300 mg of quinine (Saggers et al. 1970). Complete inhibition of paras i tes

were obtained at much lower concentrations, clearly indicating tha t paras i tes used

were sensitive to quinine. This experiment has also generated a baseline da ta of

these paras i tes for quinine susceptibility. Artemisinin has not been used for ma­

laria t rea tment in India, therefore parasi tes are expected to be sensitive to this

drug. The mean plasma level of 110 ng/ml at tained at about 7 hours in h u m a n s

taking the curative dose of 10 mg/kg body weight (Zhao and Zhang 1985, 1986) of

ar temisinin is much higher the concentration of the drug needed to prevent the

multiplication of the parasi tes used in vitro, indicating tha t the paras i tes of the

clone F-56 are sensitive to artemisinin and we have baseline values of suscepti­

bility of th is paras i te line to a drug which may be used in future for rnalaria treat­

ment.

Figure 2.1 A typical Giemsa stained tiiin blood film made from asynchronous culture showing various asexual erythrocytic stages (R= ring, T= trophozoite, S= schizont) and a sexual stage (G= gametocyte). ( X 1200 )

Figure 2.2 A Giemsa stained thin blood film depicting free merozoites released from a ruptured schizont.

m

_c

100

o i _

en

"o

c o '-^ '_Q

-C

c

^

80

60

40

O O FCD 4

A A F 56

0.500

Chloroquine concentration ( n q / m ! )

Figure 2.3 Drug dose response curve for chloroquine in the P. falciparum isolate FCD-4 and cl F-56 after 48 hours of incubation in vitro (performed in 24-well sterile plastic tissue culture plat

o en

CI O

- t—^

C

100

8 0 -

6 0 -

4 0 -

20

0 0.001

O O FCD-4

A A F-56

A-a

0.010 0.100 1.000 10.000

Concentration of omodiaquine ( nM

' I u . ' I

Figure 2.4 Response of the P. falciparum isolate FCD-4 and clone F-56 to various concentrations of amodiaquine in vitro.

o

en

O

o

'^ 'x: c

100--

8 0 -

60- -

O O FCD-4

A A r - 5 6

0.010 0.100 000

Concent ra t ion of pyrin^iethamine ( nM )

Figure 2.5 Pyrimethamine sensitivity of the P. falciparum isolate FCD-4 and clone F-56 deter­mined in vitro by the modified 48 hour test method.

o

O

C O

JZ

00

80- -

60

40

^ 2 0 -

o-A

O FCD-4

- A F-56

•i3

0- e—e 0.001 0.010 0.100 1.000

Concentration of cycloguanil ( nM )

Figure 2.6 Cycloguanil response curves of the P./(3/d/)arMm isolate FCD-4 and clone F-56 in th modified 48 hour test method.

1 0 0 -

o

O

C O

'_Q

C

O O FCD-4

A A F-56

0.500 1.000 10.000

Concent ra t ion of quinine ( nc j /m l

Figure 2.7 Sensitivity of erythrocytic stages oi P. falciparum ( FCD-4 and F-56) to quinine in vitro.

Chapter 3

CHEMOSENSITIVITY OF A CHLOROQUINE-RESISTANT P. FALCI­

PARUM ISOLATE TO QUININE-TYPE COMPOUNDS IN VITRO

Abstract: In vitro relative chemosensitivity of erythrocytic stages of the chloroquine resistant P falciparum isolate to quinine-type compounds has been evaluated. Apart from natural cinchona alkaloids, quinine and quinidine, their hydrogen derivatives proved to be more potent erythrocytic schizontocidal compounds. Some drug combinations show extremely good antimalarial property in vitro. Going by the IC^ values of the eight preparations tested the compounds can be arranged in following order with respect to their schizontocidal activity: quinidinelhydroquinidine ^ hydroquinidine > quinine I hydroquinine > quinidine > hydroquinine I quinine > apoquinine > epiquinine. Clearly in depth investigations are required for exploiting the full antimalarial potentials of these cinchorm derivatives or mixtures and other combinations.

INTRODUCTION

The property of cinchona bark to cure fevers of diverse origin was well known

to the natives of South America, particularly to the Peruvian and the Bolivian

(now Ecuador) Indians, much before the recorded historical date of 1630s when

the first European was successfully treated (presumably of malaria) by the pow­

dered bark of cinchona tree (Guerra 1977 a, b.). Causative agent of the disease

itself was first discovered and identified by Laveran (1880). The power of hot

infusion of the powdered bark has been widely exploited in the treatment of ma­

laria since then. Ever increasing demand of this bark, which could easily be mis­

taken for that of other trees, especially in the dried up conditions led to frauds,

speculative and hoarding tendencies among traders in nineteenth century

(Gramiccia 1987). This generated interest in chemical analysis of the cinchona

bark. The curative property of the bark was assigned to alkaloid components.

The bark of cinchona trees contains a mixture of some 10 alkaloids, but most of

them are not crystallizable (Bruce-Chwatt et al 1981). Quinine and cinchonine

were the first two alkaloids isolated in crystalline form in 1820 by Pelletier and

Caventou (Hofheinz and Merkli 1984). Quininc! salt proved to be an excellent

antimalarial drug. Although correct structure of quinine had already been sug­

gested by 1908, synthesis of this compound was acliieved by Woodward and Doering

5 5

MATERIALS AND METHODS

Parasites Locally collected P. falciparum isolate FCD-4, being routinely main­

tained in the laboratory using candle-jar method of Trager and Jensen (1976) was

employed in this study. Isolation, establishment and maintenance in vitro of this

isolate has been described in an earlier section of this chapter. The characteriza­

tion of the isolate demonstrated that FCD-4 was resistant to chloroquine.

Drug solutions Coded preparations of cinchona alkaloids and their derivatives

or mixtures were kindly provided by Dr. RI. Trigg of the World Health Organiza­

tion. Detail chemical structure of these compounds is given in Figure 3.1.

Identity of the eight preparations used in the present investigation is as follows:

Name Abbreviations

1. Quinine (base) Q

» 2. Quinidine (base) Qn

3. Apoquinine (base) AQ

4. Hydroquinine (base) HQ

5. Hydroquinidine (base) HQn

e.Quinine/Hydroquinine Q/HQ

60:40 mixture (bases)

T.Quinidine/Hydroquinidine QnAlQn

60:40 mixture( bases)

8. Epiquinine/Epiquinidine sulphate EQ/EQn

60:40 mixture

Stock solution of each compound was made by dissolving 1000 mg of the

substance in 61.6 ml of O.IN sulphuric acid and diluted with glass distilled water

to 100ml. Further dilutions of the stock solutions were made with HEPES buff-

57

RESULTS

Chemosensitivity of isolate FCD-4 to each compound was initially evalu­

ated by determining the blood schizontocidal activity in duplicate at 1,3,6,10, 60,

100, 300, 600, 1000 ng/ml concentrations of the compound. Minimum inhibitory

concentration (MIC) required to completely eliminate parasites with EQ/EQn (mix­

ture), AQ, Q, HQ was found to be 600, 100, 60, 30 ng/ml, respectively whereas

other preparations effectively eliminated all parasites at concentration of 10 ng/

ml or less. The results obtained are summarized in the Table3.1.

Table 3.1 Estimated MIC, IC^ , and IC^^ values of quinine and quinine-type com­

pounds assayed in vitro against a chloroquine resistant isolate FCD-4 of P. falci­

parum in 24 well sterile plastic tissue cluture plates with starting parasitemia of

less than 1%, erythrocyte suspension of 2%. The parasites were under drug pres­

sure for 48 hours.

Compounds

Quinine

Quinidine

Apoquinine

Hydroquinine

Hydroquinidine

Quinine/Hydroquinine

Quinidine/Hydroquinidine

Epiquinine/Epiquinidine sulphate

*ic,„

11

4

13

5.6

2.5

3.9

2.2

140

*ic.

48

5.8

78

9.4

5

8.4

7

270

*MIC

60

10

100

30

6

10

10

600

* Concentrations are in ng/ml.

59

tive than quinine at ICg,, level. Amount of quinidine needed to completely elimi­

nate parasites in vitro is far below the non- toxic peak quinidine levels achievable

in plasma of human subjects. Quinidine has greater systemic clearance and a

larger total apparent volume of distribution compared with quinine (White 1987).

Plasma concentrations during malaria treatment are therefore lower. In the

slightly insensitive strains of P. falciparum to quinine, although mostly cases of

the Rl-type of resistance have been recorded (Cook 1986) quinidine has been re­

discovered as more potent antimalarial than quinine. So far there has been no

report of quinidine resistance either from field or laboratory studies. Information

on the relationship between in vitro antimalarial sensitivity and in vivo response

to treatment with quinidine is lacking. This information can greatly improve and

define the dose regimens of quinidine in different parts of the world depending on

the susceptibility of local strains, thus increasing the safety meirgin of this drug.

Apart from natural cinchona alkaloids the synthetic hydroderivatives of quini­

dine, quinine and their combinations showed extremely good erythrocytic schiz­

ontocidal activity. Advantages of hydroquinine over quinine had also been ob­

served by other workers (Giemsa and Werner 1914). The unnatural isomers of

dihydroquinine and dihydroquinidine, the enantiomers or mirror image com­

pounds, were shown by Brosi and colleagues (1971) to have same degree of activ­

ity as the natural isomers in P. berghei in mice. The four major alkaloids all pos­

ses significant blood schizontocidal activity but their relative potencies vary with

the species of Plasmodium (Hofheinz and Merkli 1984). Differences in apparent

activity of cinchona alkaloids in vivo are related to both pharmacokinetic factors

in the host and pharmacodynemic factors in the parasite. But evaluation of

chemosensitivity in vitro system eliminates host factors effectively. Quinine is

evidently not the most effective cinchona alkaloids but has reached a unique posi­

tion because it just happened to be the first to be crystallized and used in 'pure'

A l 1 1.-L

H3C0. HO-C-H

Ph 4 0 0 8 - qui nine

&<<, 9'J

H O - C ^ H3CO

[j<,9 :

Ph 4017 - hydroquinine

H3CO

• N ^ Cap, 9^ J

Ph 4 0 1 2 - quinfdine

HO \

.CO C^ /^N

N ^ C e p . s ^ :

Ph 40C7— hydroqulnidine

H3CO

Ceo^ , 9^3 H^ C 8 1 i , 9 ] HjSO^

Ph 4 9 0 3 - e p l q u i n i n e . epiquinidine . sulphate

H3CO

C8<<, 9" J

Ph 4 9 0 2 - apoquinine

Figure 3.1 Chemical structures of quinine and qunine-type compounds

Chapter 4

CURE WITH CISPLATIN OF MURINE MALARIA INFECTION AND INHI­

BITION IN VITRO OF A CHLOROQUINE RESISTANT P. FALCIPARUM

ISOLATE

Abstract: Antiplasmodiumproperties ofcisplatin (cis-platinum (I!) diammine dichloride), a neoplastic drug, have been assessed using in vivo and in vitro model systems of malarial parasite. A well tolerated dose of 6 mglkg body weight of the compound cured the mice infected with P. berghei and the amount of cisplatin required for in vitro inhibition (IC^ of a chloroquine resistant falciparum isolate was lower than either chloroquine or quinine. Minimum inhibitory concentration (MIC) needed to prevent the multiplication of asexual blood parasites in vitro was 30 ng/ml. Late ring and trophozoite stages of erythrocytic cycle were most susceptible whereas schizont and early ring stages were least sensitive to the toxic effect of cisplatin. Smaller multiple doses had been the most effective in curing malaria in mice than a single large dose. In a few cases, mice treated with a single intraperitoneal large dose of 6 mglkg body weight, there was a delay in appearance of parasitemia but most of them recovered completely but slowly. This compound exerts its toxic­ity mainly by randomly damaging and cross-linking DNA strands as has been shown by Southern hybridiza­tion using a synthetic oligonucleotide probe, which is a repeat sequence in the falciparum genome. The report clearly demonstrates the antimalarial potentials of this compound and suggests a closer evaluation of this and other related compounds, specially in combination with antimalarial drugs to probe their synergistic proper­ties.

INTRODUCTION

Species of Plasmodium are the causative agents of malaria in man and some

other vertebrates. P. berghei is responsible for murine malaria in mice and P.

falciparum causes 'malignant tertian' human malaria. Appearance and speedy

spread of resistance in P falciparum to common synthetic antimalarial drugs

like chloroquine (Peters 1990b; Bruce-Chwatt et al. 1981), pyrimethamine (Peters

1984; 1990b), proguanil (Chaudhuri andChaudhuri 1949; Field and Ederson 1949;

Peters 1990b), used for treatment are showing an increasing rate of curative

failures (Peters 1984; Wernsdorfer 1991). The current grim situation is thus a

cause of concern to malaria epidemiologists, indicating the urgent need to identify

and develop alternate compounds capable of curing resistant malaria. Malaria

pathogenicity can be diminished by administration of drugs which inhibit active

multiplication of asexual erythrocytic parasites and cure can be achieved by effec­

tively eliminating the blood forms from the host. The parasite clearance may be

achieved either by lethal action of the compound used for treatment and/or by its

ability to evoke a stronger immune response against the parasite. Cisplatin has

twin properties of being employed for neoplastic treatment (Einhorn and Williams

1979; Rosenberg 1984) and immunomodulation (Page et al. 1977; Kleinerman and

Zwelling 1982). Cisplatin is a coordination compound of bivalent platinum and

was the first inorganic antineoplastic agent to enter into clinical investigations

around 1972 (Rosenberg 1973). Some of the known properties or salient features

of cisplatin have been enumerated as under:

1. The drug is active against a wide variety of tumors ( Rosenberg 1973,

1980)

2. Inactivates transforming DNA and viruses (Munchausen 1974; Shooter

et al. 1972)

3. Induces filamentous growth and causes prophage induction in lysogenic

strains of E. coli bacteria (Rosenberg 1971, 1973)

4. The drug causes chromosomal abnormalities and toxicity (Vandenberg

and Roberts 1975 )

5. Supresses graft rejection against H2 histocompatibility barrier in mice

(Khan et al. 1972 )

6. Activates the immune system of the host (Rosenberg 1985)

7. Selectively inhibits DNA synthesis (Harder and Rosenberg 1970; Howley

and Gale 1970)

8. Causes mutagenesis (Monti-Bragdin et al. 1975; Lecointe et al. 1977)

TD our knowledge no work has been reported on the effect of this compound

on malaria parasites. These considerations prompted us to assess antiplasmodial

properties of cisplatin in vitro and in vivo. Further, in order to understand the

mode of action of this compound, studies on stage-specific susceptibility of eryth­

rocytic parasites in vitro and interaction of cisplatin with intact or restriction en­

zyme digested P. falciparum DNA have been carried out. The later experiments

63

were performed with a view to look for changes, if any, in the number and size of

restriction fragments generated, following incubation of P. falciparum DNA with

cisplatin, on a Southern blot using P. falciparum specific oligonucleotide probe.

MATERIALS AND METHODS

Parasites Rodent malaria parasite P. berghei was obtained from National Insti­

tute of Communicable Diseases, Delhi, India and maintained in Swiss albino mice

of 30-40 g each, by weekly mechanical passage of infected erythrocytes drawn

from a donor mouse by cardiac prick into a sterile, heparinized S3rringe. The

biology of these parasites has been reviewed by Killick-Kendrik (1978). Chloro-

quine resistant P. falciparum isolate FCD-4 of human origin which has been de­

scribed in earlier section, was the other parasite used in this study.

Stock solution of cisplatin The stock solution of cis-platinum (II) diammine

dichloride, obtained from Sigma Chemicals, USA, was prepared by dissolving 1

mg of the compound in 60% dimethylsulfoxide (DMSO). Further dilutions were

made with buffered RPMI-1640 culture medium.

Collection of parasitized blood from infected donor mouse

The strain of P. berghei was propagated in Swiss-albino mice by weekly

mechanical passage of infected erythrocytes. The parasitized blood was drawn

from an infected donor mouse via cardiac puncture. The infected blood was centri-

fuged at 2000 rpm for 10 min at 4 °C. The buffy coat and supernatant containing

plasma were discarded. Packed cells were washed twice in 3.5 volumes of sterile

0.85% NaCl. This parasitized blood was used for passaging in mice and the course

of infection followed by examining Giemsa stained blood films made each day from

the tail blood.

Inoculation of test animals

Infected blood collected from the donor mouse usually contained about 70%

parasitemia. The infected erythrocytes were washed with sterile normal saline as

64

described above. The number of cells per 0.05 ml of infected blood was calculated

using Neubauer cell counting chamber. Percentage peu-asitemia was determined

from Giemsa stained thin blood films. Each mice was inoculated with 0.05 ml of

infected blood containing 10' to 10® parasites. Infected mice were kept in an air-

conditioned room (24 °C - 26 °C). Mice were fed ad libitum with commercial pellet

and water supplemented with 0.01% p-aminobenzoic acid.

Erythrocytic schizontocidal activity

In vivo susceptibility of P. berghei: Curative property of cisplatin was as­

sessed by comparing the survival times of mice untreated or treated with cisplatin

receiving same amount of parasite inoculum in the form of infected erythrocytes

obtained from a donor mouse. Test mice were taken in groups of five. Preliminary

experiments were conducted in batches consisting of three mice each to arrive at

the optimum tolerable dose of cisplatin effective in curing the mice. These pre­

liminary doses ranged from 2-12 mg/kg body weight. Each member of the test

group was injected with 10* parasitized erythrocytes, inoculated intraperitoneally.

The cisplatin was given intraperitoneally but eight hours later either as a single

dose or in four equally divided doses, at 4 hour intervals each in 1 ml saline solu­

tion. Appropriate sets of control mice were maintained. The development of para­

sitemia was monitored by making Giemsa stained blood films from the cut tail

vein of the experimental and control animals every 24 hours for a period of 60

days.

In vitro susceptibility of i^ falciparum: Erythrocytic schizontocidal activity

of cisplatin on P. falciparum was determined by exposing parasites in triplicates

to graded concentrations of cisplatin using the modified 48 hour test method

(Nguyen-Dinh and Payne 1980). The experiments were conducted in 24-well tis­

sue culture plates by setting up microcultures with eight different concentrations,

ranging from 1 to 1000 ng/ml. The parasite material for experiments was ob-

65

tained from stock cultures and subjected to sorbitol lysis (Lambros and Vanderberg

1979), to get synchronized ring stages. The parasitemia of the 50% cell suspen­

sion of this synchronized material was adjusted to less than 1% with uninfected

freshly washed erythrocytes. Aliquot of 20 ju.1 of the suspension was added into

series of wells of the test plate, each holding 480 fi\ of complete medium with or

without drug, yielding final cell suspension of 2%. Loaded test plates were incu­

bated at 37 "C in a candle-jar for 96 hours with daily change of medium. The drug

was included in experimental wells for first two days only. Blood smears were

made at the end of 48 and 96 hours, stained with Giemsa. Minimum of 5000

erythrocytes were enumerated to determine the parasitemia. Percentage reduc­

tion of parasitemia in relation to control was calculated. Fifty percent and 90%

inhibitory concentrations (ICg^ and ICgj,, respectively) were extrapolated from semi­

log plot of varying concentrations of cisplatin against percentage inhibition of

growth

In vitro stage-speciflc sensitivity:

To investigate the preferential toxicity to any specific stage of P. falciparum

in vitro, asynchronous culture material was subjected to triple sorbitol treatment

at 0, 40 and 47 hours interval, to obtain synchronized peirasites of 0-7 hours old

(Lambros and Vanderberg 1979). These synchronized parasites were in early ring

stage for another 12 hours, for next 12-24 hours of development in late ring or

early trophozoite stage, 24-36 hours old in late trophozoite stage and during sub­

sequent 36-48 hours of growth in schizont stage of the erythrocytic schizogonic

cycle. The synchronized stages were subjected to drug pressure for 12 hours each,

the respective period of their residence in the specific stage. The experiments

were conducted in triplicates in multiwell plates and slides made at the end of

schizogonic cycle. The toxicity of cisplatin to ring, trophozoite and schizont in­

fected stages was determined by calculating the percentage inhibition of para­

sitemia in drug treated parasites to that in drug free controls. The extent of syn-

66

chronization of parasites achieved is depicted elsewhere.

Plat inat ionofDNA

Binding of cisplatin to P. falciparum DNA, extracted from erythrocytic stages

(Tungpradabkul and Panyim 1985) was studied by incubating 4 /u.g of DNA at 37

°C for 24 hours with 50 or 100 ng of cisplatin in total volume of 10 /xl. The incu­

bated material was then digested with restriction enzyme Hind III at 37 °C for 2

hours (Sambrook et al. 1989). In another set of experiment Hind III digested DNA

material was incubated with cisplatin. Similar experiments were performed using

Taq I. These digested samples were size fractionated on a 0.7% agarose gel along

with control samples of uncleaved or restriction enzyme cleaved DNA not incu­

bated with cisplatin. The gel was stained with ethidium bromide and visualized

under UV before the material was transferred on to a nylon membrane by South­

ern blotting. The membrane was then hybridized with y-'^P end labelled 21-mer

synthetic oligonucleotide, which is known to be a repetitive sequence in P. falci­

parum genome (Mucenski et al. 1986), at 42 °C using stringent washing condi­

tions. The methods employed for the extraction of DNA, Southern transfer and

hybridization have been described in the following chapters. The sequence of the

oligomer used to probe the membrane was as follows :

5'-AGGTCTTAACTTGACTAACAT-3'

RESULTS

The periodicity of blood schizogony of the rodent malaria parasite/* berghei

was a quotidian cycle i.e., 22-25 hours. The mortality rate of P. berghei in the

strain of white mice used in the present study was 100%, if untreated. The mor­

tality curve was bimodal. During the first 6 days of infection, mature erythrocytes

were invaded, and the mouse died in a condition of shock. If the animal survived

the first phase, many reticulocytes then occured in the blood and were preferen-

67

tially invaded, anemia increased and the animal died later in a condition of an­

oxia. Parasites were observed in tail blood films of test animals within 24 hours

after inoculation of infected blood. As seen in Figure 4.1 a & b the characteristic

course of infection was highly asynchronous. Blood films showed the presence of

all the different asexual blood stages of the parasite namely rings, trophozoites

and schizonts at the same time. Reticulocytes were frequently infected with mul­

tiple parasites than mature erythrocytes. Upto 10 parasites per reticuloc3rte were

observed. The intraerythrocytic ring forms showed red staining chromatin dot

with a very small area of blue stained cytoplasm. The trophozoites were recogniz­

able by the presence of chromatin dot with enlarged cytoplasm containing faint

brown-yellowish spots of haematin granules. Mature schizonts were character­

ized by 12-20 distinct merozoites and a dark brown-yellowish dot of clustered

haematin. These schizonts in due course became more fragile and released their

merozoites, resulting in groups of free merozoites accompanied by a free pigment

cluster (Figure 4.1 b). Platelets and white blood corpuscles are seen in Figure 4.2.

Ability of cisplatin to clear P. berghei infection from mice is presented in

Table 4. Tbtal dose of 6 mg/kg body weight given in four equally divided intraperi­

toneal injections at four hour intervals effectively cured the infected mice and no

parasitemia could be observed for sixty days in any of the treated mice. The same

dose when given as a single intraperitoneal injection finally cured 80% of the in­

fected mice. Initially, however, in three out of five of these test animals parasite

appearance was delayed by 11 days compared to controls and parasite population

increased subsequently leading to death of one of the mice whereas in the other

two mice appearance of high parasitemia was followed by slow decline with final

disappearance of the parasites after 14 days. Four week onwards from the start

of the experiment no parasite could be observed in these two surviving mice till

day sixty. In all the control animals, not receiving treatment with cisplatin, healthy

parasites appeared in circulation within 24 hours of receiving the infective inocu-

68

lum and they died in less than 10 days due to high parasitemia.

Table 4.1 Ability of cisplatin to cure P. berghei infected mice. Each of the mice received an intraperitonial innoculum of 1x10* parasites. The treated animals were injected intraperitoneally with cisplatin 8 hr later.

Infected mice

Dose

Untreated

nil

Treated with cisplatin

6mg/kg body weight as a single dose

6mg/kg body weight in four equally divided doses at 4 hr intervals

Mice showing parasitemia within two weeks of innoculation

5/5 3/5 0/5

Mice surviving till 60 days following innoculation

0/5 4/5 5/5

Inhibitory effect of cisplatin on multiplication of the synchronized cultures

of P. falciparum in vitro are presented in Figure 4.3. Complete inhibition of the

multiplication was achieved by minimum amount of 30 ng /ml of cisplatin present

in culture medium for a duration of 48 hours. From the dose response curve ICg^

and ICgj, values determined after 48 hours were found to be 6.2 and 24 ng/ml,

respectively and 3.8 and 26 ng/ml, respectively after 96 hours experiment. Abnor­

mal parasites were observed from drug treated wells at the end of 48 hours, show­

ing different degree of vacuolization or pale staining, whereas normal healthy

parasites multiplied to about six fold in control wells in a schizogonic cycle. Most

of the abnormal parasites in treated wells had degenerated or lysed by 96 hours.

69

The stage specific toxicity of cisplatin is given in Figure 4.4. Schizont stages

were least susceptible to the toxic effect of the compound followed by young rings

whereas trophozoites and old rings were most susceptible. The schizont stages

exposed to 30 ng/ml of cisplatin in the medium resulted in only 36% growth inhi­

bition.

Autoradiographs of the restriction enzyme digested falciparum DNA incu­

bated with or without cisplatin and probed with a synthetic repetitive oligonucle­

otide are shown in Figures 4.5 & 4.6. No hybridization band was observed in the

lanes containing uncut DNA or digested DNA incubated with cisplatin whereas

control lanes showed the clear presence of one or several hybridization bands.

DISCUSSION

One of the most inexpensive ways of searching new lead antimalarial com­

pounds for drug development could be to screen the drugs which have been devel­

oped for other diseases and evaluate their antimalarial potentials, either alone or

in combination with other known antimalarial drugs. Cisplatin is a drug with

high potency in treatment of a few human malignancies (Rosenberg 1985; Hosokawa

et al. 1982; Volge et al. 1982) and is a broad spectrum anticancer drug in animals

(Rosenberg 1985; Welsh 1971). It is believed that the drug basically enhances the

immunogenicity of the tumor cells by exposing new antigenic sites on the tumor

cell surface and this evokes a host of offending immune reactions directed against

the tumors. This assumption is based on the following observations: a) Swiss

white mice cured of advanced Sarcoma-180 tumors with therapeutic dose of cisplatin

completely rejected all further transplants for 11 subsequent months because of

high level of immunity generated against the tumor lasting for this period

(Rosenberg 1973,1985). b) In the Swiss white mice cisplatin treatment produced

nearly absolute cure of advanced Sarcoma-180 tumors with a single intraperito­

neal injection on day eight but admin i s t ra t ion of hydrocor t isone, an

immunodepressent, on a day prior to the ii\jection of cisplatin produces only 40%

cure by eighth day (Conran and Rosenberg 1972). P. falciparum also possesses

genes with affinities to multiple drug-resistance (mdr) genes of human cancer cells

(Bradely et al. 1988; Foote et al. 1989) and this particular factor provided a strong

clue that some anticancer drugs may possess antiplasmodial properties. The re­

sults presented in this report amply demonstrate the antiplasmodial potential of

cisplatin. Apparently non-pathogenic dose of this compound cured the malaria

infected mice and in vitro inhibited multiplication of a chloroquine resistant falci­

parum isolate at a low concentration included in the medium.

Toxicity to the host is an important consideration of any candidate com­

pound with potential of being employed as a drug. The amount of cisplatin used

in this study to cure malaria infection in mice is well tolerated by the host. The

dose of 6 mg/kgbody weight given either as a single intraperitoneal push-in iryec-

tion or in four equally divided doses at 4 hour intervals with saline did not cause

any mortality in control mice. Other cancer workers have also reported that thera­

peutic dose of 7 mg/kg body weight of cisplatin causes less than 10% mortality in

mice and as a single intraperitoneal injection, the administered LD^^ dose is 13 to

14 mg of cisplatin/kg body weight (Rosenberg 1985). Slow infusion of cisplatin

gives better results in cancer treatments (Rosenberg 1985) and also kidney toxic­

ity is ameliorated with saline hydration (Hayes et al. 1977). Present report also

shows that 1.5 mg/kgbody weight dose of cisplatin 4 times at 4 hour intervals with

saline is far more superior than a single dose of 6 mg/kg in treatment of mice

malaria. This is perhaps due to longer retention of higher level of cisplatin in the

body for extended period of time, as half life of cisplatin in mice has been reported

to be only 20 hours and an erythrocytic schizogonic cycle of mice malaria is of 24

hour duration. In the two mice, which received single 6 mg/kg body weight dose of

cisplatin, appearance of parasitemia was followed by slow but complete recovery,

this could be due to immunostimulation property of cisplatin which has been clearly

71

demonstrated in several reports (Kleinerman et al. 1980; Kleinerman and Zwelling

1982; Bahadur et al. 1984). Cisplatin has trypanocidal activity in mice (Wysor

1982). The preliminary result in this study clearly demonstrates the antiplasmo-

dial properties of cisplatin both in vitro and in vivo systems. Therefore, it would

be worthwhile to investigate the antimalarial properties of this and other related

platinum complexes with regard to their ability to cure polyresistant Plasmodium

species. Probing additivity and synergism properties in combination with other

antimalarial drugs having different mode of actions should also not be ignored,

but all this needs further serious investigations.

Amount of cisplatin required in vitro to achieve 50% inhibition of parasitemia

in isolate FCD-4 was found to be less than either chloroquine (ICg^r: 18 ng/ml, our

unpublished da ta ) or quinine (ICg^jsllng/ml) (Nair and Bhasin 1993). Not much

difference in IC^^ and IC^^ values calculated from the slides made at the end of 48

or 96 hours of the experiment suggests that there was an insignificant delayed

mortality of the parasites due to cisplatin toxicity. Most of its lethal effect is ex­

hibited within an erythrocytic schizogonic cycle.

Each of the synchronized asexual erythrocytic stages were subjected in vitro

to uniform drug pressure of 12 hours with differential outcome with regard to

parasite survival and multiplication. Intraerythrocytic merozoites in the schizont

and the early rings are the least susceptible to toxic effects of cisplatin, perhaps in

these stages no active DNA synthesis takes place (Inselburg and Banyal 1984)

and the parasite plasma membrane is most intact thus retarding free entry of the

compound into the parasite milieu. Cisplatin is known to prevent the multiplica­

tion of cancer cells by randomly inter- and intralinking of DNA strands of these

dividing cells (Cohen et al. 1979). The most damaging outcome, therefore, are

seen in the early and late trophozoite stages of malaria parasite, known to be

actively involved in DNA synthesis (Inselburg and Banyal 1984).

Molecular basis of cisplatin toxicity has been attributed to lesions in DNA

7 2

molecules of cancer cells leading to inter- and intrastrand DNA cross-links, fi­

nally resulting in cell death (Cohen et al 1979; Zwelling and Kohn 1979). In vitro

binding of cisplatin can occur with any base but prefered order of binding is

G>A>C>T (Rahn et al. 1980). We explored the interaction of cisplatin with P.

falciparum DNA, by incubating it with intact DNA and digesting it later with

restriction enzymes and by incubating predigested DNA with cisplatin. When these

samples were run on agarose gel and stained with ethidium bromide, no fluores­

cence was observed in lanes containing samples incubated with cisplatin, showing

that cisplatin prevents intercalation of ethidium bromide with DNA. Following

blotting of these samples on to the nylon membrane and on probing with radiola-

belled 21-mer repeat sequence, no hybridization in these lanes are visible. This

may be due to inter- and intrastrand cross linking of DNA by cisplatin, thus pre­

venting the specific binding of the probe to complementary sequences on the DNA

which is clearly seen in the form of distinct bands in control lanes of the autorad-

iograph. Thus mode of action of this compound on Plasmodium may be similar to

the reported mechanism of action on neoplastic cells.

*Part of this work has been published in Jap. J. Med. Sci. Biol.(1994),47, 241-252.

Figure 4.1 a. A Giemsa stained thin blcx)d film from P. herghei infected mouse showing different asexual stages of the parasite namely ring (R), trophozoite (T) and schizont (S).

Figure 4.1 b. A Giemsa stained thin blood film from P. berghei infected mouse showing multiple infection of reticulocytes, a cluster of free merozoites and pigment.

Figure 4.2 A Giemsa stained thin blood film from P. ber^hei infected mouse showing parasites, platelets (P) and WBC (W).

o 0-'

o c o

1 0 0 -

7 5 -

50

:5l-

O A

O 48 hr A 96 hr

--c

0.500 1.000 10.000

Cisplatin concentration ( nq/nni )

l o o . r

Figure 4.3 In vitro growth inhibition response of asexual erythrocytic stages of P. falciparum to different concentrations of cisplatin in 48 hour test. Slides were made at the end of 48 and 96 hours. Starting synchronized parasitemia was less than 1%.

> o en

'-—

o c o

.Q

c

100-

75--

50

25- -

0

O O Early ring

A A Late ring

D D Trophozoite

V V Schizont

0.500 1.000 10.000

Cisplatin concentration ( n g / m l )

00.OU

Figure 4.4 In vitro growth inhibition of different asexual erythrocytic stages of P. falciparum to various concentrations in a 48 hour test. Slides were made at the end of 48 hours. Starting parasitemia in each case was less than 1%.

''Igure 4.5 An autoradiogram showing hybridization bands of/! falciparum DNA with species-

pecific synthetic Y " P labelled 21-mer oligonucleotide probe. The DNA samples (4 jxg in each lane

:xcept lane 3, which was blank) were size fractionated on 0.7% agarose gel and Southern trans-

erred on to nylon membrane for hybridization.

Lane 1. Undigested P. falciparum DNA

2. DNA digested with Hind III

3. Kept blank

4. DNA incubated with DMSO prior to digestion with Hind III

5. DNA digested with Hind III and incubated with DMSO

6. DNA incubated with 50 ng of cisplatin

7. DNA digested with Hind III and incubated with 50 ng of cisplatin

8. DNA incubated with 100 ng of cisplatin and later digested with Hind III

9. DNA digested with Hind III and incubated with 100 ng of cisplatin

I 2 3 4 5 6 7 8 9

• /

« I il

Figure 4.6 An autoradiogram showing hybridization bands oi P. falciparum DNA with species-

specific synthetic y ^ P labelled 21-mer oligonucleotide probe. The DNA samples (4 |xg in each lane

except lane 3, which was blank) were size fractionated on 0.7% agarose gel and Southern trans­

ferred on to nylon membrane for hybridization.

Liine 1. P. falciparum DNA incubated with 50 ng of cisplatin and then digested and

then digested with Taq I

2. DNA digested with Taq I

3. DNA digested with Taq I and then incubated with 50 ng of cisplatin

4. DNA incubated with DMSO prior to digestion with Taq I

Section - / /

Chapter 5

IN VrmO SELECTION OF P. FALCIPARUM RESISTANT LINES TO DIHY-

DROFOLATE-REDUCTASE INHIBITORS, CROSS RESISTANCE AND

OTHER RELATED STUDIES

Abstract: Proguanil and pyrimethamine exhibit their antimalarials virtues by preferentially inhibiting the DHFR enzyme of parasites. Pyrimethamine has been deployed on a much larger scale than proguanil. These drugs have been extremely useful in treatment of chloroquine resistant falciparum infection but the limiting factor has been the quick development of resistance among the parasite population against these drugs. Py­rimethamine resistance is known to be widely distributed in all malaria endemic areas of the globe, including India. Proguanil has not been (extensively) used in India for over fifty years now. It should, therefore, be of interest to know the susceptibility of pyrimethamine resistant and sensitive lines of Indian origin to cyclogua-nil (the active metabolite of proguanil). These considerations prompted us to perform a series of experiments with a view to assess the potential usefulness of cycloguanil in circumventing and combating the problem of pyrimethamine resistance in falciparum. It has been found that falciparum lines resistant to pyrimethamine are selected much faster than for cycloguanil resistance. Highly resistant pyrimethamine lines are predis­posed for faster selection to cycloguanil resistance. Resistance acquired to pyrimethamine is stable. Py­rimethamine resistant parasites acquire a degree of cross resistance to cycloguanil and to another DHFR inhibitor, methotrexate but do not show any cross resistance to other groups of antimalarial drugs. Cyclogua­nil and pyrimethamine induce the formation of gametocytes in non-gametocyte forming clone. There has been no synergistic activity observed between cycloguanil and pyrimethamine. The deployment of triple drug combination of pyrimethamine, cycloguanil and sulfadoxine to impede the spread of resistance should be seriously considered.

INTRODUCTION

Pyrimethamine and cycloguanil, the active metabolite of proguanil, are the

two most widely used DHFR inhibitor antimalarial drugs. Soon after introduc­

tion of proguanil, reports of resistance in P. falciparum started emanating from

endemic areas around the world (Chaudhuri and Chaudhuri 1949; Field and Edeson

1949; Adams and Seaton 1949; Covell et al. 1949). These observations led Nicol

(1953) to suggest that 200 mg daily dose of proguanil would be better than 100 mg.

Since that time there have been numerous reports of the failure of daily proguanil

prophylaxis (100 mg) to prevent the development of P. falciparum, but with very

few well documented case histories. The real incidence of proguanil prophylactic

resistance appears to be in doubt, but many British authorities retain a firm belief

in continuing efficacy of this compound as a prophylactic against falciparum ma­

laria (Peters 1984a). Proguanil is not available and used in India since early

1950s. This is mainly because of the availability of pyrimethamine which has

74

proved, weight for weight, to be many times more active than proguanil (Bruce-

Chwatt et al. 1981), less expensive and has a longer retention time, thus it super­

seded the use of proguanil. Pyrimethamine resistance has followed a similar

history to that against proguanil. Since 1952 there have been many reports of

pjn'imethamine resistance in all species of human malaria (Coatney et al. 1952;

Wilson 1952; Young 1967; Burgess and Young 1959). There is abundant evidence

to indicate that pyrimethamine resistance is widely distributed throughout ma­

laria endemic areas of the world (WHO 1965, 1973), so also in India (Gajanana et

al. 1984). It will be of interest to ascertain the susceptibility of pyrimethamine

resistant and sensitive lines from an Indian isolate to cycloguanil in vitro, the

drug which has not been in wide use for over fifty years now in India and in the

absence of any authentic clinical data from other endemic areas of the world with

regard to susceptibility to cycloguanil. These observations/considerations provided

an impetus to design the following experiments with defined objectives, with a

view to assQss the potential usefulness of cycloguanil in circumventing and com­

bating the problem of pyrimethamine-resistance in falciparum:

a) To evaluate the speed of selection of resistance to the two DHFR inhibitor

antimalarial drugs by subjecting a cloned P. falciparum line in vitro to py­

rimethamine or cycloguanil pressure, b) To isolate a series of progressively resis­

tant P. falciparum lines to each of these two drugs that will be useful in the study

of the mechanisms of evolution of resistance to DHFR inhibitors, c) To determine

the extent of cross-resistance acquired to each of them at various stages of resis­

tance and to look susceptibility profile changes, if any, to other antimalarials, d)

To ascertain if resistance to one drug predisposes the parasites to be selected

faster for resistance to the other drug, e) The two DHFR inhibitors are toxic to

the same or different stages of P falciparum, f) Synergistic or additive virtues of

these two compounds in vitro, g) To characterize the resistant lines selected with

regard to biological advantage, if any.

This chapter describes the findings of aforementioned experiments.

MATERIALS AND METHODS

Parasites

Isolate FCD-4 and a clone F-56 derived from this isolate were the two P.

falciparum parasite lines used in the present study. The clone was obtained by

limiting dilution method (Rosario 1981) from the erythrocytic stages of parasites

cultivated continuously in vitro employing candle-jar procedure of Trager and

Jensen(1976). The FCD-4 was isolated locally from an infected patient( Nair and

Bhasin 1993).

Stock solutions of drugs

Pyrimethamine lO^ M stock solution was prepared in 0.05% lactic acid and

10'^ M stock of cycloguanil in 70% ethanol. Chloroquine sulphate solution con­

tained chloroquine base equivalent to 40 mg /ml. Methotrexate (amethopterin)

10'^ M stock solution was prepared in 60% DMSO. Artemisinin (qinghaosu) Img/

ml of the stock solution was made in DMSO. Drugs were filter sterilized and

stored at 4 °C. Further dilutions were made in RPMI-1640 medium prior to use.

Stock culture of parasites

Parasite stocks were maintained in glass Petridishes (10 cm diameter) by

the candle jar method (Trager and Jensen 1976) in A+ human erythrocytes using

RPMI-1640 medium supplemented with AB+ serum. Blood products were procured

commercially. Starting parasitemia in these cultures was less than 1% and he­

matocrit 8% in a total of 12 ml erythrocyte cell suspension in each Petridish. The

cultures were diluted every 4 or 5 day with uninfected erythrocytes to restore the

parasitemia and hematocrit to less than 1% and 8%, respectively.

In vitro Gametocytogenesis

Cultures were intiated in glass Petridishes to determine the capability of

falciparum isolate/clone to form gametocytes in vitro (Bhasin and Trager 1984).

76

Each Petridish (5 cm diameter) was seeded with 5 ml of culture material having

8% hematocrit and less than 1% parasitemia. An initial zero hour slide of seeding

material was made to determine the exact parasitemia and gametocytemia. The

cultures were incubated at 37 °C in a candle-jar with daily change of medium for

eight consecutive schizogonic cycles without addition of uninfected erythrocytes.

Thick blood smear of 10 /il material of 60% cell suspension was made every 48

hours. Gametocytemia was assessed by examining minimum of 100 fields. The

gametocytes were classified as stage II to V (Hawking et al. 1971).

Susceptibility test method

Susceptibility of parasites to DHFR inhibitors and other antimalarials

was determined by exposing parasites in triplicates to graded concentrations of

each drug using the modified 48 hours test method (Nguyen-Dinh and Payne 1980).

The experiments were conducted in 24-well tissue culture plates by setting up

microcultures with different drug concentrations (ranging from 1 0 " to 10 ' M

with five fold difference or less for DHFR inhibitors). The parasite material for

experiments was obtained from stock cultures and subjected to sorbitol lysis

(Lambros and Vanderberg 1979), to obtain synchronized ring stages. The para­

sitemia was adjusted to less than 1% with uninfected fresh erythrocytes and this

material was made to 50% cell suspension with complete RPMI medium. Aliquots

of 20 /il of the suspension were added into series of wells of the test plate, each

holding 480 fi\ of complete medium with or without drug, yielding final cell sus­

pension of 2%. Loaded test plates were incubated at 37 °C in a candle-jar for 96

hour with daily change of medium. The drug was included in experimental wells

for first two days only. Blood smears were made at the end of 48 and 96 hours,

stained with Giemsa. Minimum of 5000 erythrocytes were enumerated to deter­

mine parasitemia in each well. Percentage reduction of parasitemia in relation to

control was calculated from percentage inhibition of growth. Fifty percent ,90%

and minimum complete inhibitory concentration (ICg^, ICg and MIC, respectively

7 7

) were extrapolated from semilog plot of varying concentrations'c^^fiftiiTst pa:;|iiJ«S^>^ . .^ • ^ ? \

inhibition of growth obtained from triplicate wells. ; '^' . > ' Ice. iVo )

Selection for increased antifol resistance Vi^v. ~ - > B 2 _ 7

The cloned falciparum line was subjected in vitro to severa^^^flfl^^if^i^cri^as-

ing drug pressure in multistep manner to select a series of progressively resistant

P. falciparum lines. Small glass Petridishes holding 5 ml of drugged medium with

starting erjrthrocytic cell suspension of 5% hematocrit and 2% parasitemia were

incubated at 37 K3 for 48 hour, drugged medium was replenished after 24 hours.

The drug concentration selected for exposure of the parasites, in the first-step,

was little lower than the ICg of the parasites. The surviving parasites were

allowed to multiply in the drug free medium till the parasitemia reached to about

2%, and these parasites were re-exposed to the first-step drug concentration for

another 48 hours followed by growth in drug free medium. This procedure contin­

ued till the 48 hours drug pressure concentration used in the first-step did not

retard the parasite multiplication, that is atleast five fold increase in parasitemia

could be obtained in a schizogonic cycle with starting parasitemia of around 0.5%.

In the second-step these parasites were exposed for 96 hours to the selected con­

centration of the drug, followed by the propagation in the drug free medium until

the parasitemia reached to around 2%. Drug was included again in the medium

for 96 hours duration of parasite multiplication and the procedure was repeated

till atleast five fold increase in parasitemia was achieved in the first 48 hours

with starting parasitemia of around 0.5% in presence of drug pressure. In the

final-step of the first round of selection the surviving parasites were grown under

continuous drug pressure till the rate of multiplication of these parasites was equal

to that of control parasites grown in drug free medium, for a few cycles. The

selected parasites of first round of selection were subjected to next round of selec­

tion pressure with five fold (or less) increase in the drug concentration by the

same multistep procedure as described for the first round. This protocol for selec-

78

tion was repeated for each of the subsequent rounds. Selected parasites were peri­

odically cryopreserved (Rowe et al. 1968) in liquid nitrogen for future use.

Cross resistance

The derived falciparum line resistant to one of the DHFR inhibitors was

evaluated for its sensitivity profile to the other antifol. In addition the suceptibility

of the highly pyrimethamine-resistant line to other antimalarials and another

DHFR inhibitor amethopterin was evaluated to determine the degree of cross re­

sistance acquired by this selected line.

Stability of resistance

In order to assess, if the selected resistant phenotype of the parasite cell

line is stable or lost once the drug pressure is discontinued for an extended period

of time during continuous cultivation, the susceptibility to pyrimethamine of these

parasites was determined at the end of 60 weeks of continued growth in drug free

medium and compared with that of the original resistant cell line kept under

constant drug pressure. The parasites were cultivated in glass Petridishes hold­

ing 5 ml of erythrocyte suspension in RPMI-1640 by candle jar method, with

dilution of cultures every 4 or 5th day by restoring the parasitemia to less than 1%

and hematocrit to 5%.

Stage-specific sensitivity to DHFR inhibitors

Highly synchronized parasites of clone F-56 were employed to look for dif­

ferences in toxicity of pyrimethamine and cycloguanil, if any, to the specific stages

of P. falciparum. Asynchronously multiplying parasites with atleast 5% parasitemia

and containing majority of the parasites in the ring stage were used for triple

sorbitol synchronization (Lambros and Vanderberg 1979). The culture material

was centrifuged at 2000 rpm for 5 min, the supernatant was discarded and the

pellet resuspended in 5 volumes of sterile 5% sorbitol in distilled water for 7 min

at room temperature. After incubation the parasite material was centrifuged and

the supernatant discarded. The pellet was washed thrice with RPMI medium and

79

culture was reestablished by addition of fresh uninfected erythrocytes in the me­

dium containing 10% serum supplement. At 40 hours following the first sorbitol

treatment the parasites were treated again with 5% sorbitol in the same afore­

mentioned manner to increase the synchronization (Vial et al. 1982). Freshly

washed erythrocytes were added to the infected cells and culture was set again.

Seven hours later the culture material was subjected to third and final treatment

with sorbitol , so as to obtain 0-7 hour old ring stage parasites. The pellet was

thoroughly washed in order to avoid the influence of trace amounts of sorbitol on

the parasites. This material was mixed with freshly washed uninfected cells to

obtain the final parasitemia between 0.5 to 1% in 50% erythrocyte cell suspension.

Stage-specific effect of pyrimethamine and cycloguanil was determined by

exposing different synchronized erythrocytic stages of P. falciparum clone F-56 to

either 1.5 x 10'® M concentration of pyrimethamine or 7.2 x 1 0 " M cycloguanil, the

concentrations used cause 50% inhibition of parasite growth in vitro. The experi­

ments were performed in 24-well tissue culture plates. Infected erythrocyte mate­

rial in aliquots of 20 ptl with about 0.7% parasitemia was inoculated in each well.

The experiment was divided into following five test groups:

Group 1- as control group, parasites were cultivated in drug free medium

Group 2- early ring stage, parasites were cutured in medium containing either

cycloguanil or pyrimethamine from 0-12 hours and thereafter in drug free me­

dium.

Group 3- parasites were exposed to the drug in the late ring or early trophozoite

stage that is the parasites were cultured in medium containing drug from 12-24

hours.

Group 4 - parasites were exposed to the drug in trophozoite stage of their life cycle

that is they were cultured in the presence of drug from 24 to 36 hours of the 48

hours of life cycle.

Group 5 - parasites were cultured in medium containing drug in the schizont stage,

80

the parasites were kept in drug free medium from 0-36 hours followed by 12 hours

in presence of the drug.

The experiments were done in triplicate. At the end of 48 hours thin blood

films were made from each of the experimental wells. The slides were stained in

Giemsa solution. Antiparasite effect of the drugs on early rings, late rings, tro­

phozoite and schizont infected erythrocytes were determined by comparing the

percentage inhibition of parasite growth in drug treated parasites to that in drug

free controls.

Synergism

Synergy, the ability of one drug to potentiate the activity of another drug

was evaluated algebraically by determining the sum of the fractional inhibitory

concentration (FIC) of a combination of drugs. The FIC of a drug is its effective

concentration in combination with another drug divided by its effective concentra­

tion alone. When the sum of the FIC is < 1; it indicates synerggism; value = 1

indicates additive effect and values > 1 indicates antagonism. To examine the

combined effect of pyrimethamine and cycloguanil in vitro on pyrimethamine re­

sistant line derived from the clone F-56 the method of Berenbaum (1978) was

employed. First IC^^ values for each drug when used alone was determined. The

parasites were exposed for this purpose either to different concentrations ranging

from 1 x 10" M to 8 X 10'* M of pyrimethamine or 6 x 10* M to 4 x l O ' M of

cycloguanil in multiwell plates for 48 hours and 10^^ values were determined by

studying the slides made at the end of 96 hours, as described elsewhere. To test

for synergism, a reference combination of the two drugs consisting of half of the

concentration close to IC^^ of each drug was prepared in complete RPMI medium

and actual IC^^ of this combination was determined together with parallel deter­

mination of ICgj, values of the drugs when used alone for estimating the FIC val­

ues.

Biological advantage of pyrimethamine resistant parasites

81

In order to asses any biological advantage acquired by the pyrimethamine

resistant (PS-5) line selected over the parent sensitive clone F-56 with regard to

growth in vitro, the following two experiments were performed. First, the growth

rate of the sensitive and the resistant parasites was compared in vitro. Second,

equal number of PS-5 and F-56 parasites were mixed, and sensitivity to py­

rimethamine of this mixed population evaluated immediately and after a year of

continuous cultivation in drug free medium. Aliquots of the mixed parasite cul­

ture prepared at the beginning of experiment was also cryopreserved for subse­

quent resuscitation and comparison of pyrimethamine sensitivity with that of the

mixed parasite population kept under continuous cultivation for a year.

RESULTS

Susceptibility profile of the parasites used: Susceptibility of jR falciparum clone F-

56 and the isolate FCD-4 to pyrimethamine, cycloguanil, and chloroquine was de­

termined in vitro. ICg^ and ICj^ values are presented in Table 5.1.

Table 6.1 In vitro susceptibility of erythrocytic stages of P falciparum (FCD-4 and F-66) to antimalarial drugs, determined by 48 hour test. The starting para­sitemia was less than 1% and hematocrit 2%

Drug

IC«o

Clone F-56

i c . IC,o

Isolate FCD-4

IC«o

Pyrimethamine* 1.5 3.6 1.5 4.6

Cycloguanil* 0.072 0.27 0.084 0.68

Chloroquine* 46.89 84.4 56.26 218.85

Data in *= nM

82

MIC for each of these drugs respectively was found to be 5 x 10'^ M, 5 x 10-*°M and

1.87 X l O ' M for clone F-56. MIC required for FCD-4 for pyrimethamine, cyclogua-

nil, and chloroquine was 10"®M, 4x lO^M and 1.87x 10''M, respectively. Chloro-

quine was found to be equitoxic to the clone and the parental isolate as observed

by MIC.

In vitro gametocytogenesis

Isolate FCD-4 and the clone F-56 were used for gametocytogenesis. Thick

smear of the isolate made at the end of first schizogonic cycle showed the presence

of a few gametocytes. The number of gametocytes in the thick smears increased in

the subsequent schizogonic cycles. However, no gametocyte formation was ob­

served in any of the smears made from the clone F-56 maintained under similar

conditions for eight schizogonic cycles. The F-56 was confirmed to be non-game-

tocyte forming clone under in vitro conditions of continuous cultivation in drug

free medium by performing these experiments repeatedly. The gametocytes were

not observed even after 20 days of continuous culture without dilution.

Selection of falciparum lines resistant to pyrimethamine

The number of days required to select in vitro a series of increasingly py­

rimethamine resistant P. falciparum lines from the clone F-56 and the drug con­

centrations used in each cycle of the selection process are depicted in Figure 5.1

A. It took a total of 348 days of continuous cultivation of F-56, in presence or

absence of drug pressure, to obtain the most resistant parasites that could multi­

ply at the highest selective drug concentration of pyrimethamine (10"* M) em­

ployed. In total of seven rounds of selection there was five or twofold increase of

drug pressure during each successive rounds. A series of progressively resistant

cell lines from PS-1 to PS-5 were cryopreserved in between and their sensitivity to

83

pyrimethamine in vitro evaluated, shown in Table 5.2. Each successive line of the

series was less sensitive to the preceding line by 2.4 to 8 folds as adjudged by IC g

value. The parasite line PS-5 showed 2400 fold decrease in sensitivity to py­

rimethamine compared to parent clone F-56.

Table 5.2 Sensitivity to pyrimethamine of the series of selected parasite lines

derived in vitro.

Selected cell line

F-56 clone

PS-1

PS-2

PS-3

PS-4

PS-5

ic«,

1.5 X 10-»M

3.8 X 10-»M

2.6 X 10« M

2.1 X lO 'M

5.1 X 10 ' M

3.6xlO-«M

ic^

3.6 X 10-»M

2.3 X 10-» M

9.4 X 10-8 M

8 X 10-' M

6.2 X 10-« M

8 X 10-« M

MIC

5xlO-»M

5xlO-8M

5x lO- 'M

2.7 X 10-«M

5xlO-«M

> 1 X 10-* M

Selection of falciparum line resistant to cycloguanil

To select cycloguanil resistant falciparum lines the clone F-56 was continu­

ously cultivated in vitro with or without cycloguanil pressure for a total duration

of 351 days. Only about seventy five fold decrease in sensitivity was registered in

the derived line during this selection. Time required to achieve each level of

decresed sensitivity to cycloguanil is shown in Figure 5.1 B. In vitro senstivity

studies with cycloguanil showed that IC^ , ICg and MIC of the parasite line de­

rived at the end of selection period to cycloguanil were 5.4 x 10'^ M , 3.6 x 10-* M

84

and 5 x 10*M, respectively.

Gametocytogenesis during selection

An interesting observation made during the selection process was the for­

mation of gametocytes in culture by the non-gametocyte forming clone F-56 under

drug pressure. Healthy gametocytes of various stages were observed in thick and

thin blood films made from the cultures kept under sub-inhibitory concentrations

of the drugs. At concentrations equal to or higher than the MIC the gametocytes

formed were phenotypically unhealthy. Gametocyte production was very low, since

in most of the blood films examined less than one gametocyte per 15,000 erythro­

cytes was observed. No correlation could be made between the concentration of

drugs in culture and the number of gametocytes formed.

Cross resistance

The falciparum lines selected for pyrimethamine resistance in vitro acquire

a degree of cross resistance to cycloguanil and to another potent DHFR inhibitor,

amethopterin (methotrexate). Results of the cross resistance studies to these drugs

are presented in Table 5.3 and 5.4.

Table 5.3 Sensitivity to cycloguanil of the series of pyrimethamine selected para­

site lines derived in vitro.

Selected cell line

F-56 clone

PS-1

PS-2

PS-3

PS-4

PS-5

IC.0

7 . 2 x l O " M

6 . 2 x l O " M

4.6 X 1 0 " M

SxlO-^M

7 X 10-8 M

7.4xlO-»M

ic,„

2 . 7 x l 0 i ° M

4.9 X lO-io M

6 X lO-i" M

8.6 X 10-» M

4.3 X 10-« M

3.1xlO-''M

MIC

5 x l O " M

lxlO-«M

3.8 X 10-»M

5 x l O « M

8xlO-«M

4 X 1 0 ' M

85

Table 5.4 Sensitivity of clone F-56 and the highly pyrimethamine-resistant

selected paras i te line PS-5 to chloroquine (CQ), ar temisinin (QHS) and

amethopterin (MTX) in vitro.

Drug F-56 PS-5

IC,„ IC,, MIC IC,„ IC^ MIC

CQ* 0.011 0.027 0.06 0.017 0.035 0.06

QHS* 0.0017 0.004 0.005 0.0015 0.0038 0.005

MTX 2.9xl0-8M 6.9xl0-8M IxlO'M 1.5xlO-'M 2.9xlO-'M 6.9xl0-«M

* values in ng/ml

Selection of cycloguanil resistance in pyrimethamine resistant falci­

parum derived line (PS-5)

Predisposition, if any, of the pyrimethamine resistant cell line to be se­

lected faster for cycloguanil resistance was evaluated by exposing highly resistant

PS-5 line to increasing concentrations of cycloguanil in a step wise fashion in vitro

for 40 days. During this short duration of selection there was 7.3 fold decrease in

the sensitivity to cycloguanil.

Stability of resistance

There was no marked difference observed in the susceptibility to py­

rimethamine of PS-5 parasite line, determined at the start and end of sixty weeks

of continuous cultivation without drug pressure. IC^ , ICj^ of this line at the be­

ginning and at the end of this experiment were found to be 3.6 x 10" M, 8.8 x 10- M

and 4..1 x 10-«M, 8.2 x 10-«M, respectively.

Stage-specific sensitivity to DHFR inhibitors

The experimental parasite material examined immediately after triple sor-

8 0

bitol treatment consisted almost entirely of single and mutiple ring form infec­

tions and uninfected erythrocytes. The synchronised parasite stages obtained are

shown in Figures 5.2 to 5.5. No significant lysis of uninfected erythrocytes was

observed.

The ICg value of pyrimethamine or cycloguanil was chosen to expose the

synchronized stages of the parasites to determine the stage specific toxicity of the

DHFR inhibitors to ring (Figure 5.2), trophozoite(Figure 5.3) and schizont(Figure

5.4) infected stages. Percent decrease in parasitemia observed at the end of the

schizogonic cycle was maximum when late ring or trophozoite stages were under

drug pressure (Figure 5.6). Rings were least susceptible to DHFR inhibitors.

Marked difference in stage specific toxicity between pyrimethamine and cyclogua­

nil was observed in group-5 where the parasites were exposed in schizont stage

(36-48 hours) of the development. When the schizonts were exposed to these drugs

95% of subsequent ring stage production was inhibited by cycloguanil, whereas

56% inhibition was seen with pyrimethamine.

Synergism

The parasites of the highly pyrimethamine resistant line PS-5 derived from

the clone F-56 were found to be more sensitive to pyrimethamine than to cyclogua­

nil. The IC90 values of the two drugs when evaluated alone were 8.6 x 10'^ M for

pyrimethamine and 3.2 x 10 'M for cycloguanil. Concentration of 4x10"^ M of py­

rimethamine and 2x10' M of cycloguanil used in combination caused 90% inhibi­

tion of the parasite growth. Sum of the FIC values were close to 1 as calculated by

the following formula of Berenbaum (1978):

4xl0-« / 8.6xl0-« + 2x10' / 3.2x10' = 1.08

The sum of the FIC values for some other combinations of pyrimethamine and

cycloguanil tested also gave figures close to 1. These results show no significant

potentiation of antimalarial activity between cycloguanil and pyrimethamine

against the asexual erythrocytic stages of P. falciparum. The combinations of the

87

two DHFR inhibitors, pyrimethamine and cycloguanil demonstrated at best only

an additive effect.

Blologfical advantagfe of pyrimethamine resistant parasites

Table 5.5 shows the multiplication ability of pyrimethamine sensitive par­

ent clone F-56 and the highly pyrimethamine resistant line PS-5 for two consecu­

tive erythrocytic schizogonic cycles in vitro.

Table 6.6 In vitro parasite multiplication as determined by multiplication factor

(MF) and parasite multiplication rate (PMR) in multiwell tissue culture plates.

Starting percentage parasitemia in F-56 and PS-5 were 0.82 and 0.68, respec­

tively.

Parasite Erythrocytic schizogonic cycle

First Second

MF PMR MF PMR

F-56 5 0.75 2.86 0.45

PS-5 5.6 0.7 2.28 0.49

From the parasite multiplication rate (PMR) for the two consecutive schizogonic

cycles it can be inferred that parasites of the sensitive clone and the resistant line

have similar multiplication ability. Results of pyrimethamine sensitivity tests

performed on mixed population of resistant and sensitive parasites at the begin­

ning and at the end of 56 weeks of continuous cultivation in drug free medium,

show no marked change in the susceptibility of the parasites to this drug.

o o

DISCUSSION

Complete inhibition of multiplication of P. falciparum strains sensitive to

chloroquine has been reported to take place in vitro at a concentration of 10 ng/ml

(Nguyen Dinh and Trager 1980). Based on this observation both isolate FCD-4

and clone F-56 are chloroquine resistant, the clone being more sensitive than the

parent isolate. Similarly the parasites capable of multiplying in a medium con­

taining l O ' M pyrimethamine (Smalley and Brown 1982) or cycloguanil (Watkins

and Sixsmith 1984; Eriksson et al. 1989; Peterson et al. 1990) are likely to be

resistant to this DHFR inhibitor to some extent. Amount of pyrimethamine or

cycloguanil needed to achieve complete inhibition has been at least ten fold less

than this concentration. Clearly, therefore, the parasites employed in this study

are sensitive to the DHFR inhibitors. It has long been known that a single asexual

parasite can give rise to both male and female gametocytes as well as more of

asexual forms(Downs 1947). Some of the asexual parasites are incapable of giving

rise to the sexual forms (Bhasin and Trager 1984). These mutants will not able to

propagate in nature beyond the host of their origin. Another novel phenotypic

feature of the clone F-56 is that it does not form gametocytes in drug free medium,

whereas the parent isolate FCD-4 is a good gametocyte forming line in vitro.

Pyrimethamine and cycloguanil are the two DHFR inhibitor antimalarial

drugs developed but pyrimethamine has been deployed on much larger scale than

cycloguanil because of its longer retention time and smaller dose needed for cure

(Bruce-Chwatt 1985). These drugs have been extremely useful in treatment of

chloroquine resistant falciparum infection but the limiting factor has been the

quick development of resistance among the parasite population against these drugs

(Bishop 1962; Diggens et al. 1970). The development of resistance to these inhibi­

tors has been associated in the field with heavy use of monotherapy with the

drugs in a particular area and emergence of resistance has been observed to be

sporadic and multifocal. The ease of development of resistance to these drugs has

89

suggested that a mutation at a single locus is likely to be involved. Analysis of

res is tance to pyrimethamine and proguanil in experimental malar ia , P.

gallinacium, also suggests the involvement of a single gene (Bishop 1962). Resis­

tance to pyrimethamine has been developed in P. yoelii in a single step by Diggens

(1970) and later by Walliker et al. (1975) in P. chabaudi. Morgan (1974) obtained

a pyrimethamine resistant line of jR yoelii from a clone of this species, demonstrat­

ing the origin of resistant mutants de novo. Cowman and Lew (1989) selected

P3n*imethamine resistant parasites of P, chabaudi in vivo by passaging parasites

four times through mice treated with increasing doses of the drug. Banyal and

Inselberg (1986) have been successful in obtaining pyrimethamine resistant lines

of P. falciparum in vitro using two different protocols. In one of the protocols, they

exposed the sensitive strain to increasing concentration of pyrimethamine in a

series of selection steps while in the other, they first exposed the sensitive para­

sites in vitro to a mutagenic agent, the N-methyl-nitro-N-nitrosoguanidine

(MNNG), and then to a single high dose of pyrimethamine for selection of resis­

tant survivors. The relapse protocol adopted in the present study for selection of

resistant lines to the two DHFR inhibitors is slow but very succesful in selecting

parasites exhibiting a very high level of resistance to pyrimethamine atleast. The

highest pyrimethamine resistant line obtained showed 2400 fold increase in ICg

value compared to the parent clone. However, for reasons unknown we did not

succeed in deriving parasite lines showing high level of resistance to cycloguanil.

Failure to obtain cycloguanil resistance is quite intriguing in view of the fact that

both pyrimethamine and cycloguanil are structurally somewhat similar, both are

potent inhibitors of the DHFR enz3rme of the Plasmodium and exert their toxic

effect by binding to this enz3ane. This observation is attractive from application

point of view, as the experiments here have clearly demonstrated that in vitro

emergence of pyrimethamine resistance is much faster and stronger than cyclogua­

nil in P. falciparum. It should be of great interest to know, if under field condi-

90

tions also, the emergence of resistance to pyrimethamine is faster than cyclogua-

nil in P. falciparum. No serious studies have been carried out in this regard, so

far. It is not known whether cycloguanil and pyrimethamine share the same bind­

ing site on the DHFR enzyme, neither it is clear whether the acquisition of resis­

tance to one of the drugs necessitates concomitant resistance to the other. The

existence of field isolates resistant to both pyrimethamine and proguanil is well

documented, so also the presence of natural isolates sensitive to one drug and

resistant to the other and vice versa (Schapira 1984; Watkins et al. 1984). Recent

reports on the molecular basis of pyrimethamine resistance in P. falciparum have

implicated an accumulation of point mutations being associated with increasing

resistance to pyrimethamine (Foote et al. 1990). Analysis of the P. falciparum

DHFR from different parasites reveal the structural basis of differential suscepti­

bility to these antifol drugs. Parasites harboring a pair of point mutations from

Ala 16 to Val 16 and Ser 108 to Thr 108 are resistant to cycloguanil but not to

pyrimethamine (Inselburg et al. 1988; Tanaka et al. 1990; Foote et al. 1990). A

single Asn 108 mutation, on the other hand confers resistance to pyrimethamine

with only a moderate decrease in susceptibility to cycloguanil (Cowman et al. 1988;

Peterson et al. 1988; Snewin et al. 1989; Zolg et al. 1989). These and other related

inferences are compiled from the studies made on parasites originating from dif­

ferent places. The moleculeir basis of resistance to cycloguanil and pyrimethamine

of selected lines derived in the present study should provide more meaningful and

accurate inferences to be drawn, as these lines have all originated from the same

sensitive parent genome of the clone F-56.

An interesting observation made during the selection of antifol resistant

parasite lines is that the non-gametocyte forming clone occasionally formed some

gametocytes under drug pressure. A marked increase in the number of circulating

gametocytes in P. falciparum infected patients has been reported following treat­

ment with antimalarial drugs like pyrimethamine, proguanil and sulphadiazine

91

(Findley et al. 1946; Mackerras et al. 1947; Ramakrishnan et al. 1952; Shute and

Maryon 1954). Increase in gametocyte production has also been observed in P.

gallinaceum treated with sulphadiazine and proguanil, whereas no such increase

has been recorded during treatment with chloroquine, mepacrine or pamquine

(Bishop 1954). But these observations are based on in vivo systems and it is well

known that the number of gametocytes produced during an infection is highly

variable. The factors responsible for these variations have not been exactly iden­

tified. Therefore, there had always been suspicion regarding the increased num­

ber of gametocytes observed in vivo following treatment with DHFR inhibitors.

This suspicion has been cleared by this study, as it has been amply demonstrated

that DHFR inhibitors somehow induce the formation of gametocytes, even in a

non-gametocyte forming clone.

No marked cross resistance to cycloguanil has been observed in parasites

selected for low levels of resistance to pyrimethamine. But the highest py­

rimethamine resistant line (PS-5) exhibits 1027 fold increase in cycloguanil IC^^

value. No cross resistance has been seen in the highest pjrrimethamine resistant

line (PS-5) to chloroquine or artemisinin. This is also expected as both chloro­

quine and artemisinin are structurally different from pyrimethamine and have

dissimilar mode of actions. However, there is clear evidence of cross-resistance to

methotrexate, another DHFR inhibitor. Concentration of 1 0 ' M of methotrexate

causes complete inhibition of pyrimethamine sensitive clone F-56 in vitro whereas

there is only 26% inhibition of pyrimethamine resistant line PS-5. Selection of

methotrexate resistant Leishmania parasites in vitro has shown gene amplifica­

tion leading to the overproduction of the DHFR enzyme in methotrexate resistant

parasites (Coderre et al 1983), reminiscent of those observed in methotrexate re­

sistant mammalian cells and fibroblasts (Haber et al 1981). Reduced binding of

methotrexate to DHFR (5 to 10 fold) in parasite extracts has also been reported in

pyrimethamine resistant P. falciparum parasites selected in vitro ( Inselburg et

al. 1988). Part of the explanation for the decreased sensitivity of pyrimethamine

resistant line to methotrexate may be attributed to the altered structure of the

DHFR during the selection process that has reduced binding capability to

methotrexate.

Selection of parasites exhibiting increased resistance to cycloguanil has been

obtained relatively faster in the parasite from the parasites that have been se­

lected earlier for pjn-imethamine resistance than from the pyrimethamine sensi­

tive parasites. This demonstrates that acquisition of resistance to pyrimethamine

predisposes parasites to become resistant faster to a related antimalarial drug

like cycloguanil, atleast in vitro. Foote et al. (1990) postulate that factors respon­

sible for pyrimethamine resistance may be genetically linked to cycloguanil resis­

tance, since both these drugs show structural similarity and have similar mode of

action. Cycloguanil resistance causing factors are perhaps not as actively selected

as those of p3n*imethamine and this might be responsible for less common occur­

rence of cycloguanil resistance.

A little studied aspect of drug resistance in malaria parasites is the capac­

ity of the resistant forms to persist in the absence of drug pressure. This aspect is

important especially in situations where the use of a particular drug has been

discontinued for a long period with a hope that the resistant mutant forms would

revert to sensitive phenotype in absence of drug pressure. This thinking is based

on an assumption that on withdrawal of drug pressure resistant genes would be at

a disadvantage or might not be of any use to the parasite and thus would be

selected out in favour of some specific sensitive genes. However, contradictory

observations have been made in this regard for instance, Jensen et al. (1981) have

observed a case of clinical drug resistant falciparum malaria acquired from an

initially chloroquine sensitive strain. A marked decrease in the level of sensitiv­

ity to chloroquine in falciparum has been observed after a few weeks of cultivation

by Le Bras et al. (1983). Our studies with pyrimethamine resistant parasite lines

93

cultivated in drug free medium for an extended period of time in vitro, indicate no

appreciable change in the level of sensitivity to pyrimethamine, clearly showing

that resistance acquired by the parasites is stable and the resistant parasites do

not show any biological advantage of overgrowing the sensitive parasites in vitro.

Clyde (1967) has provided epidemiological evidence to the fact that drug resis­

tance once arisen, can survive and spread in the absence of further drug treat­

ment. It has been reported pyrimethamine resistant P. falciparum in regions of

Tanzania several years after the large scale use of the drug has ended. Further

there are evidences that the pyrimethamine resistance has spread from its pre­

sumed place of origin into surrounding areas in which no pyrimethamine is be­

lieved to have been used (Clyde 1967). Similar findings concerning cycloguanil

are lacking.

The potentiating effects of pyrimethamine and sulfadiazine in treatment of

P. falciparum infection in man has been demonstrated for the first time by Goodwin

(1952). Drug combination of pyrimethamine and sulfadoxine (Fansidar) has been

deployed exclusively for both therapy and prophylaxis in countries where multidrug

resistant P. falciparum is a problem (Peters 1990c). A combination of pjrrimethamine

and dapson is also available under the name maloprim, though less popular (Worth

and Werbel 1984). Unfortunately, resistance to these drug combinations have be­

gun to emerge on a serious scale from various parts of the globe (Peters 1990b). In

the present study it has been shown that there is no significant potentiating or

synergistic antimalarial activity between cycloguanil and pyrimethamine when

used in combination. Yeo and Rieckmann (1992) have also reported the absence of

potentiation of antimalarial activity between cycloguanil and pyrimethamine. This,

however, does not imply that the two drugs should not be used in combination.

The identification of mutually exclusive point mutations in the DHFR gene encod­

ing resistance to the two most widely used DHFR inhibitors (pyrimethamine and

cycloguanil) and the observation that more extensive multiple mutations (that are

94

less likely to arise frequently) are required for resistance to both the drugs (Foote

et al. 1990; Peterson et al. 1990), suggests an innovative approach to the deploy­

ment of a triple drug combination of pyrimethamine, cycloguanil, sulfadoxine to

impede the spread of resistance in P. falciparum to the DHFR inhibitor antima­

larials. The suggestion should be seriously considered for further in depth inves­

tigation.

Figure 5.1 The pattern of selection of progressively pyrimethamine-resistant (A) and cycloguanil-resistant (B) P. falciparum lines obtained in vitro from the clone F-56. The selective drug concentrations at which the parasites grew are shown. Beside the drug concentration, in parentheses is the number of days after the initial expo­sure to the drug that parasites grew normally in presence of drug concentration. The five pyrimethamine-selected lines, PS-1 to PS-5 growing at progressively higher con­centrations are shown.

Selection to pyrimethamine

(days)

F-56, initial IC^„= 1.5 xlO-«M

Cone.

10-»M (24)

• PS-1 5 X 10»M (38)

10-»M (58)

t PS-2 5xlO-8M (84)

f PS-3 10-'M (57)

f PS-4 S x l O - ' M (45)

I 10-«M (42) PS-5

B

Selection to cycloguanil F-56, initial IC = 7.2 x l O " M

Cone. (days)

5 x l O " M

I 8 x l O " M

i 10 •" M

I 2xlO"'M

i 4xlO"'M

\ 6xlO'»M

\ 10 «M

1 2x lO»M

(32)

(29)

(20)

(47)

(58)

(54)

(67)

(44)

Figure 5.2 A Geimsa stained thin blood film from P. falciparum synchronised culture showing ring stages (0-7 hours old).

d

y

Figure 53 A Geimsa stained thin blood film from P. falciparum synchronised culture showing trophozoite stages.

lo

n

Figure 5.4 A Geimsa stained thin blood film from P. falciparum synchronised culture showing schizont stages.

n

13

Figure 5.5 Spontaneously released merozoites from a ruptured schizont in culture surrounding the free pigment.

Ik

j r

^

100

o en

"o

c _o

c

80

60

40

2 0 -

0 0

Pyrimethamine

K\N Cycloguani

1 2 5 4 0 - 1 2 1 2 - 2 4 2 4 - 3 6 5 6 - 4 8

Age of parasites ( hr

Figure 5.6 Sensitivity to pyrimethamine and cycloguanil in vitro of different synchronised P. falci­parum stages, rings (0-12 hours), early trophozoites (12-24 hours), trophozoites (24-36 hours) and schizonts (36-48 hours).

Chapter 6

CHARACTERIZATION OF PYRIMETHAMINE RESISTANT P. FALCIPARUM LINES

WITH A REPETITIVE OLIGONUCLEOTIDE PROBE AND DETECTION OF RESIS-

T \ N C E USING MUTATION-SPECIFIC POLYMERASE CHAIN REACTION

Abstract: Feasibility of assay methods for diagnosis of Plasmodium falciparum resistance to DHFR inhibitor antimalarials based on genetic characterization and alterations has been ex­plored. Restriction fragment length polymorphism (RFLP) and Southern hybridization with 21-oligomer probe, complementary to a repeat sequence existing in falciparum genome have been successfully applied to demonstrate the ability of this approach to detect prominent genetic alter­ations in the genome of highly resistant parasite DNA digested with Tag I or Alu I restriction enzymes. The RFLP studies clearly indicate that pyrimethamine causes point mutations in ge­nome of the resistant falciparum parasites at places other than the DHFR encoding region. Low levels of resistance to pyrimethamine escape detection by this technique. This approach can be used to discriminate highly resistant and sensitive parasites but because of certain inherent short­comings of Southern hybridization this method might not be employed for diagnosis of resis­tance. Polymerase chain reaction method has been explored to determine if mutation-specific primers can be used to diagnose pyrimethamine resistant parasites. Using the recent guidelines (Mullis 1994) for primer selection and consulting the falciparum DHFR gene sequence obtained from the databank (UNDP/World Bank/ WHO/TDR), the selected primers have been optimized for the most stringent annealing temperature which could be employed for effective amplification and detection of pyrimethamine resistance. These initial precautions led us to discriminate the sensitive and resistant P. falciparum cell lines using the counter primer and the two diagnostic primers employed without compromising the sensitivity of the technique.

INTRODUCTION

Point mutations, primarily within the gene sequence coding for the dihy-

drofolate reductase of P. falciparum, have been shown to impart pyrimethamine

resistance to these parasites (Peterson et al. 1988; Cowman et al. 1988; Zolg et al.

1989; Tanaka et al. 1990). The resistant parasites produce alterd DHFR enzyme

which retains its biocatalytic activity but looses the characteristic affinity binding

of pyrimethamine (Mc Cutchan et al. 1984; Walter 1986). Sequence comparison

of DHFR gene from pyrimethamine sensitive and resistant falciparum lines indi­

cate the pivotal role of amino acid 108 in the resistance mechanism to this antifol.

A single base exchange in position 323 of the DHFR coding region changes Thr-

108 or Ser-108 found in pyrimethamine sensitive parasites to Asn-108. Addi­

tional point mutations in the DHFR gene have been found to confer higher degree

of resistance (Foote et al. 1990). Due to their subtle nature, point mutations are

the most difficult to detect of all the genetic alterations by methods other than

sequencing. The development of technologies for detection and characterization of

these genetic alterations is having great impact in early cancer diagnosis, since

some point mutations have been implicated in several malignancies (Carter et al.

1992; van Mansfeld and Bos 1992; Tbminaga et al. 1992). The other area where

the potential of these technologies hold promise is the early detection of incipient

drug resistance, arising out of point mutations due to drug pressure, in parasite

populations and in understanding the mechanisms of drug resistance. Methods

currently utilized for detection and characterization of single base substitution,

deletion or insertion, other than sequencing are: a) RNAase mismatch cleavage

methods (Winter et al. 1985; Myers et al. 1985). b) The mismatch chemical cleav­

age (MCC) by generic denomination (Cotton et al. 1988; Montandon et al. 1989;

Gogos et al. 1990). c) The single strand conformation polymorphism (SSCP)

(Hayashi 1991). d) Restriction fragment length polymorphisms (RFLP). e ) Muta­

tion specific PCR. With the exception of the MCC, all these methods have been

successfully used with total genomic or total cellular RNA. They have been greatly

simpliHed by use of previously amplified nucleic acids in vitro by polymerase chain

reaction (PCR). In vitro test methods have widely been used for determining the

drug sensitivity of P falciparum isolates (Nguyein-Dinh and Payne 1980; Richards

and Maples 1979; Yisunsri and Rieckmann 1980) but there are several limitations

that affect their usefulness (Desjardins 1984). Feasibility of alternate assay meth­

ods based on RFLP and PCR are explored. This chapter will address the applica­

tion of the RFLP to the detection of genomic rearrangements in drug resistant

parasites and utility of mutation specific PCR to distinguish the pyrimethamine

sensitive and resistant parasite lines selected in vitro.

MATERIALS AND METHODS

Parasite cultures Parasites of the clone F56 and the five pyrimethamine

resistant lines (PS-1 to PS-5) derived from it were each seperately grown in large

97

glass Petridishes (10 cm diameter) using candle jar method (Trager and Jensen

1976). When parasitemia in these cultures reached 5-6%, the cells were pelleted,

washed once with HEPES buffered RPMI-1640 medium, snap frozen in liquid ni­

trogen and stored below 0 °C till DNA was extracted. Before freezing, a cell count

was made in a haemoc3rtometer and total parasite count was estimated in each

sample.

Requirements for extraction of parasite DNA

RNAase A (lOmg/ml): Pancreatic RNAase was dissolved at a concentration of 10

mg/ml in 10 mM Tris.Cl (pH7.5), 15mM NaCl. Solution was heated to 100 "C for 15

min, allowed to cool slowly at room temperature, dispensed in aliquots and stored

at -20 °C.

DNA extraction buffer: It consisted of the following reagents-

lOmM Tris.Cl (pH 8.0)

O.IM EDTA (pH 8.0)

20 /Ltg/ml Pancreatic RNAase A

0.5% SDS

Proteinase K (20mg/ml): Stock solution of proteinase K was prepared at a con­

centration of 20 mg/ml in water and stored at -20 "C.

Phenol: Liquified phenol stored at -20 °C was melted at 68 °C, mixed with

hydroxyquinoline (final concentration 0.1% ) and equilibrated with O.IM Tris.Cl

(pH 8.0). It was stored in a dark bottle under a layer of O.IM Tris.Cl (pH 8.0)

containing 0.2% p-mercaptoethanol at 4 °C.

Ctiloroform: It was used in combination with isoamylalcohol in the ratio of 24:1.

TE buffer (pH 7.5): It had the following composition

lOmM Tris.Cl (pH 7.5)

ImM EDTA (pH 8.0)

The buffer was sterilized by autoclaving and stored at room temperature.

TBE buffer (5X): One litre of 5X TBE was prepared by mixing 54 g Tris base.

27.5 g boric acid and 20 ml of 0.5 M EDTA (pH 8.0) in water.

Extraction of parasite DNA: The frozen samples (containing about 10^° para­

sites ) were thawed, mixed with two volumes of 1% cold acetic acid and centri-

fuged at 6000 rpm for 20 min at 4 °C. Supernatant which contained most of the

haemoglobin was removed and the pellet was resuspended in two volumes of 1%

triton X-100. It was again spun at 6000 rpm for 20 min at 4 °C and supernatant

discarded. The resulting pellet of parasites was washed twice with 0.85% NaCl

(pH 7.4). The washed parasite pellet was again resuspended in DNA extraction

buffer in a volume equal to that of the original frozen sample and incubated at 37

°C for 1 hour with intermittent shaking. Proteinase K at a final concentration of

100 fig/nd was added to the above mixture, mixed gently and incubated overnight

at 37 °C. DNA was extracted with an equal volume of phenol once,

phenol:chloroform (1:1) twice, chloroform:isoamylalcohol (24:1) once and chloro­

form once. To the aqueous phase of the final extraction step was added 0.2 volume

of 10 mM ammonium acetate and 2.5 volume of cold absolute alcohol (ethanol).

This was left overnight at -20 "C for DNA to precipitate. DNA was pelleted by

centrifugation at 12,000 rpm for 30 min at 4 "C and supernatant carefully re­

moved. The pellet was washed with cold 70% ethanol and dissolved in 200 fil of TE

buffer (pH 7.5). Amount of DNA was estimated spectrophotometrically at optical

density 260 nm and its purity determined from ratio of OD^^gJOD^^. The presence

of contaminating RNA and sheared DNA, if any, was checked by running the

samples on a mini agarose gel.

Components of Southern hybridization and oligonucleotide probe labelling

The stock solutions and buffers were prepared in glass redistilled water according

to the protocols of Sambrook et al. (1989)

SSC(20X): Sodium chloride and sodium citrate were dissolved in water to get

final concentration of 3M and 0.3M, respectively. The pH of the solution was ad­

justed to 7.0 with NaOH.

99

STE buffer (pH 7.5): It consisted of the following reagents

100 mM NaCl

10inMTris.Cl(pH7.5)

1 mM EDTA (pH 8.0)

The buffer was sterilized by autoclaving and stored at room temperature.

Sephadex G-50 : Sephadex G-50 slurry was made by mixing 3 g of it with 300 ml

of STE solution and the suspension was autoclaved to hydrate the beads.

Denhardt's solution (lOOX): 2 g each of Ficoll, polyvinylpyrrolidone ( PVP-40,

Sigma ) and BSA was dissolved in 100 ml of distilled water and stored at -20°C.

Sodium phosphate buffer (1 M, pH 7.2 ): It was prepared by mixing 28 ml of

IM NaHjPO^ solution and 72 ml of IM Na^HPO^ solution.

Pre-hybridization buffer: The composition of the buffer was as follows

5 X S S C

5% (w/v) Dextran sulfate

0.05M Sodium phosphate buffer (pH 7,2)

5X Denhardt's solution

0.0025M EDTA

0.4% SDS

It was stored in aliquots at -20°C.

Salmon sperm DNA (5 mg/ml): It was dissolved at a concentration of 5 mg/ml in

water and stirred continuously to get complete dissolution. DNA was sheared by

repeatedly passing it through a syringe with 18 gauge needle and stored in aliquots

at -20°C.

Loading dye (6X): It had the following composition

0.25% Bromophenol blue

0.25% Xylene cyanol FF

40% (w/v) Sucrose in water

Restriction enzymes and their buffers: The following 10 X restriction en-

zyme buffers were prepared for use with the respective restriction enzymes

Be^t^rigtion ?nZYm? Composition of 10 X buffer

Alu I 10 mM Tris.Cl (pH 7.0)

10 mM MgCl^

I m M D T T

Hind III 50 mM NaCl

10 mM Tris.Cl (pH 7.9)

10 mM MgCl^

I m M D T T

Taq I 100 mM NaCl

10 mM Tris.Cl (pH 8.4)

10 mM MgClj

10 mM p-mercaptoethanol

BSA was added at a final

concentration of 100 fig/ml in IX

reaction mixture

Bacteriophage T^ polynucleotide kinase (PNK) buffer: PNK, lOX buffer

was made of the following composition

500 mM Tris.Cl (pH 7.5)

100 mM MgClj

50mMDTT

1 mM EDTA (pH 8.0)

1 mM Spermidine HCl

RFLP using Southern hybridization

Restriction digestion ofDNA: DNA about 4 ng each from the clone F-56 and the

pyrimethamine resistant lines was individually digested with 20 units of either

Hind III, Alu I or Taq I restriction endonuclease in an appropriate buffer in a total

101

volume of 20 \d. Restriction digestion reaction was carried for three hours. Reac­

tion mix containing Taq I was incubated at 65 °C while others at 37 °C. Following

incubation the microfuge tubes containing Hind III or Alu I were transferred to a

65 °C water bath for 10 min and kept in ice for 5 min.

Preparation of Southern blots: The entire volume of each restriction digestion (20

\i\) was mixed with 4 ^1 of 6 X loading dye, loaded on a 0.8% agarose gel made in

0.5 X TBE buffer and electrophoresed in the same buffer overnight at 40 volts till

the tracking bromophenol dye had travelled 20 cm from the well. Gel was stained

in 1 ng/nil ethidium bromide solution for 30 min, visualised under UV light and

photographed with a polaroid camera. DNA was transferred to a nylon membrane

by Southern's capillary method as follows:

Size fractionated DNA was depurinated by incubating the gel in 0.25 N HCl

solution at room temperature with gentle agitation for 15 min. Acid solution was

decanted and replaced with 0.4 N NaOH solution and gel incubated with constant

agitation for 30 min. Gel was then neutralised in 12 mM Tris, 6 mM sodium ac­

etate, 0.3 mM EDTA solution (pH 7.5) for 30 min with gentle shaking of the gel.

Gene screen membrane cut to the size of gel was wetted with distilled water by

capillary action and immersed in transfer buffer (10 X SSC) for 15 min. Apiece of

Whatman 3MM paper was wrapped around a stack of three glass plates and placed

inside a large baking dish. The dish was filled with transfer buffer (10 X SSC)

until the level of liquid reached almost to the top of glass plates. Gel was removed

from the neutralising solution, inverted and placed on the glass support kept in

baking dish. All the edges of the gel were covered with a thin strip of parafilm to

prevent liquid from flowing directly from reservoir to paper towels placed on top of

the gel. Wet nylon membrane was then placed on the gel. Two pieces of Whatman

3MM paper cut to the size of gel were dipped in 2 X SSC and placed on top of the

membrane. Care was taken that no air bubble was trapped between any of the

layers in the entire set-up. A stack of paper towels (5 cm high), just smaller than

1U2

the size of Whatman paper was placed on top of Whatman paper. Placed a glass

plate on top of the stack and weighed it down with a 500 g weight. The transfer of

DNA was allowed to proceed for 20-24 hours with periodic replacement of wet

paper towels with dried ones. Membrane was carefully removed after the transfer

and soaked in 6 X SSC for 5 min before being dried at room temperature. Gel was

restained in ethidium bromide solution (lug/ml) and viewed under UV lamp to

check the efficiency of transfer. Air dried membrane was sandwiched between two

sheets of dry 3MM Whatman paper and baked in vacuum oven at 80 °C for 2 hours.

End labelling of synthetic oligonucleotide employed as a probe

The synthetic 21-mer deoxynucleotide which was obtained as lyophilized powder

had the following sequence:

5'- AGGTCTTAACTTGACTAACAT -3'

It was dissolved in 500 fi\ of sterile distilled water, vortexed and centrifuged to

remove the remaining resin. The aqueous phase containing dissolved oligonucle­

otide was extracted once with phenol:chloroform (1:1) and once with chloroform.

0.1 volume of O.IM MgCl^ and 2 volumes of ethanol were added to aqueous phase

of chloroform extraction and left overnight in -20 °C freezer for oligo- precipita­

tion. Oligomer was recovered by centrifuging at 14,000 rpm for 30 min at 4 **C in

a microfuge. The pellet was washed twice with 70% ethanol and finally dissolved

in 200 ^1 of sterile distilled water and quantitated spectrophotometrically. About

15 pM (0.1/xg) of oligonucleotide was labelled at 5' end with 10 fiCi of (y-'^P) ATP

(specific activity 3000 Ci/mmol) using 20 units of T^ polynucleotide kinase (PNK)

in PNK buffer in a reaction volume of 50 fxl at 37 °C for 1 hour. The reaction was

terminated by adding 2 /il of 0.5 M EDTA.

Separation of labelled oligo probe from unincorporated nucleotides

The oligo probe was separated from unincorporated nucleotides using Sephadex

G-50 spun columns. The spun column was prepared as follows. Bottom of a 1ml

103

disposable S3n"inge was plugged with autoclaved glass wool. Sephadex G-50 slurry,

equilibrated in STE was inserted into a centrifuge tube, containing at the bottom

an epperndorf tube with its lid cut off and this set-up was centrifuged at 3,000

rpm for 5 min. Eluate from centrifuge tube was drained out, more of slurry was

added into syringe and this was repeated 2-3 times till the post-spin bed volume of

0.9 ml was obtained. 100 fxl of STE was then added into syringe and spun at the

same speed (3000 rpm) for the same time. This was repeated once more. The

eppendorf tube in centrifuge was replaced with a fresh one. The column, when not

needed immediately, was stored at 4 °C after wrapping the mouth of syringe with

parafilm. End labelled probe was made to 100 /u,l volume by adding STE solution.

100 /il of labelled probe was loaded on to each of the spun column and centrifuged

at 3000 rpm for 5 min. The eluate was collected in an eppendorf tube and syringe

was safely disposed off in a radioactive waste container, l/nl of this purified probe

was taken in an eppendorf tube and placed in a scintillation vial for Cerenkov

counting in a scintillation counter (Beckman Instruments Inc.). The specific activ­

ity of probe was calculated by following formula.

The specific activity of probe = (CPM for l/itl sample) x (counting efficiency

factor) X (volume of end labelled probe in /il) x 10

When not used immediately, the labelled probe was stored in a lead container in

-20 °C freezer and was used within 4-5 days.

Hybridization on the Southern blot

Prehybridization: Each of the Southern blotted nylon membrane was individu­

ally placed in heat sealable plastic bag. Prehybridization buffer (80 fi\ buffer/ cm^

area of membrane) was added into the bag. Salmon sperm DNA was denatured by

boiling for 10 min and added into the bag (50 fig salmon sperm DNA/ml

prehybridization buffer). It was thoroughly mixed and the bag was sealed after

removing all air bubbles. Membrane was prehybridized by keeping the bag in a

waterbath set at 65 °C for 3-5 hours.

104

Hybridization: Labelled oligomer probe was boiled for 10 min and quickly cooled

on ice for 10 min. One corner of the bag was cut open and probe was added. Bag

was resealed after removing air bubbles and hybridized overnight at 40 "C in a

waterbath with constant and slow shaking.

Post-hybridization washing of membrane: Membrane was removed from the bag

and incubated in a solution of 2X SSC, 0.1% SDS at room temperature for 8 min

with constant shaking and this step was repeated once more. The above solution

was replaced with prewarmed (40 °C) solution of 0.5X SSC, 0.1% SDS and incu­

bated in a shaker water bath at 40 "C for 15 min. This was repeated with fresh

prewarmed solution of 0.5X SSC, 0.1% SDS. Membrane was then washed twice

with 2X SSC at room temperature with constant shaking for 8 min each.

After the final wash, membrane was placed on a sheet of prewet (with dis­

tilled water) Whatman 3 mm paper, covered with cling film (Saran wrap) and

exposed to X-ray film (Kodak XOMAT AR) for desired duration of time, using in­

tensifying screens at -70 °C. X-ray film was developed by immersing it in devel­

oper (20% Kodak GBX) for 1 min, rinsed briefly in water, immersed in fixer (20%

Kodak GBX) for 3min and finally rinsed in running tap water for 5 min. X-ray

film was dried and photographed.

Polymerase chain reaction (Mullis 1986; Saiki et al. 1988)

The technique: This is a technique used for specific in vitro amplification of

nucleic acid segment that is bracketed between two regions of known sequences.

The hallmarks of this method include specificity, sensitivity and speed beside be­

ing straightforward. The specificity of the amplification results from the require­

ment of DNA pol3rmerases for a primer (a short stretch of synthetic nucleotides)

that is extended only when annealed to a complementary target sequence. In

presence of dNTPs, the annealed primers are extended from 5' to 3' end and the

target DNA strand is copied from 3' end by the DNA polymerase during this exten­

sion step. The copying is halted by raising the temperature to 94 °C, causing

105

separation of all double stranded molecules. This denaturation step is followed by

annealing step in a typical cycle of the polymerase chain reaction wherein the

reactants are cooled to 37 - 55 °C, the temperature which favours the annealing of

the primers to template DNA. Raising the temperature again to 72 °C stimulates

the heat resistant Taq polymerase to copy the target DNA by extending the an­

nealed primers. Number of copies of the target DNA increases in an exponential

fashion with each subsequent cycle. Usually 30 cycles are carried out giving an

amplification level of 10*.

Components of the polymerase chain reaction:

lOX reaction buffer

The reaction buffer had the following composition:

100 mM Tris-HCl pH 8.3

500 mM KCl

15 mM MgClj

0.01% (w/v) gelatin (Sigma, Cat. No. G2500, St. Louis, MO)

Deoxynucleotide triphosphates (mix)

Stock solution of each of the following dNTPs was prepared in water (pH 7.0)

dATP 10 mM

dCTP 10 mM

dGTP 10 mM

dTTP 10 mM

Each of the dNTP was included at a final concentration of 200 yM in the reaction

mix.

Template DNA

Dilutions of the template DNA from the stock were made in 10 nM Tris.Cl pH 8.0,

ImM EDTA pH 8.0 solution. About 70 ng of template DNA was included in each

reaction mix.

Primers employed for the polymerase chain reaction

106

i . Control primers

Bacteriophage lambda DNA was used as control DNA template. Oligonucleotides

used as primers in the amplification of a segment of X DNA were

Primer Map position Sequence

Control primer 1 7131-7135 5/-GATGAGTTCGTGTCCGTACACTGG-3/

Control primer 2 7606-7630 5'-GGTTATCGAAATCAGCCACAGCGCC-3/

From map positions, these two primers should amplify 500 nucleotide target seg­

ment of the X DNA.

2. Mutation specific primers

Mutation specific primers employed to discriminate pyrimethamine sensitive and

resistant P. falciparum lines by polymerase chain reaction were:

Primer Type Map position Sequence

SP Detects the Ser 108 codon 323-337 5'-GAATGCTTTCCCAGC-3/

of pyrimethamine sensitive

parasites

DRl Detects the Asn-108 codon 323-337 5'-GAATGCTTTCCCAGT-3/

. of pyrimethamine resistant

parasites

CP Counterprimer used with 1-21 5'-ATGATGGAACAAGTCTGCGAC-3'

SP and DRl

These oligonucleotide primers were synthesized at the Keystone laboratories and

were derived from the DHFR coding sequence of the P. falciparum genome (Bzik et

al. 1987). Additional primers evaluated for amplification with the above

counterprimer (CP) were:

DR2 Detects the Thr-108 codon 323-337 5/-GAATGCTTTCCCAGG-3/

of cycloguanil resistant

parasites

107

DP A distant primer present

both in sensitive and

resistant lines

1154-1169 5/-CACCTACTCCCGTTCG-3/

Taq DNA polymerase

The enzyme was used at a concentration of 2.5 units/lOO/xl reaction mix.

Equipments

1. Thermal cycler, Perkin Elmer Cetus DNA Thermal Cycler Model 480.

2. Electrophoresis apparatus to characterize amplification products en agarose

gels.

3. Transilluminator with polaroid camera

Mutation specific polymerase chain reaction The components of the ampli­

fication reactions were mixed in the following order in a sterile 0.5 ml microfuge

tube ;

Components

Autoclaved redistilled water

lOX Reaction buffer

dATP

dCTP

dGTP

dTTP

Primer 1(CP)

Primer 2 (SP,DR1,

DR2 or DP)

Template DNA

Volume

SOiLtl

10^1

2 All

2/il

2 Ml

2ix\

1/nl

Ifil

Final concentration

IX

200/LtM

200/ iM

200/nM

200)LtM

500 ng

500 ng

Depending on the cone,

of the stock

Made the final volume to 100 /il with water

70 ng

Positive control for PCR Whole bacteriophage lambda DNA was used as a

positive control template DNA. The positive control reaction

following components:

Components

Autoclaved redistilled water

lOX Reaction buffer

dATP

dCTP

dGTP

dTTP

Control primer 1

Control primer 2

Control template

(1:10 dilution)

Total mix

Vo ^me

62)Lil

lOjLll

2/xl

2;iil

2^1

2/il

5/il

5/il

lOjtil

100 ul

Fina

mix consisted of the

.1 concentration

IX

200/LtM

200;tiM

200/LiM

200 ^M

1.0 MM

1.0/nM

Ing

Overlaid the reaction mixture with 50 fi\ of light mineral oil to prevent evapo­

ration of the sample during repeated cycles of heating and cooling. The reaction

mixture was heated for 5 min at 94 °C to denature the DNA completely. While the

reaction was still at 94 "C, 0.5 /xl (5 units/^il; Perkin Elmer Cetus N801-0046 ) of

Taq DNA polymerase was added. The amplification reaction was carried out as

described below. Typical conditions for denaturation, annealing and polymeriza­

tion were standardized and used as follows:

Cycle Denaturation Annealing^ Polymerization

First cycle 5 min at 94 °C 45 sec at 58 °C 2 min at 72 °C

Subsequent cycles 45 sec at 94 "C 45 sec at 58 °C 1 min at 72 °C

Last cycle 45 sec at 94 °C 45 sec at 58 °C 8 min at 72 "C

The duration of the ramp temperature was 30, 30 and 45 seconds between

109

each denaturation, annealing and polymerization step of a cycle, respectively. Am­

plification was carried for a total of 28 cycles.

Analysis of PCR products: Following amplification the amplified product from the

reaction mixture was examined by gel electrophoresis. 10 /il sample of the ampli­

fied DNA was drawn from each of the microfuge tube and mixed with 2 fil of 6X

loading dye. The samples were then loaded on an agarose gel (1.5 %) made in 0.5X

TBE buffer containing ethidium bromide (0.5 jug/ml) and electrophoresed in the

same buffer at 60 volts till the tracking bromophenol dye travelled a distance of

atleast 40 to 45 mm from the well. The gel was visualized in dark under UV illu­

mination and photographed.

RESULTS

Extraction of falciparum DNA

DNA extracted from the parasites was found to be of high molecular weight

and examination of various samples on the agarose gel stained with ethidium

bromide revealed that there was no visible shearing of the DNA samples isolated.

Quality of the DNA samples obtained was further assessed by determining the OD

ratio of each sample at 260 and 280 nm. The OD gp/ODggg was found to be close to

1.8 in each case. This purified DNA was employed for all further work.

Restriction digestion of DNA

Four microgram DNA each from the clone F-56 and the pyrimethamine se­

lected lines were individually digested with either Hind III, Alu I or Taq I restric­

tion enzyme. The digested material was size fractionated on a 0.8% agarose gel.

The gels were stained with ethidium bromide and photographed. Lane 1 of Figure

6.1 shows the uncut F-56 DNA as clear single band without smear or contaminat­

ing RNA. The F-56 DNA digested with Hind III, Alu I and Taq I for three hours

were loaded in lane 2,3 and 5, respectively. The lane 4 shows the DNA digested for

one hour with Thq I and Hind III cut lambda DNA showing discrete bands is seen

1 l U

in lane 6. Presence of smears in lanes 2 to 5 shows that the DNA used was suscep­

tible to the digestion by all the enzymes used. Digestion was more extensive in

three hours of incubation. Alu I generated smaller fragments than the other en­

zymes.

RFLP analysis Autoradiograms showing specific hybridization of blot trans­

ferred DNA molecules onto nylon membrane to the radiolabelled oligomer probe is

seen in the form of prominent dark bands or smears (Figures 6.2 to 6.4 ). Alu I

digested DNA from pyrimethamine selected lines PS-5, PS-4, PS-3, PS-2 and sen­

sitive clone F-56 were loaded in the gel lanes 1, 2, 3, 4 and 5, respectively of the

autoradiogram (Figure 6.2). Comparison of the band profile of the most resistant

line (PS-5) with the sensitive parent clone F-56 shows the presence of additional

bands in resistant line. Arrangement of DNA bands looks almost alike in Figure

6.3 of the Hind III digested DNA of resistant and sensitive cell lines. Consider­

able difference in the hybridization patterns can be seen in Taq I digested DNA

obtained from sensitive and resistant lines probed with the repeat oligomer. Sev­

eral new bands made their appearances in the most resistant cell line which were

conspicuous by their absence in the genome of sensitive F-56 clone and other se­

lected lines.

Mutation specific polymerase chain reaction

Mutation specific PCR is the variation of the basic PCR theme. It is a method

for determining whether previously characterized point mutations are present in

a target sequence. The assay is based on the observation that efficient amplifica­

tion under stringent PCR conditions occurs only when there is a perfect match

between the target DNA and the 3' terminous of the diagnostic primer. A single

nucleotide change can thus be detected by a PCR primer having 3' terminal nucle­

otide complementary to the mutation. As shown below the fully complementary

primer I will be extended by Taq polymerase while primer II mismatched at the 3''

terminus will not be extended:

I l l

ATG CAT ATT GCG TCG TCC > Matched primer I

TAG GTA TAA CGC AGO AGG GCA TTG ACG CTA ATT GGA CTG A (target DNA)

ATG CAT ATT GCG TCG TCC ^X-> Mismatched primer II

TAC GTA TAA CGC AGC AGT GCA TTG ACG CTA ATT GGA CTG A (target DNA)

Two diagnostic primers and one common primer are needed for the detec­

tion of each point mutation; one diagnostic primer complementary at the 3' termi­

nal nucleotide to the wild-t3T)e sequence, the other complementary to the mutated

sequence.

Design of mutation-specific primers

The mutation-specific primer assayed to detect the presence of Ser 108 (codon

AGC), located in the DHFR-TS gene of the pyrimethamine sensitive parasites,

was a 15-mer oligonucleotide and ended with cytosine base at the 3 annealing

position 323, which is the central nucleotide of the 108 serine codon AGC. The SP

primer 5/-GAATGCTTTCCCAGC-3/ is fully complementary to the wild type py­

rimethamine sensitive DHFR gene segment. The primer used to locate aspar-

agine (Asn) codon AAC of resistant parasites was similar to the SP primer except

' that it had th3rmine base terminus at 3' end (DR-1 primer). Another drug resis­

tant diagnostic primer DR-2 had guanine base at 3 terminus and amplifies the

target DNA if threonine codon (ACC) was present, found in the cycloguanil resis­

tant parasites at 323 position of the DHFR gene. All these mutation specific

primers when used in combination with a 21-mer oligonucleotide counter primer

(CP) annealing with the starting portion of DHFR coding sequence results in am­

plification of 337 base pair fragment by PCR. A distant 16-mer primer (DP) span­

ning between 1154-1169 nucleotides of the DHFR coding region present both in

112

sensitive and pyrimethamine resistant parasites had also been used in combina­

tion with the CP for amplification.

Detection limit of a 15-mer primer

Taking variable amounts of target DNA from F-56, ranging between 0.001

ng to 100 ng with a 10 fold difference, an experiment was performed to estimate

the minimum amount of the DNA required for amplification with a pair of prim­

ers, the SP a 15-mer and the CP a 21-mer , so as to have a visible fluorescence on

an agarose gel on loading 10 |il aliquot of the total 50 ,1 of the ampUfied product

obtained after 30 cycles of PCR. A typical time and temperature profile of the

cycle was 45 sec at 94 °C, 45 sec at 58 °C and 1 min at 72 °C. As seen in the Figure

6.5 even 1 pg of the target DNA was sufficient to give a clear fluorescent band on

loading only 20 % of the amplified product.

Amplification of X control DNA template

Amplification conditions employed efficiently amplified a specific 500 base

pair target segment bracketed between a pair of control primers 1 and 2 from the

48.5 kb X genome as seen in lane 3 of Figure 6.8, for instance.

Detection of pyrimethamine resistance with mutation specific primers

A series of experiments were performed to determine the most stringent an­

nealing temperature that can be used at which the mutation specific primers were

able to prime the enzymatic amplification and at the same time discriminate the point

mutation at position 323 of the DHFR coding region of the pjrrimethamine resistant

and sensitive parasites. The annealing temperature was increased by 1 °C in each

experiment, beginning from initial annealing temperature of 45 °C. Effective ampli­

fication and discrimination was obtained at an annealing temperature of 58 "C.

Using the primer pair CP and SP, which form perfect match for wild type Ser

codon (AGC) at the position 323 of the DHFR coding region, efficient amplification

was found in the microfuge tubes containing target DNA F-56, PS-1 and PS-2

amplification product shown in lanes 4, 5 and 6, respectively of Figure 6.6. No

113

amplification whatsoever was seen in lanes 6, 7 and 8 which contained the target

DNA derived from PS-3, PS-4 and PS-5 pyrimethamine selected lines. This pair of

primers can clearly, therefore, discriminate between sensitive F-56, PS-1 and PS-

2 lines from the resistant PS-3, PS-4 and PS-5 lines without any ambiguity. Simi­

larly by employing CP and DR-1 pair of primer in each tube containing target

DNA from either F-56, PS-l, PS-2, PS-3, PS-4 or PS-5 lines of P. falciparum, enor­

mous amplification of target DNA obtained from PS-3, PS-4 and PS-5 py­

rimethamine resistant lines as can be observed in lanes 6,7,8 of Figure 6.7, re­

spectively. This pair of primer can not amplify the DNA from sensitive lines (F-56,

PS-1, PS-2) but is very efficient in amplifying DNA from pyrimethamine resistant

lines (PS-3, PS-4, PS-5). The expected specific amplification of the target DNA

was monitored by the molecular weight of the amplified product by running paral­

lel controls. The two pairs of primers (one common and the two diagnostic) used

had been found to be very effective in discriminating the target DNA obtained

from pyrimethamine sensitive and in vitro selected resistant cell lines. In an­

other set of experiment Figure 6.8 using different sets of primers (even multi­

plex), target DNA etc. the utility of CP and SP pair was reconfirmed, in amplify­

ing only the p3a'imethamine sensitive target DNA only whereas all the other primer

and target DNA combinations failed to show the amplified product. The primer

pair CP and DR-2 failed to amplify the target DNA obtained from F-56 or any of

the selected parasite lines.

DISCUSSION

Genetic characterization of microorganisms is being performed increasingly

at the DNA level. The molecular biology approach generally used for an isolate or

clone individualization which may be phenotypically alike is the typing of vari­

able number of tandem repeat loci by restriction fragment length polymorphism.

How far this and other methods are valid and practical to detect drug resistance

114

resulting from point mutations in P. falciparum ? The methods currently in use to

detect and characterize single base change in a gene are: a) Mismatch cleavage

by RNAase, This method is based on the ability of pancreatic ribonuclease to

recognize and cleave single base mismatches in RNA:RNA (Winter et al. 1985)

and RNA:DNA heteroduplexes (Myers et al. 1985). The method is performed by

hybridization of the target sequence to a labelled complementary riboprobe, diges­

tion with RNase A and analysis of the resistant products by polyacrylamide elec­

trophoresis in denaturing gels. Mutations are detected and localized by the pres­

ence and size of the RNA fragments generated by cleavage at the mismatches.

Single nucleotide mismatches in DNA heteroduplexes are also recognized by this

approach, b) Similarly mismatch chemical cleavage (MCC) provides another strat­

egy to detect single base mismatch in DNA heteroduplexes by generic denomina­

tion (Cotton et al. 1988; Montandon et al. 1989; Gogos et al. 1990). c) The single

strand conformation polymorphism (SSCP) is another method based on the differ­

ences in the secondary structure of ssDNA molecule differing in single nucleotide,

which are frequently reflected in an alteration of their electrophoretic mobility

(Hayashi 1990). MCC or SSCP methods can detect mutations but can not charac­

terize them. Although the characterization of mutations can be achieved with

RNase A mismatch cleavage method by using batteries of mutant riboprobes (Win­

ter et al. 1985; Forrester et al 1987), these methods are complicated and cumber­

some. RFLP has its own limitations, which include requirements of sufficient

quantity of high molecular weight DNA (50 ng) and isotopically labelled probes to

obtain high level of sensitivity of detection. RFLP is also laborious as well as time

consuming. PCR based methods prove to be useful and practical when nature

and/or position of the mutation is known. Mutation specific PCR is the method for

determining whether previously characterized mutations are present in a target

sequence. The assay is based on the observation that efficient amplification un­

der stringent PCR conditions occurs only when there is a perfect match between

115

the target DNA and the 3' terminus of the diagnostic primer. A single nucleotide

change can thus be detected by a PCR primer having 3' terminal nucleotide comple­

mentary to the mutation. Two diagnostic PCR primers and one common primer

are required for each point mutation to be tested; one diagnostic primer comple­

mentary at the 3' terminal nucleotide to the wild-type sequence, the other comple­

mentary to the mutated sequence.

In this study the procedure adopted to extract DNA (Tungpradubkul and

Patiyim. 1985) from, paraaitea yielded pure DNA with high molecular weighty since

it was easily susceptible to restriction digestions with the various enzymes and no

smear was observed in lanes loaded with uncut DNA on an agarose gel. Alu I

restriction enzyme produced several smaller fragments which were seen as smear

at the farther end of the gel, suggesting the presence of many Alu I sites (AG|CT)

in the P. falciparum genome. Like most other eukaryotic genomes, no discrete

fragments are visible in Hind III, Alu I or Taq I digested total DNA on agarose gel,

indicating that these enzymes have innumerable restriction sites in the falciparum

DNA. It is very difficult to differentiate the smear-fragment profile of py­

rimethamine sensitive and various resistant P. falciparum lines, more so if the

point mutations are responsible for resistant phenotype.

RFLP and Southern blot hybridization have been successfully applied to

detect point mutations in ras genes using total genomic DNA (Feinberg et al. 1983;

Santos et al. 1984; Kraus et al. 1984). The genomic organization of P. falciparum

has been studied by the Southern blot hybridization with repetitive DNA probes

(Bhasin et al. 1985; Oquendo et al. 1986; Fucharoen et al. 1988). These probes

have been very useful in genotyping of isolates and clones. P. falciparum genome

contains about 10% of repetitive sequences (Hough-Evans 1982) of which more

than 1% is constituted by a 21 base pair repeat (Aslund et al 1985). The comple­

mentary 21-mer oligonucleotide sequence has been employed as a probe to look for

alterations in the genomic organization of pyrimethamine resistant cell lines se-

116

lected in vitro from sensitive F-56 parent clone. RFLP on the blots will be visible

only if the point mutations create or destroy a restriction site. Comparison of

band profile of Hind III digested total DNA from sensitive and various py­

rimethamine resistant selected falciparum lines do not show any marked differ­

ence, prompting us to infer that most of the Hind III sites (AiAGCTT) in the falci­

parum genome remain unaffected. Also Hind III digested DNA probed with 21-

mer probe can not be used to detect genomic rearrangements occurring due point

mutations caused by pyrimethamine pressure. However, clear differences are ob­

served in the hybridization patterns of DNA, from sensitive and most resistant

lines, digested with Alu I or Taq I suggesting that the 21-mer probe can be used to

compare the genomic rearrangement of pyrimethamine sensitive and the resis­

tant cell lines. This also indicates that Alu I and Taq I sites in the falciparum

genome are definitely affected by the pyrimethamine pressure on the parasites.

From these observations it can be inferred that pyrimethamine does not specifi­

cally act and affect the DHFR gene only. This method obviously can not be used

for detection of point mutations in the DHFR gene using total genome, but shows

alterations taking place at the Alu 1 and Taq I sites in the genome of pyrimethamine

resistant falciparum lines. These alterations in the band profile are prominent

only in the most resistant cell lines. This technique can more fruitfully be em­

ployed by first amplifying the DHFR coding sequence from the total genome and

subsequently monitoring the RFLP in selected/mutated lines.

Previous studies of the effect of primer-template mismatches on mutation-

specific PCR have yielded conflicting data (Wu et al. 1989; Newton et al. 1989;

Ehlen and Dubeau 1989; Kwok et al. 1990; Okayama et al. 1989; Peterson 1993).

Some studies revealed that certain mismatches at 3 terminus could be detected,

but others reported that all the 3' mismatches produced significant decrease in the

amplified product. A thorough comparison of these studies is complicated by the

use of different template and primers, as well as the different reaction conditions

117

specially the annealing temperatures employed. Therefore, it is necessary to opti­

mize the annealing temperature with a set of primers in order to obtain reproduc­

ible results. Using the guidelines (Mullis et al. 1994) for primer selection and

consulting the falciparum DHFR gene sequence obtained from the databank

(UNDP/World Bank/WHO/TDR), the selected primers were optimized for the most

stringent annealing temperature which could be employed for effective amplifica­

tion and detection of resistance. These initial precautions in selecting the primers

led us to discriminate the sensitive and resistant P. falciparum cell lines using the

counter primer and the two diagnostic primers employed without compromising

the sensitivity of the technique. The primers used are specific for detecting the

P3rrimethamine resistance, resulting due to base exchange at 323 base of the DHFR

coding sequence. Another diagnostic primer (DR-2) which detects cycloguanil re­

sistance failed to amplify the pyrimethamine resistant target DNA, amply demon­

strating the usefulness of these primer pairs. Utility of these primers to discrimi­

nate pyrimethamine sensitive and resistant isolates from field has yet to be deter­

mined so also the RFLP studies on the PCR amplified DHFR sequence.

Figure 6.1 Ethidium bromide stained 0.8 % agarose gel containing 4 [xg of DNA from clone F-56

digested with restriction enzymes and electrophoresed overnight at 30 volts

Lane 1. Undigested DNA

2. DNA digested with//iW///

3. DNA digested with A/«/

4. DNA digested with Taq I for 1 hour

5. DNA digested with Taq I for 3 hours

6. X DNA digested with//iW///

2 3

/^

Figure 6.2 An autoradiogram of Southern blot hybridized with synthetic end labelled oligonucle­

otide. 4 ng of P. falciparum DNA from the clone F-56 and pyrimethamine selected lines digested

with A/u /, size fractionated electrophoretically and Southern transferred on to a nylon membrane.

Lanel. PS-5 DNA

2. PS-4DNA

3. PS-3DNA

4. PS-2DNA

5. F-56 DNA

%

-WK0

t i

^ € |

Hi

IE

Figure 63 An autoradiogram of Southern blot hybridized with synthetic end labelled oligonucle­

otide. 4 ng of/! falciparum DNA from the clone F-56 and pyrimethamine selected lines digested

with Hind III, size fractionated electroohoreticallv and Southern transferred on to a nylon mem­

brane.

Lanel. PS-5 DNA

2. PS-4DNA

3. PS-3 DNA

4. PS-2DNA

5. F-56 DNA

Figure 6.4 An autoradiogram of Southern blot hybridized with synthetic end labelled oligonucle­

otide. 4 ^g of P. falciparum DNA from the clone F-56 and pyrimethamine selected lines digested

with Tag I, size fractionated electrophoretically and Southern transferred on to a nylon membrane.

Lanel. F-56 DNA

2. PS-1 DNA

3. PS-2DNA

4. PS-3DNA

5. PS-4DNA

6. PS-5 DNA

6

II

•%f;

••¥»•

S^-

•'m

i td

Figure 6.5 Sensitivity of primer pairs used for in vitro amplification of target DN A using PCR. The

starting P. falcipaum target DNA (for amplification of a DHFR segment) ranged from 0.001 to 100

ng-

Lanel.F-56DNA100ng

Lane 2. F-56 DNA 50 ng

Lane 3. F-56 DNA 10 ng

Lane 4. F-56 DNA 1.0 ng

Lane 5. F-56 DNA 0.1 ng

Lane 6. F-56 DNA 0.01 ng

Une 6. F-56 DNA 0.001 ng

Figure 6.6 Amplification of target DNA obtained from pyrimethamine sensitive clone and py­

rimethamine selected P. falciparum lines using sensitive primer (SP) and counter primer (CP).

Lane 1. X DNA - control

Lane 2. blank

Lane 3. Amplification of F-56 DNA using counter primer (CP) and

distant primer (DP)- control

Lane 4. F-56 DNA

Lane 5. PS-1 DNA

Une 6. PS-2 DNA

Une 7. PS-3 DNA

Une 8. PS-4 DNA

Une 9. PS-5 DNA

/4

1 2 3 4 5 6 7 8 9

ID

Figure 6.7 Amplification of target DNA obtained fi-om pyrimethamine resistant P. falciparum

selected lines using mutation-specific pyrimethamine-resistant primer (DR-1) and counter primer

(CP).

Lane 1. > DNA - control

Lane 2. blank

Lane 3. Amplification of F-56 DNA using counter primer (CP) and

distant primer (DP)- control

Une4. F-56 DNA

Lane 5. PS-1 DNA

Une6 . PS-2 DNA

Lane 7. PS-3 DNA

Une8 . PS-4 DNA

Lane 9. PS-5 DNA

Figure 6.8 Diagnostic ability of sensitive primer (SP) and counter primer (CP) to amplify DNA

only from pryrimethanie sensitive P. falciparum.

Lane \. blank

Lane 2. control-1 (F-56 DNA without Taq polymerase)

Lane 3. X DNA - control, with X specific primer pair

Une 4. F-56 DNA with SP and CP

Une 5. F-56 DNA with DR-1 and CP

Lane 6. F-56 DNA with DR-2 and CP

Une 7. F-56 DNA with SP, DR-1 and CP

Lane 8. F-56 DNA without primers, control

Lane 9. No target DNA for amplification

Lane 10. PS-5 DNA with SP and CP

Lane 11. F-56 DNA with SP only

Lane 12. F-56 DNA with CP only

Lane 13. X DNA with SP and CP

Lane 14. Human DNA with SP and CP

I 2 3 4 5 6 7 8 9

71

I 2 3 4 5 6 7 8 9 10 II 12 13 14

22

REFERENCES

Adams A.R.D. and Seaton D.R. (1949) Resistance to paludrine developed by a strain

of Plasmodium falciparum. Trans. R. Soc. Trop. Med. Hyg., 42, 314-315.

Aikawa M. (1972) High - resolution autoradiography of malarial parasites treated

with ' H - chloroquine. Am. J. Path., 67, 277-280

Anand N. (1979) Sulfonamides and sulfones. ppl-40. In Wolff E. (ed) Burger's me­

dicinal chemistry, 4th ed. part 2, VNTiley, New York.

Armstrong V.L. and Smith C.C. (1974) Cyclization and N-dealkylation of

chloroguanide by rabbit and rat hepatic microsomes. Toxicol, appl. Pharmacol., 29,

90.

Aslund L., Franzen L., Westin G., Perrson T, Wi^zeW H and Petterson U. (1985) Highly

reiterated non coding sequence in the genome of Plasmodium falciparum is composed

of 21 base-pair tandem repeats. J. Mol. Bio., 185, 509-516.

Bahadur A., Sarna S. and Sodhi A. (1984) Enhanced cell mediated immunity in mice

after cis-platin treatment. Polish J. Pharmac. Pharmacy, 36, 441-448.

Banyal H.S. and Inselburg J. (1986) Plasmodium falciparum : induction, selection and

characterization of pyrimethamine -resistant mutants. Expl. Parasitol., 62, 61-70.

Bartelloni P.J., Sheeshy T.W. and Tigerit W.D. (1967) Combined therapy for chloro-

resistant Plasmodium falciparum infection. Concurrent use of long-acting

sulphormethoxine and pyrimethamine. J. Am. Med. Assoc, 199,173-177.

Bastien P. (1987) Quinine resistant falciparum malaria in Vanuatic ? Case report.

Southeast Asian J. Trop. Med. Public Health, 18 ,101-102.

Berenbaum M.C. (1978) A method for testing for synergy with any number of agents. J. Infect. Dis., 137, 122-130.

Bhasiri V.K. and Trager W. (1984) Gametocyte forming and non- gametocyte forming clones of Plasmodium falciparum. Am. J. Trop. Med. Hyg., 33, 534-537.

Bhasin V. K. and Trager W. (1987) Gametocytocidal effect in vitro of cinchona alka-

1 19

loids and derivatives on a Plasmodium falciparum clone. Acta Leidensia, 55, 151-158.

Bhasin V.K., Clayton C, Trager W. and Cross G.A.M. (1985) Variations in the organi­zation of repetitive DNA sequences in the genomes of Plasmodium falciparum clones. Mol. Biochem. Parasitol., 15, 149-158.

Bishop A. (1954) The effect of sulphadiazine, proguanil and 2:4 - diamine - 6:7- di

isopropylpteridine upon gametocyte productionin Plasmodium gallinaceum. (

Brumpt,1935). Parasitology 44: 120-131.

Bishop A.(1962) An analysis of the development of resistance to proguanil and py­

rimethamine in

Plasmodium gallinaceum. Parasitology, 52, 495-518.

Bradley G. Juranka P.P. and Ling V. (1998) Mechanism of multidrug resistance.

Biochim. Biophys. Acta, 948, 87-128.

Brandicourt O. and Gentilini M, (1987) Risques d' infection a Plasmodium falciparum

chimio-resistant selon la densite et I' infectivite anopheliennes. Application V Afrique

de r Quest et du centre. Ann. Soc. Bel. Med. Trop., 67, 229-237.

Brockelman C.R. and Tan Ariya P. (1982) Efficacy of Fansidar against Plasmodium

falciparum in continuous culture. Am. J. Trop. Med. Hyg., 31, 913-918.

Brockelman C. Tan-ariya Rand Menabandhu C. (1985) Techniques in the study of

parasites. Cultivation of Plasmodium falciparum, pp 365-378. In : Panyim S., Wilairat

Rand Yuthavong Y (eds). Application of genetic engineering to research on tropical

disease pathogens with special reference to Plasmodia- A laboratory manual of se­

lected techniques. TDR-WHO.

Brosi A. Uskokovic M., Gutzwiller J. Krettli A. U. and Brener Z. (1971) Antimalarial activity of natural,racemic and unnatural dihy<iroquinine, dihydroquinidine, and their various racemic analogs in mice infected with Plasmodium berghei. Experientia, 27, 1100-1101.

Bruce-Chwatt L. J. (1981) Chemotherapy of malaria, 2nd edn, pp. 44-49. W.H.O.,

Geneva.

Bruce-Chwatt L.J. (1985) Essential malariology 2nd edn., pp 210-260, William

Heinemann Medical Books, London.

120

Bruce-Chawtt L. J. (1987) From Laveran's discovery to DNA probes: New trends in diagnosis of malaria. Lancet, 26,1509-1511.

Bruce-Chwatt L. J. and Zuluera J. de (1980) The rise and fall of malaria, 2nd ed., Oxford, Oxford University Press.

Bruce-Chwatt L.J., Black R. H., Canfield C.J., Clyde D. F. and Peters W. (1981) Che­motherapy of malaria, 2nd ed, Geneva,WHO, 21-55.

Bruce-Chwatt L.J., Black R.H., Canfield C.J., Clyde D.E, Peters W. and Wernsdorfer W.H. (1981) Chemotherapy of malaria. World Health Organization, Geneva. 260p

BunnagD., Harinasuta T., Vanijanonta S., Looreesuwan S., Chittamas S., Punnavut W.

and Jochims E. (1987) Slow release quinidine in the treatment of chloroquine resis­

tant falciparum malaria : a double blind trial. Acta Leindensia, 55, 129-138.

Burgers R.W. and Young M.D. (1959) The development of pyrimethamine resistance by Plasmodium falciparum. Bull. WHO, 20,37-46.

Bzik D.J., Li W.B., Horii T. and Inselburg J. (1987) Molecular cloning and sequence

analysis of the Plasmodium falciparum dihydrofolate reductase-thymidylate synthase

gene. Proc. Natn. Acad. Sci. U.S.A., 84, 8360-8364.

Canedella R. J. and Jarrell J.J. (1970) Suggested new mechanisms of antimalarial

action for DDS involving inhibition of glucose utilization by the intraerythrocytic

parasite. Am. J. Trop. Med. Hyg., 19, 592-598.

Carrington H.C., Crowther A.F., Davey D.G., Levi A.A. and Rose F.L. (1951) A me­

tabolite of paludrine with high antimalarial activity. Nature, 168, 1080.

Carter G., Ridge S. and Padula R.A. (1992) Genetic lesions in preleukemia. Crit. Rev. Oncogen., 3, 339-364.

Chaudhuri R.N. and Chaudhuri M.N. (1949) Falciparum infection refractory to Paludrine. Indian. J. Malariol., 3, 365-369.

Chulay J.D., Hayens J.D. and Diggs C.L. (1981) Inhibition of in vitro growth of Plas­

modium falciparum by immune serum from monkeys. J. Infect. Dis., 144, 270-278.

121

Clyde D.R (1967) Malaria in Tanzania, London, quoted in Rosario V.E., Hall R.,

Walliker D. and Beale G.H. (1978) Persistence of drug resistant malaria parasites.

The Lancet, Jan. 28, 185-187.

Cook G.C. (1986) Serious problems with antimalarial drugs. J. Infect., 13, 1-4.

Coatney G.R. (1963) Pitfalls in a discovery : the chronicle of chloroquine. Am. J.

Trop. Med. Hyg., 12, 121-128.

Coatney G.R., Myatt A.V., Hernandez T., Jeffrey G.M. and Cooper W.C. (1952) Stud­

ies on the compound 50-63. Trans. R. Soc. Trop. Med. Hyg./'46, 496-508.

Coderre J.A. Beverley S.M. Schimke R.T. and Santi D.V. (1983) Overproduction of a

bifunctional thymidylate synthetase dihydrofolate reductase and DNA amplification

in methotrexate - resistant Leishmania. Proc. Natl, Acad. Sci. USA, 80, 2132-2136.

Cohen S. N. and Yielding K.L. (1965) Spectrophotometric studies of the interaction

of chloroquine with deoxyribonucleic acid. J. Biol. Chfem.) 240, 3123-3131.

Cohen G.L. Baurer W.R. Barton J.K. and Lippard S.J. (1979) Binding of cis and trans

dichlorodiammine platinum (II) to DNA : evidence of unwinding and shortening of

double helix. Science, Vol 203,1014-1016.

Cook G.C. (1986) Serious problems with antimalarial drugs; J. Infect., 13, 1-4.

Cotton R.G. Rodrigues N.R. and Campbell R.D. (1988) Reactivity of cytosine and thymine in single base pair mismatches with hydroxylamine as osmium tetroxide and its applications to study of mutations. Proc. Natl. A<rad. Sci. USA, 85, 4397-4401.

Covell G. Shute P.G. and Maryon M. (1953) Pyrimethamine (Daraprim) as a prophy­lactic against a West African strain of Plasmodium falciparum. Br. Med. J., 1,1081-1083.

Cowman A.F. and Lew A.M. (1989) Antifolate drug selection results in duplication

and rearrangement of chromosome 7 in Plasmodium chabaudi. Mol. Cell. Biol., 9, 5182-

5188. •' •

Cowman A.F. Morry M.J. Biggs B.A. Cross G.A.M. and Foote S.]. (1988) Amino acid

changes linked to pyrimethamine resistance in the dihydrofolate reductase-thymidy-

late synthase gene of Plasmodium falciparum. Proc. Natl. Acad. Sci. USA, 85,9109-9113.

Curd F.H.S. Davey D.G. and Rose F.L. (1945) Studies on antimalarial drugs. X. Some

biguanide derivatives as new types of antimalarial substances with both therapeutic

and causal prophylactic activity. Ann. Trop. Med. Parasitol., 39, 208-216.

Davidson G. (1982) Developments in malaria vector control. British Med. Bull., 38,

201-206.

De Duve C. De Barsy T. Poole B. Trouet A. Tulkens P. and Van Hoof F. (1974)

Lysomotrophic agents. Biochem. Pharmac, 23, 2495-2531.

Desjardins R.E. (1984) In vitro techniques for antimalarial development and evalua­tion, p 179-205. In: Peters W. and Richards W.H.G. (eds) Antimalarial drugs I. Springer-Verlag, Berlin Heidelberg.

Dieckman A. and Jung A. (1986) The mechanism of pyrimethamine resistance in Plasmodium falciparum. Parasitology 93, 275-278.

Diggens S.M. Gutteridge W.E. and Trigg P.I. (1970) Altered dihydrofolate reductase associated with a pyrimethamine-resistant Plasmodium berghei berghei produced in a single step. Nature,228, 579-580.

Downs W.G. (1947) Infection of chicks with single parasites of Plasmodium gallinaceum.

Am. J. Trop. Med. Hyg., 46, 41-44.

Draper C.C. Hills M. Kllimali V.A.E.B. and Brubaker G. (1988) Serial studies on the

evolution of drug resistance in malaria in an area of East Africa : findings from 1979

upto 1986. J. Trop. Med. Hyg., 91, 265-273.

Eastham G.M. and Rieckmann K.H. (1981) Field incubator for measuring drug sus­ceptibility of Plasmodium falciparum. J. Trop. Med. Hyg., 84, 27-28.

Ebisawa I. Fukuyama T. and Kawamura Y. (1976) Additional foci of chloroquine-resistant falciparum malaria in East Kalimantan and West Irian, Indonesia. Trog. Geogr. Med., 28, 349-354.

Ehlen P. and Dubeau L. (1989) Detection of ras point mutations by polymerase chain reaction using mutation-specific, inosine -containing oligonucleotide primers. Biochem. Biophys. Res. Commun., 160, 441-447.

Einhorn L.H. and Williams S.D. (1979) The role of cis-platinum in solid tumor therapy. N. Engl. J. Med., 300, 289-291.

123

Endicott J.A. and Ling V. (1989) The biochemistry of a glycoprotein mediated

multidrug resistance. Annu. Rev. Biochem., 58, 137-171.

Eriksson B. Lebbad M. and Bjorkman A. (1989) In vitro activity of proguanil,

chlorproguanil and their main metabolites against Plasmodium falciparum. Trans. Roy.

Soc. Trop. Med. Hyg., 83, 488.

Falco E.A. Goodwin L.G., Hitchings G.H. Rollo I.M. and Russell RB. (1951) 2,4-diaminopyrimidines-a new series of antimalarials. Br. J. Pharmacol., 6, 185-200.

Feinberg A.R Vogelstein B. Droller M.J. Baylin S. B. and Nelkin B.D. (1983) Mutation

affecting the IZ"' amino acid of the C-H-ras oncogene product occurs infrequently in

human cancer. Science, 220, 1175-1177.

Ferone R.(1970) Dihydrofolate reductase from pyrimethamine-resistant Plasmodium

berghei. J. Biol. Chem., 245, 850-854.

Ferone R. Burchall J.J. and Hitchings G.H. (1969) Plasmodium berghei dihydrofolate

reductase. Isolation, properties and inhibition by antifolates. Mol. Pharmacol., 5, 49-

59.

Field J.W. and Ederson J.F.B. (1949) Paludrine- resistant falciparum malaria. Trans.

R. Soc. Trop. Med. Hyg., 43, 233-236.

Findlay G.M. Maegraith B.G. Markson G.L. and Holden J.R. (1946) Investigations in the chemotherapy of malaria in West Africa . Sulphonamide compounds. Ann. Trop. Med. Parasitol., 40, 358-367.

Fitch CD. (1983) Mode of action of antimalarial drugs. In Malaria and the red cell,

Ciba foundation symposium 94, pp. 222-232. Pitman Press, London.

Fitch CD. (1986) Antimalarial schizontocides: ferriprotoporphyrin IX intercalation

hypothesis. Parasit. Today, 2, 330-331.

Fitch CD., Chevli R., Banyal H.S., Phillips G., Pfaller M.A. and Krogstad D.J. (1982) Lysis of Plasmodium falciparum by ferriprotoporphyrin IX and a chloroquine-ferriprotoporphyrin IX complex. Antimicrob. Agents Chemother., 21, 819-822.

Foote S.J., Galatis D.and Cowman A.F. (1990) Amino acids in the dihydrofolate re-

134

ductase -thymidilate synthase gene of plasmodium falciparum involved in cyclogua-

nil resistance differ from those involved in pyrimethamine resistance. Proc. Natl.

Acad. Sci. USA, 87, 3014-3017.

Foote S.J., Thompson J.K., Cowman A.F. and Kemp D.J. (1989) Amplification of the

multidrug resistance gene in some chlroquine resistant isolates of Plasmodium falci­

parum. Cell, 57, 921-930.

Foote S.J., Kyle D. E., Martin R.K., Oduola A.M.J., Forsyth K., Kemp D.J. and

Cowman A.F. (1990) Several alleles of the multidrug-resistance gene are closely

linked to chloroquine resistance in Plasmodium falciparum. Nature, 345, 255-258.

Forrester K., Almoguera C, Jordano J., Grizzle W.E. and Perucho M. (1987) High

incidence of c-K-ras oncogenes in human colon cancer detected by the RNAse A mis­

match cleavage method. J. Tumor. Marker Oncol., 2,113-123.

Fucharoen S. Tirawanchai N. Wilairat P. Panyim S. and Thaithong S. (1988) Differen­

tiation of Plasmodium falciparum clones by means of a repetitive DNA probe. Trans. R.

Soc. Trop. Med. Hyg., 82, 209-211.

Gajanana A. Sinha S. and Raichowdhuri A.N. (1984) A field test to assay py­

rimethamine sensitivity of Plasmodium falciparum in vitro. Ind. J. Med. Res., 80, 112-

116.

Garret C.E. Coderre J.A. MeekT.D. Garvey E.P. ClamanD.M., Beverley S.M. and Santi D.V. (1984) A bifunctional thymidylate synthase-dihydrofolate reductase in proto­zoa. Mol. Biochem. Parasitol., 11, 257-265.

Gbary A.R. Guiguemede T.R. and Ouedraogo J.B. (1988) Emergence du paludisme

chloroquino resistant au Afrique de Y ouest: cas de sokode (Togo). Trop. Med. Parasitol.,

39, 142-144.

Geary T.G. Jensen J.B. and Ginsburg H. (1986) Uptake of 3(H) chloroquine by drug sensitive and resistant strains of the human malaria perasite Plasmodium falciparum. Biochem. Pharmac, 33, 3805-3812.

Giemsa G. and Werner H. (1914) Erfahrungen mit weiteren dem chinin mahestehenden Alkaloiden and einiger ihrer Derivate bei Malaria. Archiv Fiir Schiffs und Tropenhygiene 18: Beiheft 5.

125

Ginsburg H. and Krugliak M. (1992) Quinoline-containing antimalarials - mode of

action, drug resistance and its reversal. Biochem. Pharmacol., 43, 63-70.

Ginsburg H. Nissani E. and Krugliak M. (1989) Alkalinization of the food vacuole of malaria parasites by quinoline drugs and alkylamines is not corelated with their anti­malarial activity. Biochem. Pharmacol., 38, 2645-2654.

Gogos J.A. Karayiorgou M. Aburatani H. Kafatos F.C. (1990) Detection of single base mismatches of thymine and cytosine residues by potassium permanganate and hy-droxylamine in the presence of tetralkylammonium salts. Nucl. Acids. Res., 18, 6807-6814.

Goodwin L.G. (1952) Daraprim (BW50-63) - a new antimalarial. Br. Med. J., 1, 732.

Guerra F. (1977) The introduction of Cinchona in the treatment of malaria. J. Trop.

Med. Hyg., 80,112-118 and 135-139.

Gutteridge W.E. and Trigg P.I. (1971) Action of pyrimethamine and related drugs against Plasmodium knowlesi in vitro. Parasitology, 62, 431-444.

Haber D.A., Beverley S.M.,. Kiely M.L. and Schimke R.T. (1981) Properties of an

altered dihydrofolate reductase encoded by amplified genes in cultured mouse fibro­

blasts. J.Biol. Chem., 256, 9501-9510.

Harder H.C. and Rosenberg B. (1970) Inhibitory effect of antitumor platinum com­

pounds on DNA, RNA and protein synthesis in mammalian cells in vitro. Int. J. Can­

cer, 6, 207-216.

Harinasuta T. Viravan C. and Reid H.A. (1967) Sulphormethoxine in chloroquine resistant falciparum malaria in Thailand Lancet,l, 1117-1119.

Hawking R, Wilson M.E. and Gammage K. (1971) Evidence of cyclic development

and short lived maturity in the gametocytes of Plasmodium falciparum. Trans. R.

Soc. Trop. Med. Hyg., 65, 459-559.

Hayashi K. (1991) PCR- SSCP: A simple and sensitive method for detection of muta­

tions in the genomic DNA. PCR Methods Applic.,1, 34-38.

Hayes D.M. Cvitkovic E. Golberg R.B. and others (1977) High dose cisplatinum

diamminedichloride. Cancer, 39, 1372

126

Hill J. (1963) Chemotherapy of malaria. Part 2 Antimalaril drugs.p 514-524. In: Schnitzer A.J. and Hawking F. (eds) Experimental chemotherapy. Vol 1, Academic, New York.

Hofheinz W. and Merkli B. (1984) Quinine and quinine analogues.p. 61-81. In: Peters W. and Richards W.H.G. (eds) Antimalarial drugs II. Springer-Verlag, Berlin Heidel­berg.

Hosokawa T. Ito M. Kaplan H.B. Camacho F. and Shoenfield D. (1982) Phase II trials with cis-platin in ovarian malignancies. J. Jap. Soc. Cancer. Therap., 17, 31-40.

Hough-Evans B.R. and Howard J. (1982) Genome size and DNA complexity of Plas­

modium falciparum. Biochem. Biophys. Acta, 698, 56-61.

Howie J.A. and Gale G.R. (1970) Cis-dichlorodiammine platinum (II): Persistent and

selective inhibition of DNA synthesis in vivo. Biochem. Pharmacol., 19, 2757-2762.

Inselburg J. (1985) Induction and isolation of artemisinin-resistant mutants of Plas­

modium falciparum. Am J. Trop. Med. Hyg., 34, 417-418.

Inselburg J. and Banyal H.S. (1984) Synthesis of DNA during the asexual cycle of

Plasmodium falciparum in culture. Mol.. Biochem. Parasitol., 10, 79-87.

Inselburg J. Bzik D.J. and Li W.B. (1988) Plasmodium falciparum: Three amino acid

changes in the dihydrofolate reductase of pyrimethamine-resistant mutant. Exp.

Parasitol., 67, 361-363.

Issacs R.D. and Ellis-Pegler R.B. (1987) Plasmodium falciparum RI resistance to qui­

nine and sulfadoxine-pyrimethamine in the Solomon islands. Med. J. Aust., 146, 449-

450.

Janse C.J. vanDer Klooster P.F.J, van Der Kaay H.J. van Der Ploeg M. and Overdulve J.P. (1986) DNA synthesis in Plasmodium herghei during asexual and sexual develop­ment. Mol. Biochem. Parasitol., 20,173-182.

Jensen J.B. Capps T.C. and Carlin J.M. (1981) Clinical drug-resistant malaria acquired from cultured parasite. Am. J. Trop. Med. Hyg., 30, 523-525.

Jensen J.B. Boland M.T. and Akood M. (1982) Induction of crisis forms in cultured

Plasmodium falciparum with human serum from Sudan. Science, 216, 1230-1233.

Jensen J.B. Boland M.T. Hayens J.D. and Akood M. A.(1982) Plasmodium falciparum :

rapid assay for in-vitro inhibition due to human serum from resident of malarious

areas. Expt. Parasitol., 54, 416-424.

Jensen J.B. Hoffman S.L. Boland M.T. Akood M.A.S. Laughlin L.VV. Kurniawan L. and

Marwato H.A. (1984) Comparison of immunity to malaria in Sudan and Indonesia:

crisis- form versus merozoite invasion inhibition. Proc. Natl. Acad. Sci. USA, 81, 922-

925.

Khan A. Albyrk A. and Hill J.M. (1972) Effect of cis- platinum dichlorodiammine on

graft rejection. Prolonged survival of skin grafts against H^- histocompatibility. Proc.

Soc. Exp. Biol. Med., 141, 7-9,

Killick-Kendrick R.(1978) Taxonomy, zoogeography, and evolution, pp 1-48. In :

Killick-Kendrick, R. and Peters, W. (eds) Rodent malaria. Academic, NewYork.

Kleinerman E.S. and ZweUing L.A. (1982) The effect of cis-diamminedichloroplatinum

(II) on immune function in vitro and in vivo. Cancer Immunol. Immunother., 12,191-

196.

Kleinerman E.S. Zwelling L.A. and Muchmore A.V. (1980): The enhancement of natu­

rally occurring spontaneous monocyte-mediated cytotoxicity by cis-diammine dichloro

platinum (II). Cancer Res., 40, 3099-3102.

Knowlesi G. Sanderson A. and Walliker D. (1981) Plasmodium yoelii: genetic analysis

of crosses between two rodent malaria subspecies. Exp. parasitol., 52, 243-247.

Kramer K.J. and Siddiqui W.A. (1981) A strain of Plasmodium falciparum from the

Phillippines. Continuous in vitro cultivation and drug susceptibility studies. Tenth

International congress on tropical medicine and malaria. Manila, Phillipines, Nov. 9-

15.

Kraus M.H. Yuasa Y and Aaronson S. (1984) A position 12 - activated H- ras oncogene

in all HS578T mammary carcinosarcoma cells but not normal mammary cells of the

same patient. Proc. Natl. Acad. Sci. USA, 81, 5384-5388.

Kremsner P.G. Zotter G.M. Feldmeier H. Bienzle U. Jansen-Rosseck R. Graninger W.

1Z6

Rocha R.M. and Wernsdorfer W.H. (1989) Difference in drug response of Plasmodium

falciparum within an area of the Amazon region. Trans. R. Soc. Trop. Med. Hyg., 83, 158-161.

Kwok S. Kellogs D.E. Mc Kinney N. Spasic D. Goda L. Levenson C. and Sninsky JJ. (1990) Effects of primer- template mismatches on the polymerase chain reaction: human immunodeficiency virus type I model studies. Nucl. Acids Res., 18, 999-1005.

Lambros C. and Vanderberg J.P.(1979) Synchronization of Plasmodium falciparum eryth­

rocytic stages in culture. J.Parasitol., 65, 418-420.

Landau I. and Boulard Y. (1978) Life cycles and morphology, p 53-84. In: Killick-

Kendrick and Peters W. (eds) Rodent Malaria. Academic Press, London, New York,

San Fransisco.

Langreth S.G. Jensen J.B. Reese R.T. and Trager W. (1978) Fine structure of human

malaria in vitro. J. Protozool., 24, 443-452.

Laveran A. (1880) Note sur un nouveau parasite nouve dan le sang des malades atteints defievre palustre. Bull. Acad. MEd., 9,1235.

Le Bras J. Deloron P. Ricour A. Andrieu B. Savel J. and Couland J.P. (1983) Plasmo­dium falciparum: Drug sensitivity in vitro of isolates before and after adaptation to continuous culture. Exp. Parasitol., 56, 9-14.

Le Bras J. Simon E, Ramanamirija J.A., Calmel M.B. Hatin I. Deleron P. Porte J. Marchais

H. Clausse J.L. Biaud J.M. Sarrouy J. Guiguemde T.R. Carme B. Charmot G. Coulaud

J.P. and Coulanges P. (1987) Sen.sibilite de Plasmodium falciparum aux quinoleines et

strategies therapeutiques: Comparaison de la situation en Afrique et Madagascar entre

1983 et 1986. Bull. Soc. Path. Exot. Flliales, 80, 477-489

Lecointe P. Macquet J.P. Butour J. and Paloetti C. (1977) Relative efficiencies of a

square planar platinum (II) compounds on Salmonella Mutagenesis. Metal Res., 48,

139-144.

Looareesuwan S. White N.J. Benjasurat Y. Phillips R.E. Karbwang J. Attanath P. and

Warrell D.A. (1985) Intravenous amodiaquine and oral amodiaquine/ erythromycin

in the treatment of chloroquine- resistant falciparum malaria. Lancet, 4, 805-808.

Maberti S. (1960) DesarroUo do rcsistencia a la pirimctamina. Prcsontacion do 15

casos estudiados en Trajillo, Venezuela. Archives Venezolanos de Medicina Trop.

Parasitologia Medica ,3, 239-259.

Mackerras M.J. and Ercole Q.N. (1947) Observations on the action of Paludrine on malarial parasites. I. The action of Paludrine on Plasmodium vivax. II. The action of paludrine on Plasmodium falciparum gametocytes. Trans. R. Soc. Trop. Med. Hyg., 41, 365-376.

Markus M.B. (1976) Possible support for the sporozoite hypothesis of relapse and

latency in malaria. Trans. R. Soc. Trop. Med. Hyg., 70, 535.

Martin S.K. Oduola A.M.J, and Milhous W.K. (1987) Reversal of chloroquine resis­

tance in Plasmodium falciparum by verapamil. Science, 235, 899-901.

McChesney E.W. and Fitch CD. (1984) 4-aminoquinolines. pp 3-60. In Peters W.

and Richards W.H.G. Antimalarial drugs II, (ed. W. Peters and W.H.G. Richards),.

Springer-Verlag, Berlin.

Mc Cutchan T.F. Welch J. A. Dame J.B. Quakyi I.A. Graves P.M. Drake J.C. and Allegra

C.J. (1984) Mechanism of pyrimethamine resistance in recent isolates of Plasmodium

falciparum. Antimicrob. Agents. Chemother., 26, 656-659.

Mc Laughlin G.L., Ruth J.N. Zablonski E. et al. (1987) Use of enzyme linked synthetic DNA in diagnosis of P. falciparum malaria. Lancet,l, 714-716.

Mehlhorn H. and Walldorf V. (1988) Life cycles.p 1-147. In: Mehlhorn (ed) Parasitol­

ogy in Focus, Facts and Trends. Springer-Verlag.

Mehra N. and Bhasin V.K. (1993) In vitro gametocytocidal activity of artemisinin and

its derivatives on Plasmodium falciparum. Jap. J. Med. Sci. Bio.,46, 37-43.

Miller L.H. Mason S.J. Clyde D.F. and Mc Guiness M.H. (1976) The resistance factor

to Plasmodium vivax in blacks. The Duffy blood group genotype FyFy N. Engl. J.

Med., 295, 302-304.

Montandon A.J. Green P.M. Giannelli F. and Bentley D.R. (1989) Direct detection of point mutations by mismatch analysis: Application to Hemophilia B. Nucl. Acids Res. 17, 3347-3358.

Monti- Bragdin C. Ramani L. Samer L. Mestroni G. and Zassinorich G. (1975) Effects

130

of cis-dichlorodiammine platinum (II) and related transition metal complexes on E.coli.

Antimicrob.

Morgan (1974) the genetics of malaria parasites: studies on pyrimethamine resis­

tance ( Thesis for Ph D degree) University of Edinburgh.

Mullis K.B. Ferre E and Gibbs R. A. (1994) The polymerase chain reaction. Birkhauser

Boston.

Mullis K. Falcoma E Scharf S. Snikl R. Horn G. and Erlich H. (1986) Specific amplifi­

cation of DNA in vitro: The polymerase chain reaction. Cold Spring Harbor Symp.

Quant. Biol., 51, 260.

Mucenski CM. Guerry P. Buesing M. Szarfman A. Trosper J. Walliker D.Watt G., Sangalang R. Ranoa C.P. Tuazon M. Majam O.R. Quakyi I. Scheible L.W. Cross J.H. and Perine PL. (1986) Evaluation of a synthetic oligonucleotide probe for diagnosis of Plasmodium falciparum infection. Am. J. Trop. Med. Hyg., 35, 912-920.

Munchausen L.L. (1974) The chemical and biological effects of cis- dichlorodiammine

platinum (II), an antitumor agent on DNA. Proc. Natl. Acad. Soc. USA, 71, 4519-4522.

Myers R.M. Fischer S.G. Lerman L.S. and Maniatis T. (1985) Nearly all single base substitutions in DNA fragments joined to a GC clamp can be detected by denaturing gradient gel electrophoresis. Nucl. Acids Res., 13, 3131-3145.

Nair L. and Bhasin V. K. (1993) Chemosensitivity of chloroquine resistant Plasmo­

dium falciparum isolate to quinine-type compounds in vitro. Acta Protozoologica, 32,

79-81.

Neiva A. (1910) Ueber die Bildung einer chinninresistenten Rasse des

Malariaparasiten. Mem. Inst. Oswaldo Cruz, 2,131-140.

Newton C.R. Graham A. Heptinstall L.E. Powell S.J. Summers C. Kalsheker N. Smith J.C. and Markham A.E (1989) Analysis of any point mutation in DNA.The amplifica­tion refractory mutation system (ARMS). Nucl. Acids Res., 17, 2503-2516.

Nguyen-Dinh P. and Payne D. (1980) Pyrimethamine sensitivity in Plasmodium falci­

parum: determination in vitro by a modified 48 hour test. Bull. WHO, 58, 909-912.

Nguyen-Dinh P. Hobbs J.H. and Campbell C.C. (1981) Assessment of chloroquine

sensitivity of Plasmodium falciparum in Choluteca, Honduras. Bull. WHO, 59, 641-646.

Nicol B.M. (1953) Use and effectiveness of antimalarial drugs : experience of non -

native resident populations of Nigeria, West Africa. Br. Med. J., II, 177-180.

Oduola A.M.J. Ogundahunri O.A.T. and Salako L.A. (1992) Continuous cultivation

and drug susceptibility testing of Plasmodium falciparum in a malaria endemic area. J.

Protozool., 39 (5), 605-608.

Okayama H. Curiel D.T., Brantly M.L. Holmes M.D. and Crystal R.G. (1989) Rapid, nonradioactive detection of mutations in the human genome by allele-specific amplication. J. Lab. Clin. Med., 114,105-113.

Oquendo P. Goman M., Mackay M. Langsley G. Walliker D. and Scaife J. (1986) Char­

acterization of a repetitive DNA sequence from the malaria parasite Plasmodium falci­

parum. Mol. Biochem. Parasitol. 18, 89-101.

Orjih A.U. Banyal H.S. Chevli R. and Fitch CD. (1981) Hemin lyses malaria para­

sites. Science, 214, 667-669.

Page R.H. Tally R.W. and Liversmore D.H. (1977) The effect of cis-

diamminedichloroplatinum (II) and cyclosphosphamide on immune response and tu­

mor rejection in BALBC and PLJAX mice. J. Clin. Hematol. Oncol., 7, 105-113.

Palmer T.T. Townley L.B., Yigzaw M. and Armstrong J.C. (1976) Chloroquine sensi­tivity of Plasmodium falciparum in Ethiopia II. Results of an in vitro test. Am. J. Trop. Med. Hyg., 25, 10-13.

Pasvol G. and Wilson R.J.M. (1982) The interaction of malaria parasites with red

blood cells. British Med. Bull., 38, 133-140.

Payne D. (1987) Spread of chloroquine resistance in Plasmodium falciparum. Parasitol.

Today 3, 241-246.

Peters W (1970) Chemotherapy and drug resistance in malaria. Academic London.

Peters W. (1984 ) History and current status of drug resistance, p.423-445. In Peters

W and Richards W.H.G. (eds.). Antimalarial drugs I. Springer-Verlag Berlin Heidel­

berg.

132

Peters W. (1984) Use of drug combinations, p 499-507. In W. Peters and W. H. G.

Richards (eds.). Antimalarial drugs II. Springer-Verlag Berlin Heidelberg.

Peters W. (1987) Chemotherapy and drug resistance in malaria , Vols I and II, Aca­

demic Press, London.

Peters W. (1989) Changing pattern of antimalarial drug resistance. J. R. Soc. Med.,

82, 14-17.

Peters W. (1990a) Drug resistance in malaria. Recenti Progres.Gi in Medicina, 81, 750-

753.

Peters W. (1990b) Plasmodium : resistance to antimalarial drugs. Ann. Parasitol.

Hum. Comp., 65, Suppl. 1,103-106.

Peters W. (1990c) Prevention of antimalarial drug resistance. Pharmac. Ther., 47, 499-508.

Peterson D.S. (1993) PCR methods for identification of point mutations and gene rearrangements.p 213-222 . In: Hyde J.E. (ed) Methods in molecular biology, vol 21, Protocols in molecular parasitology. Humana Press Inc., Totowa, NJ.

Peterson D.S., Walliker D.and Wellems T.E. (1988) Evidence that a point mutation in dihydrofolate reductase-thymidj^late sjmthase confers resistance to pyrimethamine in falciparum malaria. Proc. Natl. Acad. Sci. USA., 85, 9114-9118.

Peterson D.S. Milhous W.K. and Wellems T.E. (1990) Molecular basis of differential resistance to cycloguanil and pyrimethamine in Plasmodium falciparum malaria. Proc. Natl. Acad. Sci. USA., 87, 3018-3022.

Peterson E. Hogh B. Hanson A.P. Bjorkman A. and Flacks H (1990) In vitro and in vivo susceptibility of Plasmodium falciparum isolates from Liberia to pyrimethamine, cycloguanil and chlorcycloguanil. Am. J. Trop. Med. Parasitol., 84, 563-571.

Phillips R.E. Warell D. A., White N.J. Looareesuwan S. and Karbwang J. (1985) Intra­venous quinidine for treatment of severe falciparum malaria.Clii\icdl pharmacokinetic studies. N. Engl. J. Med., 312,1273-1278.

Powell R.D. Brewer G.A. Alving A.S. and Millar J.W. (1964) Studies on a strain of

chloroquine resistant Plasmodium falciparum from Thailand. Bull. WHO, 30, 29-44.

133

Rahn R.O. Johnson N.R Hsie A.W. Lemontt J.R Marker W.E. Regan J.D. and Dunn W.C. (1980) The interaction of platinum compounds with the genome: correlation between DNA binding and biological effects. Mechanism in organ and tissue dam­age, p 153-162. In: W^tchi H.(ed) The scientific basis of toxicity assessment.

Ramakrishnan S.R Young M.D. Jeffrey G.M. Burgers R.W. and Mc Lendon S.B. (1952)

The effect of single and multiple doses of paludrine upon Plasmodium falciparum. Am.

J. Hyg., 55, 239-245.Trop. Med. Hyg., 78, 359-362.

Ramanamirija J.A. Deloron R Biaud J.M. Le-Bras J. and Coulanges P. (1985) Sensibilite

in vivo et in vitro aux amino - 4 - quinoleines de Plasmodium falciparum a Madagas­

car : resultats de deux annees d' etude. Bull. Soc. Path. Exot. Filiales., 78, 606-614.

Reese R.T. Motyl M.R. and Hofer-Warbinek R (1981) Reaction of immune sera with

components of the human malarial parasite Plasmodium falciparum. Am. J. Trop. Med.

Hyg., 30, 1168.

lUchards W.H.G. and Maples B.K. (1979) Studies of P.falciparum. in continuous culti­vation: Effect of chloroquine and pyrimethamine on parasite growth and viability. Ann. Trop. Med. Parasitol., 73, 99-108,

Rieckmann K.H. (1980) Susceptibility of cultured parasites of Plasmodium falciparum

to antimalarial drugs.p 35-50. In: Rowe D.S. and Hirumi H.(eds) The in vitro cultiva­tion of the pathogens of tropical diseases. Tropical diseases research series, Schwabe, Basel.

Rieckmann K.H. and Antunano L. (1971) Chloroquine resistance of Plasmodium falci­

parum in Brazil detected by a simple in vitro method. Bull. WHO, 45, 157-167.

Rieckmann K.H., Campbell G.H. Sax L.J. and Mrema J.E. (1978) Drug sensitivity of

Plasmodium falciparum: An in vitro microtechnique. Lancet, 1, 22-23.

Rieckmann K.H. Mc Namara J.V. Frischer H< Stockerf T*A Carson P.E. and Powell R.D. (1968) Effect of chloroquine, quinine and cycloguanil upon maturation of asexual erythrocj^ic forms of two strains of Plasmodium falciparum in vitro. Am. J. Trop. Med. Hyg., 17, 661-671.

Rosario V. (1981) Cloning of naturally occurring mixed infections of malaria para­sites. Science, 212, 1037-1038.

134

Rosenberg B. (1971) Some biological effects of platinum compounds. Platinum metal

reviews,15, 3-12.

Rosenberg B, (1973) Platinum coordination complexes in cancer chemotherapy. Naturwissenschaften, 60, 399-406.

Rosenberg B. (1984) Cisplatin: Its history and possible mechanism of action, p 9-20.

In: Prestayko A.W., Crooke S.T. and Carter S.K. (eds) Cisplatin, current status and

new developments. Academic Press Inc., New York and London.

Rosenberg B. (1985) Fundamental studies with cisplatin. Cancer, 55, 2303-2316.

Rosenthal PJ., McKerrow J.H. Aikawa M. Nagasawa H. and Leech J.H. (1988) A

malarial cysteine proteinase is necessary for hemoglobin degradation by Plasmodium

falciparum. J. Clin. Invest., 82, 1560-1566.

Rowe A.W. Eyster E. and Kellner A. (1968) Liquid nitrogen preservation of red blood cells for transfusion - a low glycerol rapid freeze procedure. Cryobiology, 5,119-128.

Saggers V.H., Hariratnajothi N. and Mc Lean A.E.M. (1970) The effect of diet and

phenobarbitone on quinine metabolism in the rat and in man. Biochem. Pharmacol.,

18, 499-503.

Saiki R. Gelfand D.H. Stoffel S. Schaif S.J. Higuchi R. Horn G.T. Mullis K.B. and Erlich

H.A. (1988) Primer directed enzymatic amplification of DNA with thermostable DNA

polymerase. Science, 239, 487-491.

Sambrook J. Fritch E.F. and Maniatis T. (1989) Molecular cloning: A laboratory manual

(second ed.). Cold Spring Harbor Laboratory Press.

Santos E. Martin-Zanca D. Reddy E. Pierotti M.A. Delia Porta G. and Barbacid M.

(1984) Malignant activation of a K-ras oncogene in lung carcinomas but not in nor­

mal tissue of the same patient. Science 223, 661-664.

Schapira A. (1984) Concomitant resistance to pyrimethamine and cycloguanil of chlo-roquine-resistant falciparum malaria from East Africa: an in vitro study of 12 isolates. Trans. R. Soc. Trop. Med. Hyg., 78, 359-362.

Schellenberg K.A. and Coatney G.R. (1961) The influence of antimalarial drugs on

nucleic acid synthesis in Plasmodium gallinaceum and Plasmodium berghei. Biochem.

Pharmacol., 6, 143-152.

Schute P.G. and Maryon M. (1954) A study of gametocytes in a West African strain of

Plasmodium falciparum. Trans. R. Soc. Trop, Med. Hyg., 44, 421-438.

Shooter K.V., Hawse R., Merrifield R. K. and Robin A.B. (1972) The interaction of platinum (II) compounds with bacteriophages T and R . Chem. Biol. Interact., 5, 289-307.

Sirawaraporn W. and Yuthavong Y. (1984) Kinetic and molecular properties of dihy-drofolate reductase from pyrimethamine sensitive and pyrimethamine resistant Plas­modium Chabaudi. Mol. Biochem. Parasitol.,10, 355-367.

Slater A.F.G. and Cerami A. (1992) Inhibition by chloroquine of a novel heme

polymerase enzyme activity in malaria trophozoites. Nature, 355, 167-169.

Smalley M.E. and Brown J. (1982) In vitro demonstration' of pyrimethamine resis­

tance of wild P. falciparum in Gambia. Trans. R. Soc. Trop. Med. Hyg., 76, 324-328.

Smit E.H.D. (1987) Quinine is not what it used to be. Acta Leidensia, 55, 21-27.

Snewin V.A. England S.M.Sims P.EG. and Hyde J.E. (1989) Characterization of the

dihydrofolate reductase-thymidylate synthetase gene from human malaria parasite

highly resistant to pyrimethamine. Gene, 76, 41-52.

Snounou G. Viriyakosol S. Zhu X.P. Jarra W. Pinheiro L. do Rosario V.E. Thaithong S. Brown K. N. (1993) High sensitivity of detection of human malaria parasites by the use of nested polymerase chain reaction, Mol. Biochem. Parasitol., 61(2), 315-320.

Sucharit P. Harinasuta T. Chongsuphajaisiddhi T. Tongprasreeth N. and Kasemsuth R.

(1977) In vivo and in vitro studies of chloroquine-resistant malaria in Thailand. Ann.

Trop. Med. Parasitol., 71, 401-405.

Suebsaeng L. Wernsdorfer W.H. and Rooney W. (1986) Sensitivity to quinine and

mefloquine of Plasodium falciparum in Thailand. Bull. WHO, 64, 759-765.

Sweeny T.R. (1984) Drugs with quinine-like action. pp275-287. In W. Peters and

W.H.G. Richard eds. Antimalarial drugs 11. Springer-Verlag, Berlin.

136

Tanaka M. Gu H.M. BzikD.J. Li W.B. and Inselburg J. (1990) Dihydrofolate reductase mutations and chromosomal changes associated with pyrimethamine resistance of Plasmodium falciparum. Mol. Biochem. Parasitol., 39,127-134.

TDR news (1994) UNDP/World Bank/WHO, March, no. 44

Thaithong S. Beagle G.H. and Chutmongkonkul M. (1983) Susceptibility of Plasmo­

dium falciparum to five drugs : an in vitro study of isolates mainly from Thailand.

Trans. R. Soc. Trop. Med. Hyg., 77, 228-231.

Tominaya O. Hamelin R. Remvikos Y. Salmon R.J. and Thomas G. (1992) p53 from

basic research to clinical applications. Crit. Rev. Oncogen, 3, 257-282.

Trager W. (1979) Plasmodium falciparum in culture: Improved continuous flow method.

J. ProtozooL, 26,125-129.

Trager W. and Jensen J.B. (1976) Human malaria parasites in continuous culture.

Science, 193, 673-675.

Tungpradabkul S and Panyim S. (1985): Isolation of DNA and total RNA. In : Panyim,

S,, V^lairat, P. and Yuthavong, Y. (eds). Application of genetic engineering to research

on tropical disease pathogens with special reference to Plasmodium - A laboratory

manual of selected techniques,TDR-WHO, 51-57.

Turner R.B. and Woodward R.B. (1953) The chemistry of the cinchona alkaloids, p 1-63. In: Manske R.H.F. and Holmes H.L. (eds) The alkaloids. Vol III., Academic, New York.

Valera C.V. and Shute G.T. (1975) Preliminary studies on the response of Plasmodium

falciparum to chloroquinine in the Phillipines using the in vitro technique. WHO/

MAL 75: 852,WHO,Genpva.

van Mansfeld A. and Bos J.H. (1992) PCR based approaches for detection of mutated ras genes. PCR Methods Applic.,1, 211-216.

Vandenberg H.W. and Roberts J.J. (1975) Investigations into the mechanism of action

of antitumor platinum compounds: Time and dose- dependent changes in the alka­

line sucrose gradient sedimentation profiles of DNA from hamster cells treated with

cis-platinum (II) diamminedichloride. Chem. Bio. Interact., 11, 493-499.

1 3 /

Verdrager J. (1986a) epidemiology of emergence and spread of drug-resistant falci­parum malaria in South-East Asia and Australasia. J.Trop. Med. Hyg., 89, 277-289.

Verdrager J. (1986b) Epidemiology of emergence and spread of drug-resistant falci­

parum malaria in Southeast Asia. Southeast Asian J. frop! iiied. Public Hlth.,17,111-

118.

Vial H.J. Thuet M.S. and Phillips J.R. (1982) Phospholipid biosynthesis in synchro­

nous Plasmodium falciparum cultures. J. Protozopl., 29, 258-263.

Vincke I. and Lips M. (1948) Un nouveau Plasmodium d'un rongeur sauvage du Congo,

Plasmodium berghei n.sp. Ann. Soc. Beige, Med. Trop., 28, 97-104.

Volge S.E. Lenner H., Kaplan H.B., Camacho E and Shoenfield D. (1982): Mitomycin methotrexate bleomycin and cis-DDP (II) n the chemotherapyof advanced waquamous cancer of the head and neck. Cancer, 50, 6-9

Walker A.J. and Lopez Antunano F.J, (^968) Response to drugs of South American

strains of Plasmodium falciparum. Trans. R., Soc. Trpp. Med. Hyg., 62, 654-667.

Walliker D. Carter R. and Sanderson A, (1975), Genetic studies on Plasmodium chabaudi . ' , ' ••,• .. ^ I V ^ ' • • r . I . I .

: recombination between enzyme markers. Parasitology, 70, 19-24,

Walliker D, Sanderson A. Yoeli M, an(d Hargreavi^s B.J. (19 76) A genetic investigation of virulence in a rodent malaria parasite. Parasitology, 72, 183-194.

Walter R.D. (1986) Altered dihydrofolate reductase in pyrimethamine - resistant Plas­

modium falciparum. Mol. Biochem. Parasitol., 19, 61-66.

Warhurst D.C. and Killick Kendr^ck R. (1967) Spontaneous resistance to chloroquine • ' I i • • ' • • ' . . . I ' l } ' - ' - . ! / (

in a strain of rodent malaria (Plasmodium berghei yoelli). Nature, 213, 1048-1049.

Watkins W.M., Sixsmith D.G. and Chulay J.D. (1984) The activity of proguanil and its metabolites cycloguanil and cWorophenylbiguanide, against Plasmodium falciparum

in vitro. Ann. Trop, Med, Parasitol,, 78, 273-278,

Watkins WM. Sixsmith D,G. Chulay J.D. and Spencer H.C. (1985) Antagonism of

sulfadoxine and pyrimethamine antimalarial activity in vitro by p-amino benzoic

138

acid, p-aminobenzoyl glumatic acid and folic acid. Mol. Biochem. Parasitol., 14, 55-

61.

Watkins W.M. Spencer H.C. Kariuki D.M. Sixsmith D.G. Boriga D.A. Kipingur T. and Koech D.K. (1984) Effectiveness of amodiaquine as treatment for chloroquine resis­tant Plasmodium falciparum infections in Kenya. Lancet, 1, 357-359.

Weber J.L. (1988). Molecular biology of malaria parasite. Exp. Parasitol. 66, 143-170.

Welsh C.W. (1971) Growth inhibition of rat mammary carcinoma induced by cis-

platinum diammine dichloride 11, J. Natl. Cancer Inst., 47, 1071-1078.

Wernsdorfer W. H. (1991) The dynamics of drug resistance in Plasmodium falciparum.

Pharmac. Ther., 50, 95-121.

Wernsdorfer W.H. (1987) Quinine in health care in the tropics. Acta Leidensia, 55,

197-208.

Wernsdorfer W.H. and Kouznetsov R.L. (1980) Drug resistant malaria - occurrence,

control and surveillance. Bull. WHO, 58, 341-352.

Wernsdorfer W.H. and Payne D. (1991) The dynamics of drug resistance in Plasmo­

dium falciparum. Pharmac. Ther,, 50, 95-121.

White N.J. (1987) The pharmacokinetics of Quinine and quinidine in malaria. Acta

Leidensia, 55, 65-76,

Wilson T, (1952) Discussion , In: Symposium on Daraprim, Trans. R. Soc. Trop. Med.

Hyg., 46, 499-500,

Wilson C, M., Serrano A,E,, Wasley A,, Bogenschutz M,P,, shankar A,H. and Wirth D,F. (1989) Amplification of a gene related to mammalian mdr genes in drug -resis­tant Plasmodium falciparum. Science, 244,1184-1186,

Wmter E, Yamamoto E Almoguera C, and Perucho M, (1985) A method to detect and characterize point mutations in transcribed genes: Amplification and over expression of the mutant c-Ki-ras allele in human tumor cells. Proc. Natl. Acad. Sci. USA, 82, 7575-7579.

139

WHO (1965) Resistance of malaria parasites to drugs. Report of a WHO scientific

group.

WHO (1967) Chemotherapy of malaria. Report of a WHO scientific group. WHO Tech. Rep. Ser., 37, 42.

WHO (1971) Off. Rec. WHO. no 190, Appendix 14, 176-182.

WHO (1973) Chemotherapy of malaria and resistance to antimalarials. Report of a

WHO scientific working group. WHO Tech. Rep. Ser., 529, 30.

WHO (1979) Instructions for use of the WHO test kit for assessement of the response

of Plasmodium falciparum to chloroquine. WHO/ MAP 79:1, WHO, Geneva.

WHO (1984) Advances in malaria chemotherapy (W.H.O. Technical Report Series

No. 711).

WHO (1986) Eighteenth WHO expert committee on malaria. WHO Tech. Rep. Ser.,

no. 735.

WHO (1990) Practical chemotherapy of malaria. WHO Tech. Rep. Ser., 805,1-140.

Worth D.F. and Werbel L.M. (1984) Repository preparations. pp237-249. In: Peters W. and Richards W.H.G. (eds) Antimalarial drugs II, Springer - Verlag, Berlin Heidel­berg.

Wu D.Y. Ugozzoli L. Pal B.K, and Wallace R.B. (1989) Allele-specific enzymatic am­plification of beta-globin genomic DNA for diagnosis of sickle cell anemia. Proc. Natl. Acad. Sci. USA, 86, 2757-2760.

Wyler D.J. (1993) Malaria : Overview and Update. Clin. Infect. Dis., 16, 449-458.

Wysor M.S. Zwelling L.A. Sanders J.E. and Grenan M.M. (1982) Cure of mice

infected with Trypanosome rhodesiense by cis-diammine dichloro platinum (II) and

disulfiram rescue. Science, Vol 317, 454-456.

Yayon A. Cabanchik Z.I. and Ginsburg H. ( 1984) Identification of the acidic com­partment of Plasmodium falciparum infected human erythrocytes as the target of the antimalarial drug chloroquine. EMBO J, 3, 2605-2610.

140

Yeo A.E.T. and Rieckmann K.H. (1992) The activity of cycloguanil and pyrimethamine

in combination against Plasmodium falciparum. Trans. R. Soc. Trop. Med. Hyg., 86, 234.

Yisunsri L. and Rieckmann K.H. (1980) In vitro microtechnique for determining the drug susceptibility of cultured parasites of Plasmodium falciparum. Trans. R. ^pc. Trop. Med. Hyg., 74, 809-810.

Young M.D. (1957) Resistance of Plasmodium malariae to pyrimethamine (Daraprim). Am. J. Trop. Med. Hyg., 6, 621-624.

Zhang Y. and Hempelmann E. (1987) Lysis of malarial parasite and erythrocytes by

ferriprotoporphyrin IX-chloroquine and the inhibition of this effect by proteins.

Biochem. Pharmacol., 36,1267-1273.

Zhao S. and Zhang M.Y. (1985) Spektrometrische Ho chruck Flussigkeih

Chromatographische (HPLC) Untersuchungen Zur Analytic von Quinghaosu. Planta

Medica, 304, 233-237.

Zhao S. and Zhang M.Y. (1986) Application of precolumn reactions to high perfor­

mance liquid chromatography Quinghaosu in animal plasma. Anal. Chem., 58, 289-

292.

Zolg J.W. Chen G. and Plitt J.R. (1990) Detection of pyrimethamine resistance in Plasmodium falciparum by mutation-specific polymerase chain reaction. Mol. Biochem. Parasitol., 257-266.

Zwelling L. A. and Kohn K.W. (1979) Mechanism of action of cis-dichlorodiammine

platinum (II). Cancer Treat. Rep., 63,1439-1444.