characterization of putative virulence genes on the related … · cronobacter species nomenclature...

APPLIED AND ENVIRONMENTAL MICROBIOLOGY, May 2011, p. 3255–3267 Vol. 77, No. 100099-2240/11/$12.00 doi:10.1128/AEM.03023-10Copyright © 2011, American Society for Microbiology. All Rights Reserved.

Characterization of Putative Virulence Genes on the Related RepFIBPlasmids Harbored by Cronobacter spp.�†

A. A. Franco,1‡ L. Hu,1‡ C. J. Grim,1,2 G. Gopinath,1 V. Sathyamoorthy,1 K. G. Jarvis,1,2 C. Lee,1J. Sadowski,1 J. Kim,1,3 M. H. Kothary,1 B. A. McCardell,1 and B. D. Tall1*

Center for Food Safety and Applied Nutrition, FDA, Laurel, Maryland1; Oak Ridge Institute for Science and Education, Oak Ridge,Tennessee2; and Washington Internship Program, Washington, DC3

Received 24 December 2010/Accepted 7 March 2011

Cronobacter spp. are emerging neonatal pathogens that cause meningitis, sepsis, and necrotizing enteroco-litis. The genus Chronobacter consists of six species: C. sakazakii, C. malonaticus, C. muytjensii, C. turicensis, C.dublinensis, and Cronobacter genomospecies group 1. Whole-genome sequencing of C. sakazakii BAA-894 and C.turicensis z3032 revealed that they harbor similarly sized plasmids identified as pESA3 (131 kb) and pCTU1(138 kb), respectively. In silico analysis showed that both plasmids encode a single RepFIB-like origin ofreplication gene, repA, as well as two iron acquisition systems (eitCBAD and iucABCD/iutA). In a chrome azurolS agar diffusion assay, it was demonstrated that siderophore activity was associated with the presence of pESA3or pCTU1. Additionally, pESA3 contains a cpa (Cronobacter plasminogen activator) gene and a 17-kb type 6secretion system (T6SS) locus, while pCTU1 contains a 27-kb region encoding a filamentous hemagglutiningene (fhaB), its specifc transporter gene (fhaC), and associated putative adhesins (FHA locus), suggesting thatthese are virulence plasmids. In a repA-targeted PCR assay, 97% of 229 Cronobacter species isolates were foundto possess a homologous RepFIB plasmid. All repA PCR-positive strains were also positive for the eitCBAD andiucABCD/iutA iron acquisition systems. However, the presence of cpa, T6SS, and FHA loci depended on species,demonstrating a strong correlation with the presence of virulence traits, plasmid type, and species. Theseresults support the hypothesis that these plasmids have evolved from a single archetypical plasmid backbonethrough the cointegration, or deletion, of specific virulence traits in each species.

Farmer et al. (20) established the taxonomic position ofEnterobacter sakazakii, which was previously identified as yel-low-pigmented Enterobacter cloacae based on DNA-DNA hy-bridization studies in combination with phenotypic observa-tions (67). Recently, these organisms were reclassified withinthe novel genus Cronobacter, which comprises six speciesgroups: C. sakazakii, C. malonaticus, C. muytjensii, C. turicensis,C. dublinensis (with three subspecies, C. dublinensis subsp. dub-linensis, C. dublinensis subsp. lausannensis, and C. dublinensissubsp. lactaridi), and Cronobacter genomospecies group 1 (29).Cronobacter spp. can cause neonatal sepsis, necrotizing entero-colitis, and meningitis, with reported mortality rates of 40 to80%, and survivors often have severe neurological and devel-opmental disorders (38, 48, 68). These opportunistic pathogenshave been detected in many types of foods (18, 32, 48), as wellas in diverse environments (36). However, only powdered in-fant formula has been linked to outbreaks of meningitis inneonates and infants (8, 26).

Bacterial plasmids have been found to encode a diverseassortment of virulence factors, including antibiotic resistance,

toxins, adherence factors, and secretion systems (types 3, 4,and 6) (16, 33, 34, 46, 58). Pathogenic Escherichia coli, whichcomprises six different intestinal or extraintestinal pathotypes,was one of the first organisms for which virulence factorsgenes, such as those for expression of iron acquisition systems,adherence factors, and enterotoxins, were determined to becarried on plasmids (11, 37, 59). Plasmid-borne virulence geneclusters of one species have also been observed in plasmids ofother species or pathogenic groups, suggesting acquisition byhorizontal gene transfer (33, 34, 46).

Muytjens et al. (47) first performed plasmid analysis andcharacterization of a small cluster of eight Enterobacter saka-zakii strains obtained during a 6-year surveillance study ofneonatal meningitis and septicemia cases. This was followed bysimilar reports which showed that Cronobacter spp. (reportedas E. sakazakii) harbored multiple and similarly sized plasmids,that they could be isolated from strains obtained from infants,and that these plasmid-harboring strains could also be isolatedboth from utensils used to prepare infant formula and fromcontainers of powdered infant formula preparations kept inhospital nurseries (2, 13, 57).

The genomes of two Cronobacter species, C. sakazakii ATCCBAA-894 (41) and C. turicensis z3032 (61), have been se-quenced, and multiple plasmids are present in each strain,including two homologous plasmids identified as pESA3(�131 kb) in C. sakazakii BAA-894 and pCTU1 (�138 kb) inC. turicensis z3032. Recently, we reported that pESA3 encodesan outer membrane protease (named Cronobacter plasmino-gen activator) that was shown to provide serum resistance to C.sakazakii and may enhance its spread and invasion in a host

* Corresponding author. Mailing address: Room 3607, MOD 1 Fa-cility, Virulence Mechanisms Branch (HFS-025), Division of VirulenceAssessment, OARSA, Center for Food Safety and Applied Nutrition,U.S. Food and Drug Administration, 8301 MuirKirk Rd., Laurel, MD20708. Phone: (301) 210-7880. Fax: (301) 210-7976. E-mail: [email protected].

‡ A. A. Franco and L. Hu contributed equally to this project andboth should be considered first authors.

† Supplemental material for this article may be found at http://aem.asm.org/.

� Published ahead of print on 18 March 2011.

3255

on March 29, 2020 by guest

http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

(21). In this study, we performed an in silico analysis of pESA3and pCTU1 and identified several virulence gene clusters en-coded on these plasmids, such as two iron acquisition systemloci (eitCBAD and iucABCD/iutA), a type six secretion system(T6SS) locus, and a two-partner secretion system (TPS)/fila-mentous hemagglutinin gene (fhaB), and a transporter gene(fhaC) and associated putative adhesins (FHA locus). Wescreened a large collection of Cronobacter spp. to determinethe occurrence of these homologous plasmids among the spe-cies groups as well as the distributions of the virulence geneclusters.

MATERIALS AND METHODS

Bacterial strains and media. The strains evaluated in this study consisted of178 C. sakazakii, 25 C. malonaticus, 12 C. muytjensii, 6 C. turicensis, 6 C. dubli-nensis, and 2 genomospecies group 1 strains from our laboratory culture collec-tion; these strains represent isolates obtained from clinical, food, and environ-mental sources and from diverse geographical locations. Assignment of theCronobacter species nomenclature to the 229 strains was performed according tothe proposed classification scheme suggested by Iversen et al. (29). All of thestrains were PCR positive for the 350-bp amplified region of the Cronobacter zincmetalloprotease (zpx), a genus-specific gene target previously reported by ourgroup (40). Species identity was confirmed using the PCR procedure describedby Stoop et al. (62). For all experiments, wild-type C. sakazakii BAA-984 and C.turicensis z3032 strains and their respective pESA3- and pCTU1-cured deriva-tives were used as controls.

Frozen bacterial cultures were stored at �80°C in Trypticase soy broth (BBL,Cockeysville, MD) supplemented with 1% NaCl (TSBS) and 50% glycerol. Forpropagation, frozen cultures were rapidly thawed and subcultured onto platescontaining Trypticase soy agar (TSA; BBL) supplemented with 1% NaCl (TSAS)or Luria-Bertani (LB) agar (LBA; BBL), and the plates were incubated for 16 to18 h at 37°C.

Plasmid and PCR template isolation. Single colonies of each strain weretransferred from a TSAS or LBA plate to a culture tube containing 5 ml of TSBSor LB broth. Bacterial broth cultures were slanted to achieve maximum aerationand were incubated for 16 h with agitation at 37°C. Genomic DNA was preparedby serial dilution (1:1,000) of boiled cell cultures in distilled water as describedby Chun et al. (12) and was used as PCR template to screen the 229 Cronobacterstrains for the presence or absence of plasmid-borne genes. In parallel, plasmidswere isolated from a 3.0-ml aliquot from each broth culture by using the Qiaprepspin miniprep kit or the Qiagen plasmid minikit (Qiagen Sciences, Germantown,MD) according to the manufacturer’s instructions.

Curing pESA3 and pCTU1. To cure pESA3 and pCTU1 from wild-type strainsC. sakazakii strain BAA-894 and C. turicensis strain z3032, plasmids were firstlabeled with an ampicillin resistance gene by integration of pCVD442::cpa andpCVD442::fhaB into pESA3 and pCTU1, respectively. To constructpCVD442::cpa and pCVD442::fhaB, internal regions of cpa and fhaB were am-plified by PCR using primers designed to contain XbaI restriction sites at the 5�and 3� ends of the PCR products (Table 1). The PCR products were digestedwith XbaI and cloned into a compatible site in the suicide vector pCVD442 (17).pCVD442::cpa and pCVD442::fhaB were transformed into E. coli SM10 �pir andthen mobilized into nalidixic acid-resistant strains C. sakazakii BAA894NA andC. turicensis strain z3032NA, respectively (21). Single homologous recombinantswere selected on LB agar containing ampicillin (100 �g/ml) and nalidixic acid(256 �g/ml). Plasmids pESA3�cpa and pCTU1�fhaB, created by integration ofpCVD442::cpa and pCVD442::fhaB, respectively, were cured of C. sakazakiiBAA894NA and C. turicensis z3032NA by growing these strains in LB brothcontaining 1% sodium dodecyl sulfate (SDS). Recombinants cured of the plas-mids were selected on LB agar containing 10% sucrose as described by Don-nenberg and Kaper (17). The losses of pESA3 and pCTU1 in these recombi-nants, which were sucrose resistant and ampicillin sensitive, were confirmed byplasmid extraction (35) and PCR assays using primers derived from repA, eitA,iucC, and cpa genes and T6SS and fhaB loci (Table 1). The presence of pESA2in C. zakazakii BAA-894NA (cured of pESA3) and pCTU2 and pCTU3 in C.turicensis z3032NA (cured of pCTU1) was determined by PCR analysis usingprimers derived from pCTU3 repA and a common region of pESA2/pCTU2 repA(Table 1).

Bacterial mating. C. turicensis strain z3032NA harboring plasmidpCTU1�fhaB was used as a donor strain, and E. coli DH5�5 containing thekanamycin resistance plasmid pET30a(�) (Novagen, San Diego, CA) was used

as the recipient strain. Exponential cultures of donor and recipient bacteria werecentrifuged, washed, and suspended in fresh LB medium. Donor and recipientcells were mixed in a final ratio of 1:1, and 20 �l of this mix was applied to anitrocellulose filter placed on LB agar. The filter matings were incubated over-night at 37°C, and transconjugants were selected on LB agar containing ampi-cillin (100 �g/ml) and kanamycin (50 �g/ml).

Siderophore detection. Siderophore production was determined using thechrome azurol S (CAS) agar diffusion (CASAD) assay (55, 56). The CAS agarplate was punched with 5-mm-diamater holes by using a gel puncher. Each holewas filled in a two-step process with 70 �l (35 �l twice) of cell-free culturesupernatant of the test bacteria grown for 18 h in LB broth containing 200 �M2,2�-dipyridyl (Sigma Aldrich). After incubation at 37°C for 4 to 8 h, the presenceof an orange halo around a hole indicated a culture was positive for siderophoreproduction.

PCR assay development for the presence of pESA3 or pCTU1 plasmids andplasmid-specific gene targets. PCR primers were designed that targeted therepA, eitCBAD, iucABCD/iutA, and cpa genes and T6SS, and fhaB loci on pESA3and pCTU1, taking into account chromosomal homologues, when present, e.g.,homologues of the T6SS gene cluster. PCR primer names, sequences, ampliconsizes, and gene target names are shown in Table 1. All primers used in the PCRamplification experiments were prepared by Integrated DNA Technologies(Coralville, IA). All PCR mixtures were prepared using the GoTaq Green mastermix (Promega Corp., Madison, WI), which entailed a 25-�l reaction mixture with1 unit of GoTaq Hotstart DNA polymerase, 1.5 mM MgCl2, and 200 �M eachdeoxynucleoside triphosphate. Primers were added at 1 �M each, and 1 �l of theplasmid lysate (approximately 90 ng DNA/25-�l reaction mixture) or 5 �l ofboiled genomic DNA sample (approximately 50 ng DNA/25-�l reaction mixture)served as DNA template. In all PCRs, the polymerase was activated by using a3-min incubation step at 94°C, followed by 25 cycles of denaturation at 94°C for30 s and annealing and extension steps according to the PCR parameters de-scribed in Table 1. For each reaction, a final extension step of 5 min at the cycleextension temperature, as described for each PCR, was used (Table 1).

Plasmid agarose gel electrophoresis analysis. To confirm the results of therepA PCR assay used in this study, plasmids were isolated from representativestrains (including plasmid-harboring and plasmid-cured control strains) by usingthe Kado and Liu procedure (35) and subjected to agarose gel electrophoresisusing 0.7% Tris-borate-EDTA (TBE; Invitrogen, Carlsbad, CA) agarose gels ina RunOne (Embi Tec, San Diego, CA) or an IBI (Thermo Fisher Scientific, Inc.,Waltham, MA) horizontal electrophoresis unit. Gels were photographed withtransilluminated UV light by using a Gel-Chem-Doc XR molecular imagingsystem (Bio-Rad Laboratories, Hercules, CA). For PCR analysis, these plasmidsamples were dialyzed in distilled water using 0.025-�m VSWP filters (MilliporeCorp., Billerica, MA) to remove residual phenol and contained approximately400 ng DNA/25-�l reaction mixture. Plasmid preparations using the above citedplasmid kits were also subjected to agarose gel electrophoresis.

Nucleotide sequencing. PCRs for nucleotide sequencing were performed usingAccuPrime Taq DNA polymerase high fidelity (Invitrogen, Inc., Carlsbad, CA).Primers for sequencing reactions are listed in Table 1. Sequencing of PCRamplicons was performed by Macrogen, Inc. (Rockville, MD), and the sequenceswere submitted to GenBank.

Nucleotide sequence accession numbers. The NCBI accession numbers of thenucleotide sequences used in this study are as follows: the genome of C. sakazakiiATCC BAA-894, CP000783 to CP000785NP_009780; the genome of C. turicensisz3032, FN543093 to FN543096; pESA3, NC_009780; and pCTU1, NC_013283.All de novo sequences which were generated during this study were submitted toGenBank (accession numbers listed in parentheses) and included the following:(i) repA sequences of pCTU1 from C. turicensis strain E681 (HQ536984) andpCGS1 (plasmids named in similar fashion as per the pCTU1 naming scheme)from Cronobacter genomospecies group 1 strains E680 (HQ536988) and NCTC9529 (HQ536992); pCMA1 from C. malonaticus strains LMG 23826 (HQ536990)and E763 (HQ536983); pCSA1 from C. sakazakii strain Jor100 (HQ536986);pCDD1 from C. dublinensis subsp. dublinensis strain LMG 23823 (HQ536991);pCDL1 from C. dublinensis subsp. lausannensis strain LMG23824 (HQ536989);pCMU1 from C. muytjensii strains Jor174 (HQ536987) and Jor171 (HQ536985);(ii) an internal region of fhaB of pCDD1 from C. dublinensis subsp. dublinensisstrain LMG 23823 (HQ587045); and (iii) a partial sequence of iucC of pCDD1from C. dublinensis subsp. dublinensis strain LMG 23823 (JF412348).

RESULTS

Targeted in silico sequence analysis of pESA3 and pCTU1.Targeted in silico sequence analysis of pESA3 and pCTU1

3256 FRANCO ET AL. APPL. ENVIRON. MICROBIOL.


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

revealed that these two plasmids share a high degree of se-quence homology for each plasmid, although there are a num-ber of inserted and deleted regions specific to each plasmid(Fig. 1). Many of these unique clusters of genes, such as thetwo iron acquisition system loci (eitCBAD and iucABCD/iutA)and the cpa locus and T6SS of pESA3 and the downstreamregions of the FHA cluster of pCTU1, were most likely ac-

quired via horizontal gene transfer, as evidenced by a signifi-cant change in G�C content at these sites (Fig. 1).

BlastN analysis of the homologous, single replication proteingene repA (ESA_pESA3, location 115 to 588, and CT_pCTU1,location 110354 to 111367) indicated that these two plasmidsare members of the plasmid incompatibility group IncFIB.Phylogenetic cluster analysis (Fig. 2) of repA genes from

TABLE 1. PCR primers used in this study

Primer usagegroup and target

Forwardand reverse

primersSequence (5�–3�) Amplicon

size (bp)Annealing/extension cycle

parametersaPlasmid

association

For PCR analysisIncF1B F1B2fw GATGCGCCTTGGCCTGTTTGT 264 56°C for 30 s/72°C for 30 s pESA3/pCTU1

F1B2rv GCACAGCTTCACGAACTCCACeitA EitAF1 CCTTTTTCACGGCGTCGAGCTG 280 60°C for 30 s/72°C for 30 s pESA3/pCTU1

EitAR1 TCTCTTCTGGTTCTCCAGCGCGiucC IucCF TGCAGTGCCTGATGTCAGGCCAT 660 58°C for 30 s/72°C for 30 s pESA3/pCTU1

IucCR ACGCCAAACATCTCCTGATAGCGcpa cpafw GACAACCCTGAGTTCTGGTAAC 306 56°C for 30 s/72°C for 30 s pESA3

cparv ATGCGTATTTCTGCTGGTAA�cpa �cpafw CCGCTCAGTTTCATCTCAAT 303 50°C for 30 s/70°C for 90 s pCTU1

�cparv GCTGAATGATTTTGTGGT 1,693 pESA3�T6SS �t6ssfw GGAATACGCCTGCGCTGATGAC 471 56°C for 30 s/72°C for 60 s pCTU1

�t6ssrv CTGAACAGATGGCCGATCTGGTIntT6SS left �t6ssfw GGAATACGCCTGCGCTGATGAC 1,168 56°C for 30 s/72°C for 90 s pESA3

t6ssrv CCAGTAATTTCAGCGGCAGCTCvgrG vgrGfw GGTTTCACTTCCCGCTGATA 850 52°C for 30 s/70°C for 60 s pESA3

vgrGrv CCCGCAGTTAATCACCAGTTT6SS R end t6ssfw CTCAGATTACTGATCGGCGCTG 338 56°C for 30 s/72°C for 40 s pESA3

t6ssrw3 GTATGGCATACCGCAATTGCGCIntT6SS right t6ssfw CTCAGATTACTGATCGGCGCTG 800 56°C for 30 s/72°C for 60 s pESA3

�t6ssrv CTGAACAGATGGCCGATCTGGTfhaB fhafw GTGGCGAACCCGTATGGCATTAC 804 56°C for 30 s/72°C for 60 s pCTU1

fharv TGTCGCCTGCTATCTGCGCGTTG�FHA �fhafw GCGAAATGGTGATGCTGACCA 668 56°C for 30 s/72°C for 60 s pESA3

�fharv TCAACAGAGAGTGGGCAGCGACdfhaB cdfhafw GTGGCGAACCCGTATGGCACCAC 735 60°C for 30 s/72°C for 60 s pCDU1

cdfharv CGTGACGTCGTTTCTGGCATCACdiucC cdiucfw CGATCTGCAATTGCTGGAAGCGC 800 56°C for 30 s/72°C for 60 s

cdiucfw ATCAGTGCTGCCATCAGCACAGC

For sequencing reactionsb

repA, 5� end repA_1F GTGATACTCTCACTGGCGAAG 600 55°C for 30 s/72°C for 60 s pESA3/pCTU1repA_1R CTGTACTTGGCRGACTGCAC

repA, 3� end repA_2F GTGGAGTTCGTGAAGCTGTGCG 606 55°C for 30 s/72°C for 60 s pESA3/pCTU1repA_2R GGTCAGCATCACCATTTCGCCC

For plasmid curingc

fhaB fha11 CGACGTACTCTAGAGCGGCAACCTGACGGCGAAAGGCGAC

983 58°C for 30 s/72°C for 60 s pCTU1

fha12 GCGCCACTTCTAGAGACTCATCGCCCTGAAAAGTGGTCGC

cpa cpamut5 CGACGGACTCTAGAGTCGAAAGAATTTGTATATGACTCCAGTAC

551 56°C for 30 s/72°C for 60 s pESA3

cpamut6 GCGCCACTTCTAGATAATGCTCGTCGTTATCCTTCGCGGTCACCC

To identify pESA2/pCTU2and pCTU3

repA InF2Fw GAGACTGGCAGACCCGGCATA 398 59°C for 30 s/72°C for 40 s pESA2/pCTU2IncF2Rv TGCGTTCACGAGCTGCCTGG

repA H1Fw CGCCTCAGTGTGTTCACTCCG 551 52°C for 30 s/70°C for 60 s pCTU3H1Rv TAGCTCCCATAGACTCGGATC

a All PCRs were performed with 25 cycles (see Materials and Methods for further details).b Note that the two PCR products obtained from the two repA sequencing reactions overlapped by 164 bp.c The underlined sequence portions show the restriction site for XbaI.

VOL. 77, 2011 TWO PUTATIVE VIRULENCE PLASMIDS IN CRONOBACTER SPP. 3257


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

pESA3 and pCTU1 as well as those from representative strainsfrom the other Cronobacter species indicated that, as a group,they are most closely related to the RepFIB repA genes ofpILF82 harbored by pathogenic E. coli, pHCM2 of Salmonellaenterica serovar Typhi, and pMT1 harbored by Yersinia pestis.The repA sequences from Cronobacter spp. also separated intotwo distinct clusters, with clade 1 comprised of C. sakazakiistrains BAA-894 and Jor100, C. malonaticus strains E763 andLMG 23826, C. dublinensis subsp. lausannensis strain LMG23824, C. turicensis strains z3032 and E681, and the two Crono-bacter genomospecies group 1 strains E680 and NCTC 9529.Strains residing in cluster 2 are C. muytjensii strains Jor174 andJor171 and C. dublinensis subsp. dublinensis strain LMG 23823.

In silico analysis of pESA3 and pCTU1 showed that bothplasmids possess parAB partioning genes immediately up-stream of repA, but they did not possess the typical F-transfer(tra) or mobilization (mob) regions commonly found in Rep-FIB plasmids harbored by other members of the Enterobacte-riaceae (33). A site-specific integrase was observed in the insilico analysis of each plasmid (ESA_pESA3p05520 andCtu_1p00690) and was found to belong to the � phage familyof integrases in an operon arrangement with three genes en-coding a hypothetical protein and two tandem helicases (Fig.1). Interestingly, C. sakazakii BAA-894 and C. turicensis z3032each possess a cryptic conjugative plasmid, pESA2 andpCTU2, respectively, which could function to transfer pESA3and pCTU1 if a mob region were present on these plasmids(41, 61). To this end, results of conjugation mating experimentsusing C. turicensis strain z3032 as donor and E. coli DH5� asrecipient showed that pCTU1 was not self-transferred or mo-bilized by a pCTU2-mediated coconjugative mechanism (datanot shown).

Cronobacter species RepFIB plasmid-encoded putative viru-lence factors. Homologues of several putative virulence factorsare also found on both plasmids, indicating that the presenceof these plasmids likely contributes to the virulence of Crono-bacter spp. For example, both plasmids encode two highlyconserved iron acquisition systems (Fig. 1). In addition, pESA3encodes a T6SS and the cpa gene, which was recently demon-strated to be an important virulence factor in C. sakazakii (21),while pCTU1 contains a 27-kb region encoding a two-partnersecretion system and FHA locus (Fig. 1).

(i) Iron acquisition gene clusters. The capability of iron ac-quisition is generally thought to be a prerequisite for a pathogento establish infections when entering a host (15, 23). PlasmidspESA3 and pCTU1 harbor two iron(III) acquisition systems, ei-tCBAD (plasmid locations pESA_74943 to _77745 andpCTU1_45608 to _46366) and iucABCD/iutA (pESA3_119253 to_127220 and pCTU1_98772 to _106741) (Fig. 1).

The eitCBAD operon shares significant homology with manyABC transporters that mediate the translocation of iron, sid-erophores, and heme (39). The eitABCD operon is found inseveral enteric pathogens, both chromosomally and plasmidborne (33). Interestingly, in silico analyses of the nucleotidesequence of the eit operons of pESA3 and pCTU1 cluster themdistantly from other representative plasmid-borne eit operons,with the eit operons of pESA3 and pCTU1 having a differentgene arrangement, i.e., two oppositely oriented operons, ei-tCBA and eitD, compared to the typical operon arrangement ofeitABCD (see Fig. S1a in the supplemental material). TheeitCBAD operons of both pESA3 and pCTU1 are flankeddownstream by two unknown proteins (in pCTU1, one of theseproteins may be an inner membrane protein) and upstream bya gene encoding a major facilitator superfamily (MFS) protein.

FIG. 1. Sequence alignment of pESA3 and pCTU1, produced with the Artemis Comparison Tool (ACT). A schematic of each plasmid is shownabove (or below) its corresponding ruler. The sequence of pESA3 was modified by rejoining the repA gene at the 3� end, which is split in theGenBank sequence. The G�C content (as a percentage) is shown between the plasmid ORF schematic and the ACT homology output; pESA3and pCTU1 have a mean G�C contents of 56.85% and 56.05%, respectively. Select genes or loci are shown in color as follows: eit (red), iuc(orange), parAB and repA (purple), integrase (black) and associated genes (white), cpa (teal), T6SS (blue), and FHA (brown). In the middlesection, the red color indicates significant nucleotide homology, as determined by BlastN analysis, between pESA3 and pCTU1, and the locationon each plasmid, for example eit, iuc, parAB, and repA. White indicates regions or loci present on one plasmid and absent on the other, e.g., cpa,T6SS, and FHA.



http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

MFS-like proteins consist of a large and diverse group ofsecondary transporters, including uniporters, symporters, andantiporters, which facilitate the transport of a variety of sub-strates, such as ions, sugar phosphates, nucleosides, and aminoacids, across cytoplasmic or internal membranes.

The iucABCD/iutA operon consists of five genes responsiblefor synthesis and transport of a hydroxymate aerobactin-likesiderophore (39). The iucABCD/iutA operon of pESA3 andpCTU1 is highly conserved and shares a high degree of ho-mology with iron acquisition gene clusters harbored by otherenteric organisms (see Fig. S1b in the supplemental material),indicating that these genes are commonly found within theEnterobacteriaceae and that they are easily transferable, sincethe operons are found both chromosomally and on plasmids.The iucABCD/iutA operon of pESA3 and pCTU1 clusteredmost closely with another small clade comprised of Enterobac-ter cloacae, Enterobacter hormaechei, and Escherichia fergusoni.This subcluster falls within a larger cluster represented byseveral Yersinia species and Serratia proteamaculans (see Fig.S1b). Again, as with the eitCBAD operon, this operon isflanked upstream by a gene encoding an MFS-like protein,ShiF. Additionally, upstream of shiF is a homologue of viuB, aFAD-binding siderophore-interacting protein which has a highbinding constant that allows bacteria to sequester iron fromtransferrin and lactoferrin and suggests that viuB may dictateserum survival within a host, an attribute known to aid inpathogenicity (3). In both plasmids, this gene cluster is flankeddownstream by parBA.

To determine if pESA3 and pCTU1 encode functionallyactive siderophore systems, we assayed wild-type C. sakazakiiBAA-894 and C. turicensis z3032 and their plasmid-cured de-rivative strains for iron(III) uptake in a CASAD assay (56).Surprisingly, the wild-type strains (harboring plasmids pESA3and pCTU1), but not the plasmid-cured derivatives of BAA-894 and z3032, possessed siderophore activity (see Fig. S2 inthe supplemental material) suggesting that this activity is solelyplasmid associated.

(ii) Cronobacter plasminogen activator (cpa) gene locus. Insilico analysis of pESA3 revealed the presence of an omptinsuperfamily homologue, pESA3p05434, recently named Cpaby Franco et al. (21) (Fig. 1 and 3). Cpa shares significantidentity with the plasminogen activators Pla of Yersinia pestisand PgtE of Salmonella enterica (21). Other examples of plas-mid-borne omptins include PlaA, encoded on pEP36 harboredby Erwinia pyrifoliae, and protease VII encoded on pKP187and harbored by Klebsiella pneumoniae strain 342 (27, 43). Plaand PgtE contribute to the pathogenesis of Y. pestis and Sal-monella enterica by several mechanisms, such as invasiveness,systemic spread, and uncontrolled proteolysis of a variety ofhost proteins, including plasminogen, i.e., �2-antiplasmin (�2-AP) and complement proteins (27, 42, 43, 53, 60). We recentlyfound that Cpa has the capacity to provide serum resistance toC. sakazakii BAA-894 by proteolytically cleaving complementcomponents, as well as activate plasminogen and inactivate theplasmin inhibitor �2-AP, suggesting that this protein is animportant virulence factor for C. sakazakii (21). On pESA3,cpa is flanked upstream by an MFS-1 homologue and down-stream by cpmJK, encoding proteins involved in carbapenemresistance (Fig. 3). The cpa-flanking regions found on pESA3are conserved on pCTU1; however, instead of a 1,427-bp re-

FIG. 2. Phylogenetic cluster analysis of repA. The evolutionary historywas inferred using the neighbor-joining method (64). The percentages ofreplicate trees in which the associated taxa clustered together in thebootstrap test (1,000 replicates) are shown next to the branches (64). Thetree is drawn to scale, with branch lengths in the same units as those ofthe evolutionary distances used to infer the phylogenetic tree. The evo-lutionary distances were computed using the maximum composite likeli-hood method (65), and data shown are the number of base substitutionsper site. Codon positions included were the first, second, and third andnoncoding positions. All positions containing gaps and missing data wereeliminated from the data set (complete deletion option). There were atotal of 780 positions in the final data set. Phylogenetic analyses wereconducted by using MEGA4 (65).



http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

gion containing cpa, pCTU1 has a specific 37-bp region (Fig.3). Also in this region, on both plasmids is a palindromicinverted repeat (IR) of 10 to 13 nucleotides, separated by a10-bp spacer, forming a stem-loop structure. Interestingly,the small pCTU1-specific sequence is located upstream ofthis IR, while the cpa locus on pESA3 is located down-stream. We hypothesize that the IR is most likely a trans-poson attachment site, which would explain the presence ofcpa on pESA3 (Fig. 3).

(iii) T6SS-encoding regions or the T6SS locus. The T6SS isa recently characterized secretion system which appears to beinvolved in bacterial pathogenesis as a potential phage-likenanosyringe for the translocation of putative effector proteins(4, 31). T6SS gene clusters have been found in both pathogenicand nonpathogenic bacterial species (4). Several bacterial spe-cies have one or two copies of T6SS clusters, but a few species,

including Burkholderia species, have four to six clusters, sug-gesting redundancy for virulence or specificities for particularniches or hosts (4, 5, 31). T6SSs are typically comprised of aconserved core gene cluster of 13 to 15 open reading frames(ORFs) (5). In silico analysis of pESA3 harbored by BAA-894revealed that this T6SS gene cluster consists of 16 ORFs(ESA_pESA3p05491 to -5506) (Fig. 1 and 4). Two effectorproteins identified in other homologues of T6SS are also seenin this plasmid-borne T6SS gene cluster: Hcp1 (hemolysin co-regulated protein 1) and VgrG (valine-glycine repeat G pro-tein) are encoded by single-copy genes in this cluster (4, 5, 31).The COG3157 domain of this Hcp1 is shared by two otherproteins on pESA3 and the chromosome of C. sakazakii strainBAA-894, although the latter loci are not associated with aT6SS gene cluster. The VgrG protein also has related proteinsdistributed on the chromosome, but most of them are not

FIG. 3. cpa locus of pESA3. The schematic shows the pESA3 cpa locus, 1,427 bp, collapsed region (dashed lines) in pCTU1 (37 bp), andconserved upstream and downstream flanking genes rimL (COG1670; acetyltransferase of the type rimL N-acetylase of ribosomal proteins),MFS-1, the major facilitator superfamily transporter (putative antibiotic resistance drug efflux pump); cpmJK, homologous (41% amino acididentity) to proteins of Photorhabdus luminescens subsp. laumondii TTO1 involved in carbapenem resistance; TR, transcriptional regulator; gloA,gene with the functional domain of lactoylglutathione lyase (also known as glyoxalase I), bleomycin resistance protein, or dioxygenase; and PCRprimers (arrows with superscript numbers) used for plasmidotype screening. Primer 1, �cpafw; primer 2, �cparv; primer 3, cpafw; primer 4, cparv.

FIG. 4. The T6SS cluster of pESA3, 16,937 bp long, compared to the collapsed region (dashed lines) on pCTU1 (32 bp), including conservedupstream and downstream flanking genes and PCR primers (arrows with superscript numbers) used for plasmidotype screening. T6SS cluster genes(diagonal shading) are identified by their COG numbers, unless otherwise specified. DUF2931, putative lipoprotein. Flanking genes were identifiedby closest or most probable BlastX homology. arsCBR, arsenic resistance gene operon; dapA, homologue of dihydrodipicolinate synthetase;PRK11272, drug/metabolite transporter; gntR, putative transcriptional regulator with DNA-binding and aminotransferase domain; dsbGD,disulfide bond formation/isomerization genes; scsA, homologue of suppressor of copper sensitivity from Serratia odorifera DSM 4582; ynaJ, putativeinner membrane protein; SMI1_KNR4, regulator of 1,3--glucan synthase activity; ymjA, conserved hypothetical protein of Enterobacteriaceae;eitABCD, iron(III) siderophore operon. PCR primers (arrows with superscript numbers) used for plasmidotype screening were as follows: primer1, �t6ssfw; primer 2, �t6ssrv; primer 3, t6ssrv; primer 4, vgrGfw; primer 5, vgrGrv; primer 6, t6ssfw; primer 7, t6ssrv3.



http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

associated with any T6SS gene cluster. Other genetic compo-nents of the T6SS contained on pESA3 include genes encodingmembrane-embedded proteins, such as IcmF-DotU/IcmH-SciN homologues. IcmF/DotU share significant homology withsimilar homologues of T4SS stabilization proteins (5). Addi-tionally, an energizing component, ClpV, whose ATPase activ-ity is crucial for T6SS activity (4), is also present within theplasmid-borne T6SS locus. ClpV is a member of the Hsp100/Clp family of AAA� (ATPases associated with various cellularactivities) proteins (4). The major T6SS gene cluster of pESA3is flanked upstream by a gntR-like homologue whose product ischaracterized as a transcriptional regulator with two functionaldomains, an N-terminal DNA-binding helix-turn-helix domainand an aminotransferase C-terminal ligand-binding and oli-gomerization domain (Fig. 5). Downstream of the T6SS clusterare three putative genes encoding increased copper tolerance,including dsbG (24). The regions flanking the T6SS gene clus-ter on pESA3 are conserved on pCTU1; however, the16,937-bp T6SS locus is replaced by a specific 32-bp sequence(Fig. 4). In addition to the plasmid-borne T6SS cluster seen inpESA3, a larger cluster encoding 28 known T6SS proteins ispresent on the chromosome of BAA-894 between bp 3867420and 3897047. This cluster shares homology with a shorter clus-ter found on the chromosome of C. turicensis z3032 (betweenbp 74000 and 90400). The chromosomal T6SS cluster in BAA894 does not share significant homology at the nucleotide levelwith the pESA3 T6SS gene locus. While the T6SS gene clusterof pESA3 is absent from pCTU1, some of its predicted pro-teins, like VgrG and clpV, share homology with proteins foundin two partial clusters on the chromosome of C. turicensis z3032(between bp 2019520 and 2031123 and bp 2049130 and2062940) and a second cluster located on the chromosome ofC. sakazakii strain BAA-894 between bp 1966728 and 1978959(41). This suggests that the chromosomal T6SS loci and that

associated with the pESA3-like plasmids in Cronobacter spp.may possibly have distinct origins.

(iv) FHA locus. In silico sequence analysis of pCTU1 re-vealed the presence of a specific �27-kb region containingfhaB, fhaC, and five associated putative adhesins (Fig. 5). ThefhaB and fhaC genes encode proteins with significant identityto protein members of a two-partner secretion system (TPS).TPSs translocate large proteins or protein domains, mostlyadhesins and hemolysins, and have been identified in manybacterial genera, including human, animal, and plant patho-gens (30). TPSs are composed of two proteins, the transportedprotein (named fhaB in this study) and the specific transporter(fhaC) (30). The secretion of the filamentous hemagglutinin(FHA), a 230-kDa adhesin of Bordetella pertussis, represents amodel TPS (1). By using the KEGG Sequence Similarity da-tabase (SSDB) motif program (http://www.genome.jp/keg/ssdb), similar FHA-like proteins FhaB and ShlA/HecA/FhaAexofamily were found in Pantoea ananatis and Erwiniabillingiae EB661. SSDB analysis of the predicted protein en-coded by fhaB of pCTU1 revealed at least three carbohydrate-dependent hemagglutination active sites throughout the mol-ecule, 42 tandem hemagglutinin repeating motifs, and threeN-terminal phage replisome organizer (Phage_rep_org_N)protein motifs. Similar to what was observed in the cpa and theT6SS gene clusters encoded on pESA3, the 27,421-bp FHAlocus of pCTU1 is replaced by a 266-bp sequence on pESA3(Fig. 5). This pESA3-specific sequence has some stretches ofhigh homology to pCTU1 in the 5� region; however, the 3�region is highly divergent.

Curing of pESA3 and pCTU1 from C. sakazakii BAA-894and C. turicensis z3032. C. sakazakii BAA-894 and C. turicensisz3032 were successfully cured of pESA3 and pCTU1, respec-tively, after growing the strains in the presence of 1% SDS asdescribed in Materials and Methods. Curing of pESA3 and

FIG. 5. FHA locus of pCTU1 (27,421 bp), compared to the collapsed region (dashed lines) of pESA3 (266 bp), including conserved upstreamand downstream flanking genes. The FHA cluster includes a homologue of fhaC, two partner secretion proteins, and fhaB, the filamentoushemagglutinin precursor (diagonal gray lines); accessory adhesins (fha1 to -5; black) and accessory outer membrane protein homologues (FHAOMP; vertical gray lines) are also shown. Flanking genes include parAB, chromosome/plasmid partitioning proteins; repA, plasmid replicationprotein; HP_PGM, His residue phosphotase/phosphoglycerate mutase; COG4705, conserved membrane-anchored protein; rimL, COG1670acetyltransferase of the type rimL N-acetylase of ribosomal proteins; MFS_1, major facilitator superfamily transporter. Genes encoding hypo-thetical proteins are indicated by white arrows. PCR primers (indicated by arrows with superscript numbers) used for plasmidotype screening wereas follows: primer 1, �fhafw; primer 2, �fharv; primer 3, fhafw; primer 4, fharv.



http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

pCTU1 and conservation of pESA2 in BAA-894 and pCTU2and pCTU3 in z3032 were confirmed by plasmid extraction andagarose gel electrophoresis (curing of pESA3 is shown in Fig.S3 of the supplemental material). Furthermore, the plasmid-cured derivatives of C. sakazakii BAA-894 and C. turicensisz3032 were PCR negative for all pESA3/pCTU1 plasmid tar-gets (data not shown). Additionally, BAA-894 and z3032 wild-type and plasmid-cured derivative strains were PCR positivefor the repA gene of pESA2/pCTU2, whereas PCR assaysdesigned to detect the pCTU3 repA gene were positive in thewild-type strain and plasmid-cured derivative of C. turicensisz3032 (data not shown). Taken together, these results demon-strated that the plasmid-cured derivatives of these strainslacked only pESA3 or pCTU1 plasmids, respectively.

Detection of RepFIB plasmids among Cronobacter spp.based on repA-targeted PCR. A total of 229 strains of Crono-bacter spp. were screened by PCR, using primers targeting therepA gene, for the presence of a pESA3- or pCTU1-like plas-mid. Among the six species groups, 224 strains (97%) werePCR positive for repA (Table 2). The five repA PCR-negativestrains included three C. muytjensii strains, E456, E488, andATCC 51329, C. sakazakii CDC 9363-75, and C. dublinensisCDC 0743-75. Kado and Lui (35) plasmid preparations fromthese five strains and from the plasmid-harboring and plasmid-cured derivatives of C. sakazakii strain BAA-894 were sub-jected to agarose gel electrophoresis to confirm the repA PCRresults (see Fig. S3 in the supplemental material). Except forC. muytjensii E488, four of the five repA PCR-negative strains,as well as the pESA3-cured derivative of C. sakazakii BAA-894, did not harbor a pESA3-like plasmid compared to thewild-type control strain. Similar results were observed for theplasmid-harboring and plasmid-cured derivatives of C. turicen-sis strain z3032 (data not shown). Agarose gel electrophoresisdid show a plasmid band of the appropriate size of pESA3 inC. muytjensii strain E488, most likely indicating that a non-RepFIB-like or a distantly related plasmid of similar size ispresent in this strain.

Detection of Cronobacter species plasmid-borne putative vir-ulence factor genes by PCR. The putative virulence genes orgene clusters and associated conserved flanking regions ofpESA3 and pCTU1 identified from the in silico analysis weretargeted in a PCR plasmid typing or “plasmidotyping” scheme.Specifically, these included the two shared iron acquisition

gene clusters, eitCBAD and iucABCD/iutA, as well as cpa,T6SS, and the FHA loci.

Iron acquisition gene systems. PCR primers derived fromeitA and iucC genes of pESA3/pCTU1 were used to screen forthe presence of the eitCBAD and iucABC/iutA iron acquisitiongene clusters, respectively (Table 1). All 224 plasmid-harbor-ing Cronobacter species strains were PCR positive for eitA;however, only 212 (95%) of these strains were positive for iucC(Table 2). Strains negative for the iucC gene included four C.dublinensis strains (67%) and eight C. muytjensii strains (67%).In accordance with results of the repA PCR assay, we hypoth-esized that the negative results for the iucC PCR target ob-served for strains of C. dublinensis and C. muytjensii are likelyexplained by nucleotide sequence divergence. A large region ofthe iucC gene of C. dublinensis subsp. dublinensis strainLMG23823 was amplified using conserved primers and se-quenced. From this sequence, CdiucC-specific primers weredesigned (Table 1), and these strains were retested. The resultsshown in Table 2 demonstrate that the iucABC/iutA cluster ispresent in the C. muytjensii and C. dublinensis strains previ-ously thought to be negative for the iucABC/iutA cluster, andthey confirm that all RepFIB plasmid-harboring Cronobacterspp. strains possess both iron acquisition gene clusters.

cpa locus. PCR screening using cpa-specific primers (Fig. 3and Table 1) revealed that the majority (173 of 177 [98%]) ofthe C. sakazakii isolates harbor the cpa gene. In addition, thetwo genomospecies group 1 strains were PCR positive for cpa(Table 2). All other Cronobacter species tested were PCR neg-ative for cpa. To confirm these results, a second set of primerswere designed, targeting the conserved flanking regions up-stream and downstream of the cpa locus on both pESA3 andpCTU1 (primers �cpa [Table 1; Fig. 3]). This PCR assay yieldsan amplicon of 303 bp if the cpa gene is absent, as is the casefor pCTU1, and produces a 1,693-bp product if the gene ispresent, as is the case for pESA3 (Fig. 3). The results of the�cpa PCR assay corroborated the results of the cpa PCR assayfor the six C. turicensis, one C. dublinensis, and 18 C. malonati-cus strains. In contrast, three of the four C. sakazakii strainsthat were PCR negative for the cpa gene also failed to producea PCR product when we used the flanking region primers(�cpa), suggesting that the cpa gene is absent in these strainsand that these regions were either deleted, rearranged, or theirnucleotide sequences differed greatly from that of pESA3 and

TABLE 2. Plasmidotype patterns observed for Cronobacter isolates

Species

No. ofisolatesof thespecies

repA

No. of isolates with the indicated plasmidotypea

cpa T6SS FHA Iron acquisition

cpa � cpa Int L vgrG R end Int R � T6SS fhaB � FHA dfhaB eit iuc Cdiuc

C. sakazakii 178 177 (99) 173 (98) 0 (0) 172 (97) 87 (49) 90 (51) 47 (27) 0 (0) 35 (19) 137 (77) 0 (0) 177 (100) 177 (100) 0 (0)C. malonaticus 25 25 (100) 0 (0) 18 (72) 0 (0) 0 (0) 0 (0) 0 (0) 21 (84) 25 (100) 0 (0) 0 (0) 25 (100) 25 (100) 0 (0)C. turicensis 6 6 (100) 0 (0) 6 (100) 0 (0) 1 (16) 0 (0) 0 (0) 3 (50) 6 (100) 0 (0) 0 (0) 6 (100) 6 (100) 0 (0)C. muytjensii 12 9 (75) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 9 (100) 9 (100) 1 (11) 9 (100)C. dublinensis 6 5 (83) 0 (0) 1 (20) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 5 (100) 5 (100) 1 (20) 5 (100)Genomospecies

group 12 2 (100) 2 (100) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 2 (100) 2 (100) 0 (0) 0 (0) 2 (100) 2 (100) 0 (0)

Total 229 224 (97) 175 (78) 25 (11) 172 (76) 87 (38) 87 (38) 47 (20) 26 (11) 69 (30) 137 (61) 14 (6) 224 (100) 212 (95) 14 (6)

a Numbers within parentheses are the percent PCR positive for each gene locus in relation to the total number of plasmid-harboring strains of that species, exceptfor the data for repA, which are in relation to the total number of strains.



http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

pCTU1. The fourth strain, C. sakazakii ATCC 29544, gave anapproximately 500-bp product with the �cpa PCR assay. All ofthe C. muytjensii strains and four of the C. dublinensis strainsdid not produce a product when we used either set of primers.This was true even after efforts were made to reduce the PCRcycle annealing temperatures.

T6SS locus. Due to the large size and known heterogeneityof T6SS gene clusters, four separate PCR assays were designedto characterize this cluster, based on the T6SS genes presenton pESA3 (Table 1 and Fig. 4). The primers for the T6SScluster target VgrG (ESA_pESA3p05500) are specific to theVgrG gene sequence present on pESA3. Furthermore, to as-sess whether the entire T6SS was absent, a fifth PCR assay wasdesigned based on the conserved flanking regions of the T6SSpresent in both pESA3 and pCTU1 (primers �T6SS [Table 1and Fig. 4]). These primers amplify a 471-bp region in pCTU1(lacks the T6SS) and flank the 16,937-bp T6SS region inpESA3, a fragment too large (17,377 bp) to be amplified underthe PCR conditions utilized.

DNA amplification in the T6SS PCR assays revealed that allplasmid-harboring C. malonaticus, C. muytjensii, C. dublinensis,and genomospecies group 1 strains were negative for the fourT6SS targets (Table 2). One strain of C. turicensis, E688, wasPCR positive for vgrG; however, this strain also produced theexpected amplicon when we used the �T6SS primers (Table 2),indicating that the amplified vgrG gene in this strain is locatedin a different T6SS locus, possibly one of the two loci previ-ously described in C. turicensis z3032 which were found on thechromosome.

In contrast, 175 of the 177 (98%) plasmid-harboring C. saka-zakii strains encoded at least a partial T6SS cluster (Table 3),with most strains possessing the 5� region of the cluster (Table2, Int L). Additionally, 87 of the 177 plasmid-harboring C.sakazakii strains (49%) were positive for the T6SS effectorgene vgrG, and 90 (51%) were positive for right side of theT6SS cluster (R end); however, only 47 (27%) were positive forthe right integration site of the T6SS gene cluster (Int R) ofpESA3. Three strains, C. sakazakii ATCC 29544, ES614, andES617, appeared to only possess the 3� region of the T6SSlocus (Table 3). Analysis of the T6SS PCR results for the 177plasmid-harboring strains of C. sakazakii revealed six distinctpatterns (Table 3). Surprisingly, the T6SS PCR pattern asso-ciated with pESA3 was not the most commonly observed pat-

tern; rather, a much-truncated version of the T6SS cluster wasobserved for the majority of the strains. These results suggestthat this region of the plasmid is in great genetic flux, witheither insertions or deletions most likely occurring in 3� regionof the gene cluster, which is further supported by the observedchanges in the G�C content in this region (Fig. 1). To furtherinvestigate the approximate size of the T6SS cluster, a subsetof C. sakazakii strains, which were PCR negative for the 3�region of the T6SS cluster (T6SS R end and/or IntR), weresubjected to long-range PCR analysis using either the �T6SSor the T6SS Int R PCR primers. Results from these experi-ments corroborated that the most common T6SS clusteramong C. sakazakii strains is much smaller than that of pESA3,ranging from 4 to 9 kb in size, and revealed that some T6SSclusters were much longer than that of pESA3, containing anadditional 9 to 12 kb, and may represent an intact Cronobacterspp. RepFIB T6SS (see. Fig. S4 in the supplemental material).

FHA locus. To determine the occurrence of the FHA locusin Cronobacter species RepFIB plasmids, we designed PCRprimers targeting fhaB and the shared regions of pESA3 andpCTU1 flanking the FHA locus (Table 1 and Fig. 5). Primers�FHA flank the 27,421-bp FHA locus in pCTU1 and yield a668-bp amplicon when the locus is absent, as in pESA3. PCRscreening revealed that all six of the C. turicensis strains, bothof the genomospecies group 1 strains, and the 25 C. malonati-cus strains harbored an FHA locus on their RepFIB plasmids(Table 2). Interestingly, 35 C. sakazakii strains (19%) alsopossessed an fhaB gene in addition to the pESA3-specific loci,cpa and T6SS. These results were corroborated by the �FHAPCR assay (Table 2). None of the RepFIB plasmid-harboringstrains of C. dublinensis or C. muytjensii strains yielded anamplicon for either the fhaB or the �FHA locus in standardPCR assays; however, all strains yielded a weak fhaB PCRamplicon when the annealing temperature was lowered. Thecorresponding PCR product from C. dublinensis subsp. dubli-nensis LMG 23823 was sequenced. As expected, these twohomologues were only 86% identical, accounting for the aboveresults. Therefore, new primers were designed that were spe-cific for the C. dublinensis subsp. dublinensis homologue offhaB (primers dfhaB [Table 1]). PCR results using these prim-ers showed that all plasmid-harboring C. dublinensis and C.muytjensii strains were positive for this target (Table 2), indi-cating that C. dublinensis and C. muytjensii RepFIB plasmidspossess an fhaB-like locus, which we named CdfhaB.

Evolution of the putative virulence plasmids in Cronobacterspp. Hierarchical clustering was performed for the eight tar-gets, repA, C. turicensis fhaB (CtfhaB), C. dublinensis fhaB(CdfhaB), cpa, eitA, iucC, C. dublinensis iucC (CdiucC), andT6SS, screened from 224 plasmid-harboring Cronobacter spp.(Fig. 6). The clustering grouped the RepFIB plasmids ofCronobacter spp. into three major clades and revealed a strongcorrelation between plasmidotype and species. Ninety-eightpercent of C. sakazakii strains clustered in clade 1A. Withinthis group, 80% of C. sakazakii strains harbored a plasmidsimilar to pESA3; that is, they contained eit and iuc clusters,cpa, and T6SS, but lacked the FHA locus. However, also foundin this clade were those strains of C. sakazakii (19%) whoseplasmids, in addition to the previously mentioned pESA3 genetargets, also possess an FHA locus. Clade 1B comprises C.malonaticus and C. turicensis. All strains of these species har-

TABLE 3. T6SS patterns observed among 177 RepFIB plasmid-harboring strains of C. sakazakii

No. ofC. sakazakii strainswith T6SS pattern

T6SS Int L vgrG T6SS R end T6SS Int R

2a � � � �2 � � � �1 � � � �85 � � � �1 � � � �39 � � � �47b � � � �

a The two plasmid-harboring C. sakazakii strains that did not contain T6SS lociwere CDC 1059-77 and CDC 4963-71.

b The T6SS PCR pattern of pESA3. Note that 175 of the 177 (98%) plasmid-harboring C. sakazakii strains harbored at least a partial T6SS cluster.



http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

bor RepFIB plasmids with putative virulence traits identical topCTU1; that is, they contain eit and iuc operons and an FHAlocus but lack cpa and the T6SS locus. The two genomospeciesgroup 1 strains were also clustered within clade 1B, possessinga RepFIB plasmid, which is a hybrid of pESA3 and pCTU1,containing the shared eit and iuc operons, as well as cpa andthe FHA locus. Clade 2 contained the RepFIB plasmids of allC. dublinensis and C. muytjensii strains.

All strain information and results have been submittedto the Pathogen Annotated Tracking Resource Network(PATRN), located at http://www.patrn.net (63) and they areavailable to all users after a free registration process.

DISCUSSION

The IncF group of plasmids, harbored by many entericpathogens, consists of eight related replicon designations:RepFIA, RepFIB, RepFIC, RepFIV, RepFV, RepFVI, RepFVII,and RepFIIA (9, 33, 54). IncF plasmids range in size from 1 kbto several hundred kilobases and from 1 copy to several hun-dred copies per cell, with all known members possessing anadditional origin of replication, usually RepFIIA. For example,pCoo and pECOS88 harbored by E. coli strains possess dualcointegrated replication regions, consisting of both RepI1 andRepFIIA replicon sites or RepFIB and RepFIIA replicon sites,respectively (22, 52, 59). In silico analysis showed that Crono-bacter species plasmids pESA3 and pCTU1 have a single rep-licon of the incompatibility group RepFIB. The origin of rep-lication gene has proven to be a useful gene target in thedevelopment of both DNA hybridization-based (14) and PCR-based plasmid classification systems (7), i.e., it is widely ac-cepted that the presence of an origin of replication gene de-tected by PCR is synonymous with the presence of a plasmid ofthat incompatibility group (7, 50). PCR analysis using primersderived from the repA genes of pESA3 and pCTU1 indicatedthat most Cronobacter spp. harbor a homologous RepFIB plas-mid. The exception to this, on a species level, is C. muytjensii,

for which only 75% of the strains tested were positive for therepA gene. The high prevalence of these plasmids in Crono-bacter spp. supports the hypothesis that these plasmids play animportant role in these bacteria.

Iron is an essential microelement for bacteria (15, 23). It isrequired as a cofactor for important enzymes involved in manyfundamental cellular processes, including electron transfer,cellular respiration, and superoxide metabolism. Iron is also animportant factor for bacterial pathogenesis (6, 49, 66). As partof the innate immune system, human hosts limit iron availabil-ity via iron-binding proteins in order to reduce the level of freeiron to levels that will not support bacterial growth. A patho-gen’s ability to acquire iron from its host during infection iscrucial for successful pathogenesis. Under iron starvationgrowth conditions, bacteria produce high-affinity iron-bindingmolecules, such as siderophores, to scavenge iron from theirenvironment. The iron-siderophore complexes are transportedinto bacteria by specific iron transport systems. Most irontransport systems consist of an outer membrane receptor, aperiplasmic binding protein, and an ABC transporter formedby permease and ATPase proteins (19, 39). Plasmids pESA3and pCTU1 contain two clusters of genes, a homologue of anABC transport-mediated iron uptake and siderophore system(eitCBAD operon) and a siderophore-mediated iron acquisi-tion system (iucABCD/iutA operon). In the present study, wesuccessfully cured pESA3 and pCTU1 and we showed thatboth plasmids, but not the BAA-894 or z3032 chromosomes,encode active siderophores. Further, our PCR results showedthat all Cronobacter species RepFIB plasmids contain both theeitCBAD and iucABCD/iutA iron acquisition operons. Theseresults suggest that presence of these plasmids may be crucialfor systemic survival of Cronobacter spp. in a host.

The Cronobacter species RepFIB plasmids have evolved byacquisition, or deletion, of a number of putative species-spe-cific virulence traits, including the cpa gene as well as the T6SSand FHA locus. Hierarchical clustering of the PCR results(Fig. 6) targeting the various plasmid virulence traits revealed

FIG. 6. Hierarchical clustering of PCR prevalence results for 8 plasmids traits screened from among 224 Cronobacter species isolates. A positivePCR is indicated by a score of 1, and a negative reaction is indicated by a 0. A PCR-positive result of at least one of the targets of the T6SS wasconsidered positive for the group as a whole. Cluster analysis was performed using the unweighted pair group method with arithmetic mean(UPGMA) found in the Bionumerics software suite of programs (Applied Maths, Inc., Austin, TX). The percentage of strains positive for eachsubgroup was rounded to the nearest whole number.



http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

that the Cronobacter species group as clades, and the clusteringresults are in agreement with previous phylogenetic clusteringresults based on chromosomal targets, namely, 16S rRNA (28,29), and genomic DNA microarray results as described byHealy et al. (25). Acquisition of these virulence traits, in somecases, appears to be species specific, for example, the T6SS onplasmids of C. sakazakii, suggesting recent acquisition. Con-versely, the distribution of the FHA locus, which is present in100% of Cronobacter spp. except C. sakazakii (19% presence),suggests a loss of this locus by most strains of C. sakazakii. Theevolutionary history of the cpa gene is less clear; the distribu-tion of the gene locus among the strains of Cronobacter spp.used in this study suggests that the gene was acquired on theRepFIB plasmids of C. sakazakii and genomospecies group 1as separate events. Taken together, we hypothesize that theancestral Cronobacter species RepFIB plasmid possessed theeit and iuc operons, as well as the FHA locus, plasmidotypecharacteristics of current C. turicensis and C. malonaticusstrains.

Interestingly, RepFIB virulence plasmids pLVPK of Kleb-siella pneumoniae, pECOS88 from E. coli, and pAPEC-01-colBM and pAPEC-02-colV from avian pathogenic E. coli, inaddition to possessing a common repA also contain one or bothiron acquisition operons present on the RepFIB Cronobacterplasmids (9, 33, 52). Furthermore, similar to pESA3, plasmidspECOS88 and pAPEC-01-colBM contain a gene homologousto cpa (33, 52). Apparently, these virulence plasmids andCronobacter species RepFIB plasmids have evolved from acommon ancestor, and the repA gene and the eitCBAD (eit-ABCD) and iucABCD/iutA iron acquisition operons remain aspart of the archetypical backbone of these plasmids.

Phylogenetic cluster analysis based on the nucleotide se-quence of the repA gene supports the hierachical clustering ofthe plasmid virulence target PCR results. As before, C. dubli-nensis and C. muytjensii formed a separate clade (clade 2)within the cluster of the Cronobacter species (Fig. 2). The highvariability in the repA sequence between the Cronobacter spe-cies, compared to E. coli and Y. pestis, suggests that theseplasmids were acquired long ago in the evolutionary history ofthe genus Cronobacter. The correlations of plasmidotype andrepA sequence with each species suggests that these plasmidshave evolved independently in each species. Results of themating experiments confirmed that these RepFIB plasmids arenot mobilizable by conjugative plasmids present in the samestrain.

With regard to the T6SS gene cluster found on the RepFIBplasmids of the C. sakazakii strains used in this study, weobserved considerable variation (Table 3). Indeed, the T6SSgene cluster represented by the gene architecture encoded onpESA3 was not the most common type observed. These resultssupport the observations by Boneman et al. (4) and others (5)that among enteric Gram-negative bacteria, significant vari-ability in T6SS gene architecture exists. Recently, Jani andCotter (31) described three roles that T6SSs may play duringhost-microbe interactions: (i) T6SSs act as a delivery system ofeffector proteins, e.g., Hcp1, VgrG, and other toxins (31, 44,45); (ii) T6SSs act as a host immune modulation system; (iii)T6SSs may influence interbacterial interactions and relation-ships within a host. Although the role of the T6SS in C. saka-zakii is currently not known, studies with Helicobacter hepaticus

and S. enterica serovar Typhimurium, reported by Chow andMazmanian (10) and Parsons and Heffron (51), respectively,suggest that infections with wild-type strains of these organismslead to a milder inflammatory response and less colonizationthan that with their T6SS isogenic mutants, which were foundto cause an increased host inflammatory response and couldcolonize host systems better than isogenic wild-type strains. Itis intriguing that most C. sakazakii strains harbor a plasmid-borne T6SS gene cluster that is reduced in size (Table 3).Without T6SS core components these strains may naturallysupercolonize host environments, causing a greater proinflam-matory response. Studies are under way in our laboratory tounderstand the critical size needed for full functionality of theT6SS cluster in Cronobacter spp. in comparison to T6SS clus-ters of other enteric pathogens.

Although there are examples of isolates obtained from clin-ical sources in all of the species groups analyzed in this study,except for the genomospecies group 1, we did not observe anycorrelation between source, clinical relevance, and plasmid-otype. However, better surveillance and epidemiological stud-ies combined with functional studies of the various putativevirulence factors are needed.

Two important evolutionary points can be deduced from theresults of this study: that these plasmids have evolved in asimilar way as the chromosomal genome of the Cronobacterspecies and that C. dublinensis and C. muytjensii strains (clade2) have diverged significantly from the other species to a pointat which PCR primers designed from pESA3 and pCTU1 nu-cleotide sequences will not anneal to homologous genes thatare not highly conserved. This is supported by the fact that allC. dublinensis and C. muytjensii strains were fhaB and iucCpositive only when specific primers derived from C. dublin-ensis CdfhaB and CdiucC were used. This conclusion wouldexplain the negative results observed for both the cpa geneand T6SS locus, given that a binary opposition strategy wasused (Table 1).

Recently, we demonstrated that Cpa, encoded by pESA3,provides serum resistance to C. sakazakii BAA-894 by proteo-lytically cleaving complement components, as well as the acti-vation of the human proenzyme plasminogen to plasmin andthe inactivation of the plasmin inhibitor �2-AP (21). In thecurrent studies, we demonstrated the functionality of the iucsiderophore acquisition system encoded on pESA3 andpCTU1. Together, these properties may contribute to the sys-temic survival of C. sakazakii and subsequent invasion of thecentral nervous system to cause disease.

In conclusion, we have demonstrated that pESA3 andpCTU1 encode active siderophores, and in silico analysis haveshown that these plasmids encode other potential virulencefactors, including Cpa, a T6SS, and a filamentous hemaggluti-nin. A repA-targeted PCR assay revealed that most Cronobac-ter species strains harbor a homologous RepFIB-like plasmid,and hierarchical clustering of virulence factor PCR assay re-sults combined with phylogenetic analysis of repA sequencesdemonstrated a strong correlation between the RepFIB-likeplasmid type, or “plasmidotype,” with specific Cronobacterspp., suggesting that these nonmobile plasmids were acquiredlong ago and have coevolved with each of the different speciesin a fashion similar to their chromosomal genomes. Further,our results support the hypothesis that these plasmids have



http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

evolved from an ancestral plasmid whose elements persist inthe form of conserved backbone genes and gene clusters, suchas the eitCBAD and iucABCD/iutA iron acquisition systems, yethave evolved through the cointegration of virulence traits thatmay be essential for and specific to the respective pathotypes ofeach species. Clearly, representative RepFIB plasmids frommore Cronobacter spp. need to be sequenced and compared tofurther corroborate or refute these conclusions. The currentstudy provides significant new insights into the contribution ofpESA3 and closely related pCTU1 in the virulence of Crono-bacter spp. Furthermore, this study also helps in understandingthe molecular evolution of these plasmids in Cronobacter spe-cies strains.

ACKNOWLEDGMENTS

When this study started, L. Hu was an FDA Commissioner’s Fellow;she is now an Oak Ridge Institute for Science and Education (ORISE)fellow. K. G. Jarvis and C. J. Grim are also ORISE fellows, and wethank the FDA’s Office of the Commissioner and the Department ofEnergy for their support. We also thank the Joint Institute of FoodSafety and Applied Nutrition Internship and Washington InternshipPrograms for the support of undergraduate students J. Sadowski, C.Lee, and J. Kim, respectively.

Lastly, we thank M. Kotewicz for critically reading the manuscriptand for offering helpful comments.

REFERENCES

1. Arai, H., and Y. Sato. 1976. Separation and characterization of two distincthemagglutinins contained in purified leukocytosis-promoting factor fromBordetella pertussis. Biochem. Biophys. Acta 444:765–782.

2. Biering, G., et al. 1989. Three cases of neonatal meningitis caused by En-terobacter sakazakii in powdered milk. J. Clin. Microbiol. 27:2054–2056.

3. Bogard, R. W., and J. D. Oliver. 2007. Role of iron in human serum resis-tance of the clinical and environmental Vibrio vulnificus genotypes. Appl.Environ. Microbiol. 73:7501–7505.

4. Bonemann, G., A. Pietrosiuk, A. Diemand, H. Zentgraf, and A. Mogk. 2009.Remodeling of VipA/VipB tubules by ClpV-mediated threading is crucialfor type VI protein secretion. EMBO J. 28:315–325.

5. Boyer, F., G. Fichant, J. Berthod, Y. Vandenbrouck, and I. Attree. 2009.Dissecting the bacterial type VI secretion system by a genome wide in silicoanalysis: what can be learned from available microbial genomic resources?BMC Genomics 10:104.

6. Calderwood, S. B., and J. J. Mekalanos. 1987. Iron regulation of Shiga-liketoxin expression in Escherichia coli is mediated by the fur locus. J. Bacteriol.169:4759–4764.

7. Carattoli, A., et al. 2005. Identification of plasmids by PCR-based replicontyping. J. Microbiol. Methods 63:219–228.

8. Centers for Disease Control and Prevention. 2002. Enterobacter sakazakiiinfections associated with the use of powdered infant formula—Tennessee.MMWR Morb. Mortal. Wkly. Rep. 51:297–300.

9. Chen, Y. T., et al. 2004. Sequencing and analysis of the large virulenceplasmid pLVPK of Klebsiella pneumoniae CG43. Gene 337:189–198.

10. Chow, J., and S. K. Mazmanian. 2010. A pathobiont of the microbiotabalances host colonization and intestinal inflammation. Cell Host Microbe7:265–276.

11. Chu, C., and C.-H. Chiu. 2006. Evolution of the virulence plasmids ofnon-typhoid Salmonella and its association with antimicrobial resistance.Microbes Infect. 8:1931–1936.

12. Chun, J., A. Huq, and R. R. Colwell. 1999. Analysis of 16S-23S rRNAintergenic spacer regions of Vibrio cholerae and Vibrio mimicus. Appl. Envi-ron. Microbiol. 65:2202–2208.

13. Clark, N. C., B. C. Hill, C. M. O’Hara, O. Steingrimsson, and R. C. Cooksey.1990. Epidemiologic typing of Enterobacter sakazakii in two neonatal noso-comial outbreaks. Diagn. Microbiol. Infect. Dis. 13:467–472.

14. Couturier, M., F. Bex, P. L. Bergquist, and W. K. Mass. 1988. Identificationand classification of bacterial plasmids. Microbiol. Rev. 52:375–395.

15. Crosa, J. H., and C. T. Walsh. 2002. Genetics and assembly line enzymologyof siderophore biosynthesis in bacteria. Microbiol. Mol. Biol. Rev. 66:223–249.

16. Datta, N., and R. W. Hedges. 1971. Compatibility groups among fi-R factors.Nature 234:222–223.

17. Donnenberg, M. S., and J. B. Kaper. 1991. Construction of an eae deletionmutant of enteropathogenic Escherichia coli by using a positive-selectionsuicide vector. Infect. Immun. 59:4310–4317.

18. Drudy, D., et al. 2006. Characterization of a collection of Enterobacter saka-zakii isolates from environmental and food sources. Int. J. Food Microbiol.110:127–134.

19. Faraldo-Gomez, J. D., and M. S. Sansom. 2003. Acquisition of siderophoresin Gram-negative bacteria. Nat. Rev. Mol. Cell Biol. 4:105–116.

20. Farmer, J. J., III, M. A. Asbury, F. W. Hickman, D. J. Brenner, and theEnterobacteriaceae Study Group. 1980. Enterobacter sakazakii: a new speciesof “Enterobacteriaceae” isolated from clinical specimens. Int. J. Syst. Bacte-riol. 30:569–584.

21. Franco, A. A., et al. 2011. Cpa, the outer membrane protease of Cronobactersakazakii, activates plasminogen and mediates resistance to serum bacteri-cidal activity. Infect. Immun. 79:1578–1587.

22. Froehlich, B., J. Parkhill, M. Sanders, N. A. Quail, and J. R. Scott. 2005. ThepCoo plasmid of enterotoxigenic Escherichia coli is a mosaic cointegrate. J.Bacteriol. 187:6509–6516.

23. Griffiths, E. 1999. Iron in biological systems, p. 1–26. In J. Bullen and E.Griffiths (ed.), Iron and infection. Wiley, Chichester, United Kingdom.

24. Gupta, S. D., H. C. Wu, and P. D. Rick. 1997. A Salmonella typhimuriumgenetic locus which confers copper tolerance on copper-sensitive mutants ofE. coli. J. Bacteriol. 179:4977–4984.

25. Healy, B., et al. 2009. Microarray-based genomic indexing of the Cronobactergenus (Enterobacter sakazakii). Int. J. Food Microbiol. 136:159–164.

26. Himelright, I., E. Harris, V. Lorch, and M. Anderson. 2002. Enterobactersakazakii infections associated with the use of powdered infant formula—Tennessee, 2001. JAMA 287:2204–2205.

27. Hritonenko, V., and C. Stathopoulos. 2007. Omptin proteins: an expandingfamily of outer membrane proteases in Gram-negative Enterobacteriaceae.Mol. Membr. Biol. 24:395–406.

28. Iversen, C., M. Waddington, J. J. Farmer, and S. J. Forsythe. 2006. Thebiochemical differentiation of Enterobacter sakazakii genotypes. BMC Mi-crobiol. 6:94.

29. Iversen, C., et al. 2008. Cronobacter gen. nov., a new genus to accommodatethe biogroups of Enterobacter sakazakii, and proposal of Cronobacter saka-zakii gen. nov., comb. nov., C. malonaticus sp. nov., C. turicensis sp. nov., C.muytjensii sp. nov., C. dublinensis sp. nov., Cronobacter genomospecies 1, andof three subspecies, C. dublinensis sp. nov. subsp. dublinensis subsp. nov., C.dublinensis sp. nov. subsp. lausannensis subsp. nov., and C. dublinensis sp.nov. subsp. lactaridi subsp. nov. Int. J. Sys. Evol. Microbiol. 58:1442–1447.

30. Jacob-Dubuisson, F., C. Locht, and R. Antoine. 2001. Two-partner secretionin Gram-negative bacteria: a thrifty, specific pathway for large virulenceproteins. Mol. Microbiol. 40:306–313.

31. Jani, A., and P. A. Cotter. 2010. Type VI secretion: not just for pathogenesisanymore. Cell Host Microbe 8:2–6.

32. Jaradat, Z. W., Q. O. Ababneh, I. M. Saadoun, N. A. Samara, and A. M.Rashdan. 2009. Isolation of Cronobacter spp. (formerly Enterobacter saka-zakii) from infant food, herbs and environmental samples and the subse-quent identification and confirmation of the isolates using biochemical, chro-mogenic assays, PCR and 16S rRNA sequencing. BMC Microbiol. 9:225.

33. Johnson, T. J., and L. K. Nolan. 2009. Pathogenomics of the virulenceplasmids of Escherichia coli. Microbiol. Mol. Biol. Rev. 73:750–774.

34. Juhas, M., D. W. Crook., and D. W. Hood. 2008. Type IV secretion systems:tools of bacterial horizontal gene transfer and virulence. Cell. Microbiol.10:2377–2386.

35. Kado, C. I., and S. T. Liu. 1981. Rapid procedure for detection and isolationof large and small plasmids. J. Bacteriol. 145:1365–1373.

36. Kandhai, M. C., M. W. Reij, L. G. Gorris, O. Guillaume-Gentil, and M. vanSchothorst. 2004. Occurrence of Enterobacter sakazakii in food productionenvironments and households. Lancet 363:39–40.

37. Kaper, J. B., J. P. Nataro, and H. L. Mobley. 2004. Pathogenic Escherichiacoli. Nat. Rev. Microbiol. 2:123–140.

38. Kleiman, M. B., S. D. Allen, P. Neal, and J. Reynolds. 1981. Meningoen-cephalitis and compartmentalization of the cerebral ventricles caused byEnterobacter sakazakii. J. Clin. Microbiol. 14:352–354.

39. Koster, W. 2001. ABC transporter-mediated uptake of iron, siderophores,heme and vitamin B12. Res. Microbiol. 152:291–301.

40. Kothary, M. H., B. A. McCardell, C. D. Frazar, D. Deer, and B. D. Tall. 2007.Characterization of the zinc-containing metalloprotease (zpx) and develop-ment of a species-specific detection method for Enterobacter sakazakii. Appl.Environ. Microbiol. 73:4142–4151.

41. Kucerova, E., et al. 2010. Genome sequence of Cronobacter sakazakii BAA-894 and comparative genomic hybridization analysis with other Cronobacterspecies. PLoS One 5:e9556.

42. Kukkonen, M., et al. 2001. Protein regions important for plasminogen acti-vation and inactivation of �2-antiplasmin in the surface protease Pla ofYersinia pestis. Mol. Microbiol. 40:1097–1111.

43. Kukkonen, M., and T. K. Kornhonen. 2004. The omptin family of entero-bacterial surface proteases/adhesins: from housekeeping in Escherichia colito systemic spread in Yersina pestis. Int. J. Med. Microbiol. 294:7–14.

44. Ma, A. T., S. McAuley, S. Pukatzki, and J. J. Mekalanos. 2009. Translocationof a Vibrio cholerae Type VI secretion effector requires bacterial endocytosisby host cells. Cell Host Microbe 5:234–243.

45. Ma, A. T., and J. J. Mekalanos. 2010. In vivo actin cross-linking induced by



http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

Vibrio cholerae type VI secretion system is associated with intestinal inflam-mation Proc. Natl. Acad. Sci. U. S. A. 107:4365–4370.

46. Mellata, M., J. W. Touchman, and R. Curtiss III. 2009. Full sequence andcomparative analysis of the plasmid pAPEC-1 of avian pathogenic E. coliX7122 (O78:K80:H9). PLoS One 4:e4232.

47. Muytjens, H. L., et al. 1983. Analysis of eight cases of neonatal meningitisand sepsis due to Enterobacter sakazakii. J. Clin. Microbiol. 18:115–120.

48. Nazarowec-White, M., and J. M. Farber. 1997. Enterobacter sakazakii: areview. Int. J. Food Microbiol. 34:103–113.

49. Negre, V. L., et al. 2004. The siderophore receptor IroN, but not the high-pathogenicity island or the hemin receptor ChuA, contributes to the bacte-remic step of Escherichia coli neonatal meningitis. Infect. Immun. 72:1216–1220.

50. Novick, R. P. 1987. Plasmid incompatibility. Microbiol. Rev. 51:381–395.51. Parsons, D. A., and F. Heffron. 2005. sciS, an icmF homolog in Salmonella

enterica serovar Typhimurium, limits intracellular replication and decreasesvirulence. Infect. Immun. 73:4338–4345.

52. Peigne, C., et al. 2009. The plasmid of Escherichia coli strain S88 (O45:K1:H7) that causes neonatal meningitis is closely related to avian pathogenic E.coli plasmids and is associated with high level bacteremia in a neonatal ratmeningitis model. Infect. Immun. 77:2272–2284.

53. Ramu, P., et al. 2007. The surface protease PgtE of Salmonella entericaaffects complement activity by proteolytically cleaving C3b, C4b and C5.FEBS Lett. 581:1716–1720.

54. Saul, D., et al. 1989. Nucleotide sequence and replication characteristics ofRepFIB, a basic replicon of IncF plasmids. J. Bacteriol. 171:2697–2707.

55. Schwyn, B., and J. B. Neilands. 1987. Universal chemical assay for thedetection and determination of siderophores. Anal. Biochem. 160:47–56.

56. Shin, S. H., Y. Lim, S. E. Lee, N. W. Yang, and J. H. Rhee. 2001. CAS agardiffusion assay for the measurement of siderophores in biological fluids. J.Microbiol. Methods 44:89–95.

57. Simmons, B. P., M. S. Gelfand, M. Haas, L. Metts, and J. Ferguson. 1989.Enterobacter sakazakii infections in neonates associated with intrinsic con-tamination of powdered infant formula. Infect. Control Hosp. Epidemiol.10:398–401.

58. Smith, H. W., and S. Halls. 1967. Studies on Escherichia coli enterotoxin.J. Pathol. Bacteriol. 93:531–543.

59. So, M., H. W. Boyer, M. Betlach, and S. Falkow. 1976. Molecular cloning ofan Escherichia coli plasmid determinant than encodes for the production ofheat-stable enterotoxin. J. Bacteriol. 128:463–472.

60. Sodeinde, O. A., and J. D. Goguen. 1989. Nucleotide sequence of the plas-minogen activator gene of Yersinia pestis: relationship to ompT of Escherichiacoli and gene E of Salmonella typhimurium. Infect. Immun. 57:1517–1523.

61. Stephan, R., A. Lehner, P. Tischler, and T. Rattei. 2011. Complete genomesequence of Cronobacter turicensis LMG 23827, a food-borne pathogen caus-ing deaths in neonates. J. Bacteriol. 193:309–310.

62. Stoop, B., A. Lehner, C. Iversen, S. Fanning, and R. Stephan. 2009. Devel-opment and evaluation of rpoB based PCR systems to differentiate the sixproposed species within the genus Cronobacter. Int. J. Food Microbiol.136:165–168.

63. Tall, B. D., et al. 2010. Development and application of a Pathogen Anno-tated Tracking Resource Network (PATRN) system to aid analysis of food-borne pathogens, abstr. R-2447. Abstr. 110th Gen. Meet. Am. Soc. Micro-biol. American Society for Microbiology, Washington, DC.

64. Tamura, K., M. Nei, and S. Kumar. 2004. Prospects for inferring very largephylogenies by using the neighbor-joining method. Proc. Natl. Acad. Sci.U. S. A. 101:11030–11035.

65. Tamura, K., J. Dudley, M. Nei, and S. Kumar. 2007. MEGA4: MolecularEvolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol.Evol. 24:1596–1599.

66. Torres, A. G., P. Redford, R. A. Welch, and S. M. Payne. 2001. TonB-dependent systems of uropathogenic Escherichia coli: aerobactin and hemetransport and TonB are required for virulence in the mouse. Infect. Immun.69:6179–6185.

67. Urmenyi, A. M., and A. White-Franklin. 1961. Neonatal death from pig-mented coliform infection. Lancet i:313–315.

68. van Acker, J., et al. 2001. Outbreak of necrotizing enterocolitis associatedwith Enterobacter sakazakii in powdered milk formula. J. Clin. Microbiol.39:293–297.



http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

characterization of putative virulence genes on the related … · cronobacter species nomenclature...

Documents