Characterization of the putative surface protein TLP in Plasmodium bergheiand Plasmodium falciparum

Ryan M Harrison1,2, Cristina K Moreria3, Catherine Lavazec3, Thomas J Templeton3

1 Gateways to the Laboratory Program, Weill Cornell/ Rockefeller/Sloan-Kettering Tri-Institutional MD-PhD Program, New York, NY

2 Department of Biomedical Engineering, Johns Hopkins University, Baltimore, MD3 Department of Immunology and Microbiology, Weill Cornell Medical College, New York, NY

Malaria, a complex illness caused by the protozoan parasite Plasmodium, is an endemic diseasethat is responsible for approximately a half billion human infections and over two million deathsper year. Development of a potent malaria vaccine will be supported by a broader fundamentalunderstanding of Plasmodium on both a molecular and cellular level. We intend to characterizethe TRAP-Like Protein (TLP), a recently discovered putative surface protein conserved acrossmultiple Plasmodium species. Due to TLP’s domain homology with Thrombospondin RelatedAdhesive Protein (TRAP), Circumsporozoite Protein (CSP) and Circumsporozoite-TRAP-Related Protein (CTRP), TLP is suspected to be involved in host cell recognition and invasion.

The lifecycle stage of expression for TLP was determined by Quantitative Real-Time PCRanalysis on wild type and TLP knockout cDNA from eight discrete time points in both P.berghei and P. falciparum. This analysis revealed that TLP is predominantly expressed inmosquito salivary gland sporozoites. To assess the function of TLP, knockout lines of P.falciparum were created by gene disruption. Knockout lines of P. berghei were obtained fromthe Leiden Malaria Research Group at Leiden University Medical Center. The gene disruption inboth P. falciparum and P. berghei was confirmed via diagnostic PCR. Southern blotcorroboration of the gene disruption, immunofluorescence assays and hepatocyte invasion assaysare in progress.

Key Words: Malaria, Plasmodium falciparum, Plasmodium berghei, TLP

Introduction

Epidemiology of Malaria

In terms of social and economic impact, malaria is by far one of the most devastating human

diseases. Afflicting approximately a half billion people annually, malaria is a pervasive and

endemic problem in many areas of the developing world (Guinovart et al., 2006). According to

the Centers for Disease Control, forty-one percent of the global population lives in areas at risk

for malaria transmission (Figure 1). Every year, over two million people die of malaria;

approximately 90% of these fatalities occur in sub-Saharan Africa. (Greenwood & Mutabingwa,

2002).

Figure 1: Global Distribution of Malaria

Malaria is an endemic disease afflicting approximately a half billion people per year. Areas where malariatransmission occurs are highlighted in dark green. Areas with limited risk of malaria are highlighted in lightgreen. Due to effective malaria eradication programs in the United States and Europe, today malaria is limited totropical and subtropical regions such as sub-Saharan Africa, the Amazon, South Asia and Southeast Asia.

WHO, 2002

While effective treatment options are widespread and relatively affordable by Western standards,

many populations, particularly in Africa and Southeast Asia, are unable to obtain the necessary

medication and treatment. Moreover, the economic and political instability in many malaria

endemic areas hinders drug distribution and malaria transmission prevention measures (Sachs &

Malaney, 2002).

Malaria is caused by the protozoan parasite Plasmodium. Of the many Plasmodium species, only

four species (P. falciparum, P. vivax, P. ovale and P. malariae) infect humans. The transmission

vector for the Plasmodium parasite is the Anopheles mosquito. In terms of malaria infectivity

rates, Anopheles gambiae mosquitoes, the primary transmission vector in sub-Saharan Africa, is

by far the most common transmission vectors to humans. In the past century, mosquito

population control measures have effectively eradicated malaria in the United States, Europe and

the rest of the developed world. While mosquito population control and anti-malarial drugs, such

as chloroquine, are currently effective preventative and treatment measures to malaria,

insecticide and drug resistance strains are developing in many parts of the world. To date, there

is no effective vaccine against Plasmodium and malarial infection.

Plasmodium Pathology

Plasmodium, the protozoan parasite responsible for malaria infections, has a diverse life cycle

spanning asexual and sexual stages in both its mosquito vectors and animal host (Miller et al.,

2002). The asexual life cycle stages occur largely in the vertebrate host, while the sexual stages

occur largely in the mosquito vector (Figure 2).

The primary clinical symptoms of human malaria are tertian or quartan fevers and anemia

(Miller et al., 2002). Fevers are caused by the synchronous rupture of schizonts, which release

between 8 and 64 merozoites into the host blood stream, depending on Plasmodium species.

Anemia is caused by the loss of healthy erythrocytes to lyses and parasite invasion. Secondary,

and more fatal, symptoms of malaria are due to the trafficking of large non-specific adhesive

proteins such as PfEMP-1 (Erythrocyte Membrane Protein), to the erythrocyte cell surface

Figure 2: Overview of the Plasmodium Life Cycle

Plasmodium, the protozoan parasite responsible for malaria, has an extremely complex life cycle in both itsvertebrate host and mosquito vector. Beginning its asexual life cycle with sporozoite entry from the mosquitosalivary glands, the parasite migrates to the host liver where it selectively invades hepatocytes. Upon thePlasmodium induced rupture of an infected hepatoocyte, thousands of merozoites, an erythrocyte infective stage,are released into the blood stream. Eventually, a handful of merozoite invaded erythrocytes will differentiate intogametocytes beginning the sexual stages. If ingested by a mosquito, these gametocytes will fertilize and developin the mosquito mid gut, eventually returning to the mosquito salivary glands as sporozoites.

“Malaria” Encyclopedia of Life Sciences

(Fairhurst et al. 2005, Fairhurst et al. 2006, Templeton et al., 2005). These adhesive domains

help lodge the infected erythrocyte within the microvasculature, preventing parasite detection

and destruction in the spleen. Potentially fatal organ failure can occur when these obstructions

and occlusions become widespread, as is common in the liver, kidneys, brain and placenta

(Miller et al., 2002).

Conserved adhesive domains mediate Plasmodium host cell invasion

At certain stages of the Plasmodium life cycle (sporozoite, merozoite and ookinte stages), the

parasite must seek out new host cells. Like all members of the phylum Apicomplexa,

Plasmodium has an apical complex, a specialized system designed to promote invasion of host

cells. Conserved apical complex organelles include microtubules, micronemes, a polar ring and

rhoptries. The process of host cell recognition and invasion is regulated by a complex set of

proteins and protein interactions. Although many proteins suspected to be involved in host cell

recognition and invasion remain uncharacterized, CSP (Circumsporozoite Protein), TRAP

(Thrombospondin Related Adhesive Protein) and CTRP (Circumsporozoite-TRAP Related

Protein) are characterized examples of invasion mediating proteins (Dessens et al., 1999; Kaneko

et al., 2006; Wengelnik et al., 1999; Yuda et al., 1999).

CSP and TRAP are large multidomain adhesive proteins expressed during the sporozoite life

cycle stage. TRAP contains conserved von Willebrand Factor A (vWFA) domains,

thrombospondin type I repeat (TSP) domains and a single transmembrane spanning helix capped

by a conserved tryptophan (Wengelnik et al., 1999); CSP contains TSP and transmembrane

domains (Figure 3). CSP is localized to the parasite surface while TRAP is localized both in the

micronemes and on the parasite surface. CSP adheres to the hepatocyte membrane, allows the

sporozoite to reorient such that the apical complex comes into contact with the target cell. A tight

junction is then formed between the apical complex polar ring the hepatocye membrane. TRAP

is released when micronemes discharge into junction. Beyond its involvement in the formation of

the tight junction and sporozoite motility, the exact mechanism by which TRAP acts remains

unknown. Notably, when either CSP or TRAP is disrupted, sporozoite motility and invasive

capability are reduced but not eliminated (Wengelnik et al., 1999).

CTRP, a protein involved in ookinete invasion, has similar vWFA, TSP, and single

transmembrane spanning helix motifs as CSP and TRAP. In fact, CTRP is essential for ookinete

invasion and the formation of oocyst. When CTRP is disrupted, ookinetes develop normally, but

oocysts do not develop in the mosquito mid gut (Dessens et al, 1999; Yuda et al., 1999).

TLP shares conserved adhesive domains with CSP, TRAP and CTRP

Basic science research to elucidate the fundamental cellular and molecular mechanics of

Plasmodium and its host and vector interactions will greatly support the development of more

effective treatments and an effective malaria vaccine. With the recent release of the Plasmodium

genome, new proteins are constantly being discovered that may play a role in sporozoite and

TRAPvWFA TSP REP Cy TRAPvWFA TSP REP Cy

CTRPvWFA TSPTSPTSP TSPTSPTSPTSPvWFAvWFAvWFAvWFAvWFA Cy CTRPvWFA TSPTSPTSP TSPTSPTSPTSPvWFAvWFAvWFAvWFAvWFA Cy

TLPvWFA vWFATSP Cy TLPvWFA vWFATSP Cy

Figure 3: CSP, TRAP, CTRP and TLP contain conserved adhesive domains

CSP, TRAP and CTRP, proteins known to mediate Plasmodium host cell invasion, have two conserved adhesivedomains: von Willebrand factor A (vWFA) domains and thrombospondin type I repeat (TSP) domains. Due todomain homology with these proteins, TSP is hypothesized to have a similar invasive function.

ookinete invasion pathways (Gardner et al., 2002). TLP (TRAP-Like Protein), a recently

discovered and completely uncharacterized protein, shares conserved TSP and vWFA adhesive

domains with CSP, TRAP and CTRP (Figure 3) (Hayward et al., 2000). Characterization of TLP

will be necessarily to elucidate the significance of this domain homology. In order to further our

understanding of TLP, and thereby Plasmodium in general, we intend to determine the life cycle

stage in which TLP is expressed. Due to TLP’s domain homology to CSP, TRAP and CTRP, all

characterized proteins involved in host cell invasion, we hypothesis that TLP might be primarily

expressed in an invasive stage such as the sporozoite, merozoite or ookinete. We will also

prepare gene disrupted knockouts for use in invasion assays. These assays will be used to

determine the extent to which TLP is involved in host cell recognition and invasion by

comparing TLP-knockout infectivity to wild type infectivity.

Methods

Plasmodium Parasites

P. falciparum NF54 strain gametocyte cultures were maintained for both wild type and TLP

knockout parasites. Wild type and TLP knockout cultures were kept at a constant temperature of

37oC to prevent premature gametocyte exflagellation. Cultures were fed daily with complete

RPMI/human serum media. Pyrimethamine was added to TLP knockout media to positively

select for gene disrupted parasites (TLP gene was disrupted with a cassette containing a gene for

Pyrimethamine resistance). One culture was maintained at less than 2% parasitemia by a 1:20

dilution every three to four days. This provided several gametocyte cultures three to four days

apart from each other. Parasitemia and gametocytemia was checked on day three, ten and

fourteen via Giemsa staining. If no gametocytes were present by day ten, the culture was

discarded. After day fourteen, exflagellation assays were conducted to determine whether to

proceed with mosquito infection. If not used for mosquito infection or genomic DNA extraction

by day seventeen, the culture was discarded.

P. berghei ANKA strain was cultured in mice. Parasitemia and gametocytemia were checked

daily from blood extracted from the tail vein. Mice were sacrificed to provide infected blood for

mosquito infections and genomic DNA extraction via tail vein bleeding.

Gene Disruption

TLP knockout P. falciparum parasites were generated by transforming erythrocytes with a

pHHT-TK plasmid containing DHFR (Duraisingh et al., 2002), a gene for pyrimethamine

resistance, via electroporation. These transected erythrocytes were then infected with P.

falciparum NF54 (Deitsh et al., 2001). TLP knockout P. berghei ANKA was generously donated

by the Leiden Malaria Research Group at Leiden University Medical Center in the Netherlands.

Erythrocytes infected with P. falciparum were transformed with a pHHT-TK plasmid containing

DHFR, a gene for pyrimethamine resistance, via electroporation. Cultures were then treated with

pyrimethamine to select for parasites with the integrated cassette. After a recovery time of up to

one month, transformed parasite clones were isolated by dilution cloning, where cultures were

added to a 96 well plate at a concentration of less than one parasite per well. After an additional

three weeks, plates were assays for live parasites with MALSTAT. Single clonal populations

were obtained from wells testing positive for Plasmodium. The population 7Fb from the NF54

strain was used as the primary TLP knockout for P. falciparum.

Diagnostic PCR

P. falciparum and P. berghei genomic DNA were isolated from gametocyte cultures using a

QIAamp DNA blood Midi kit (Qiagen). A total four amplification regions were selected to

confirm the presence of the integrated cassette (Figure 4). Primers were designed by hand in GC

rich regions (Plasmodium has an AT rich genome) such that two of these regions were

completely within the genome; two others were partially contained within the integrated cassette

(Table 1).

P. berghei Primer SetsPrimer Set Sense Oligonucleotide Anti-sense Oligonucleotide

A PbCLG5 S1GGATCCCATAAATGGCAACCCAAGC

PbCLG5 AS1CCTTTTGTTGTTACTCTGTCAATTAATG

B PbCLG5 S1GGATCCCATAAATGGCAACCCAAGC

pKO3UTR SGCGGAAATACAGAAGCTGGC

C PbCLG3 S1CTCGACACAGGAAATGATAAAAATG

PbCLGgene ASGTACATGCTGTCCAATCATCCC

D pKO5UTR ASCCAACTCAATTTAATAGATGTGTTAG

PbCLG3 AS1GCATCTTAATAGTTCATTTGTATTGGG

P. falciparum Primer SetsPrimer Set Sense Oligonucleotide Anti-sense Oligonucleotide

A PfCLG5UTR S2CGATCTGTTCACTGTATTGTGCC

PfCLG5 ASCCATCTGTATTCATAAACATGACAACC

B PfCLG5UTR S2CTGAGAATTTATGAATGCCCC

PfCLGgene ASCCTCCTACGTCTGCTTCCATATTTTCC

C PfCLG3 SCAACTTCAAATGAGCATCACGC

PfCLGgene ASCCTCCTACGTCTGCTTCCATATTTTCC

D pHHT-TK PfHRP3UTR S1 PfCLGgene ASCCTCCTACGTCTGCTTCCATATTTTCC

Table 1: Diagnostic PCR primers

Diagnostic primers were designed by hand on the criteria of 40% GC content and an approximate annealingtemperature of 50oC. Primers for sets “A” and “C” are both contained in the genomic DNA; one primer for sets“B” and “D” is in the genomic DNA, the other in the integrated cassette.

For P. berghei and P. falciparum, best results were obtained with 35 cycles of amplification, 30

second denaturation at 94oC, 30 second annealing at 48oC and 4 minute extension at 65oC. PCR

was done using a PTC-100 Thermal Cycler (MJ Research).

a)

b)

Figure 4: Diagnostic PCR design

Diagnostic PCR design for P. berghei and P. falciparum. Bolded letters correspond to primer sets (Table 1)and agarose gel lane labels in (Figure 6). Note that the integrated cassette is only present in TLP knockoutstrains.

Southern Blot

Genomic DNA was isolated from mature wild type and TLP knockout P. falciparum cultures via

phenol/chloroform extraction. 4.8ug of wild type or TLP knockout genomic DNA were digested

with HindIII and NcoI (Figure 5). The reaction was allowed to proceed overnight at 37oC.

The digest product, run on a 1.2% Ethidium Bromide stained agarose gel for 210minutes at 50V,

was visualized in a UV Transilluminator (Bio-Rad). Membrane transfer was performed by

capillary transfer using a 20x SSC transfer buffer and nitrocellulose membrane (Sambrook et al.,

1989). The membrane was hybridized overnight with a 600bp DIG labeled probe at 40oC.

Hybridization and labeling steps were carried out using the DIG High Prime DNA Labeling and

Detection Starter Kit II (Roche Applied Science). Florescent antibody-bound DIG labeled probe

was visualized by 2-10minute exposures to X-ray film.

gDNA gDNA

NcoI HindIII

Hybridization Probe

Wildtype

TLP knockout

7,600bp

gDNA gDNA

NcoI HindIII

Hybridization Probe

9,700bp

HindIII HindIII2000bp

Integrated Cassette

Figure 5: Southern blot design

A genomic DNA restriction digest with NcoI and HindIII theoretically yields a 7.6kbp and 2.0kbp band forwildtype and TLP knockout respectively. After transfer, the Hybond nitrocellulose membrane was hybridizedwith a 600bp DIG labeled hybridization probe and visualized with a florescent DIG antibody with X-ray film.

Real Time PCR

Using Quantitative Real-Time Polymerase Chain Reaction (QRT-PCR), gene expression was

monitored at eight discrete time points in both P. berghei and P. falciparum. RNA was extracted

at each time point in Trizol (Invitrogen) as recommended by the manufacturer. RNA was treated

with DNAse I (Boehringer Mannheim) and purified on an RNeasy Minielute cleanup column

(Qiagen) until free of DNA. cDNA was then obtained by subjecting extracted RNA to reverse

transcription using Superscript II primed with random hexamer primers (Invitrogen).

Quantitative Real-Time PCR assays were performed using a SYBR Green PCR Master Mix

protocol and 100uM primers. Gene specific primers for TLP, AMA-1, glutamic acid tRNA

synthase, RLPl11 and arginine tRNA synthase were empirically designed. CT’s beyond thirty

cycles were excluded as noise.

Results

TLP gene is likely disrupted

To confirm the disruption of the TLP gene, diagnostic PCR was preformed on P. berghei and P.

falciparum genomic DNA (Figure 6). The sets of primers “A” and “C” are complementary to the

genomic DNA and are therefore expected in both the wild type and TLP knockout. One of the

primers in set “D” located within the disruptive cassette and should only be observed in the TLP

knockout. For P. berghei, one of the primers of set “B” is located within the disruptive cassette

and like “D” should only be observed in the TLP knockout. For P. falciparum the PCR product

for primer set “B” spans the entire integrated cassette.

In P. berghei, band A was expected at 755bp; band B at 1,238bp; band C at 869bp; and band D

at 963bp. All bands were observed as expected. In P. falciparum, band A was expected at 620bp;

band B at 3,000bp (wild type) and 5,000bp (TLP knockout); band C at 800bp; and band D at

1,622bp. All bands were observed as expected with the exception of TLP knockout band B. This

is likely due to an insufficient extension time for the 5.0kbp fragment. A smear caused by

nonspecific extension resulted when attempted with longer extension times (up to ten minutes).

These results suggest that the disruptive cassette is likely integrated into the P. berghei and P.

falciparum TLP knockout genome.

TLP expression occurs predominately in the sporozoite

Quantitative Real-Time Polymerase Chain Reaction (QRT-PCR) was used to determine the life

cycle stages at which the TLP gene was expressed. Results for P. berghei (Figure 7) and P.

falciparum (Figure 8) are shown below.

A B C D

WT TLP

P. berghei

A B C D

P. falciparum

A B C D A B C D

WT TLP

Figure 6: Disruption cassette is likely integrated into the TLP knockout genome

Diagnostic PCR on P. berghei and P. falciparum genomic DNA suggests that the gene disruption cassette islikely integrated into the TLP knockout genome. For P. berghei, expected PCR product sizes are as follows:755bp band A; 1,238bp band B; 869bp band C; 963bp band D. For P. falciparum: 620bp band A; 3,000bp bandB wild type; 5,000bp band B TLP knockout; 800bp band C; 1,622bp band D. All bands were observed whereexpected except P. falciparum TLP knockout band B. This is likely due to insufficient extension time for the5,000bp PCR product.

Of the eight discrete mRNA isolation time points for P. berghei, five (ring, early trophozoite,

late trophozoite, schizont and merozoite) represent the asexual stages. HSP70 (Heat Shock

Protein 70), a ubiquitous chaperone protein, was the positive control for the entire life cycle.

AMA-1 (Apical Membrane Antigen 1), a well characterized protein previously determined to be

expressed in merozoites and sporozoites, was additional control for the merozoite and sporozoite

stages. Figure 7 demonstrates that TLP is predominately expressed in the sporozoite. In fact,

TLP is expressed at approximately the same levels as AMA-1 in merozoites, suggestive of a high

level of expression.

Figure 7: P. berghei TLP gene expression occurs predominately in the sporozoite

TLP gene is highly expressed in the sporozoite. No expression occurs in the host asexual stages (ring, earlytrophozoite, late trophozoite, schizont and merozoite), gametocyte or oocyst. AMA-1 (Apical Membrane Antigen1) is a positive control expressed in the merozoite and sporozoite stages. HSP70 (Heat Shock Protein 70) is apositive control expressed in all life cycle stages.

QRT-PCR was also conducted on P. falciparum at eight discrete time points (Figure 8). As for P.

berghei, AMA-1 was used a positive control for the sporozoite and merozoite stages. Glutamic

acid tRNA synthase was used a positive control for the entire lifecycle.

In addition to sporozoite expression, the TLP gene was expressed in the gametocyte and zygote.

Although both the gametocyte and zygote are not invasive, it is possible that P. falciparum is

storing TLP mRNA for later translation. It is important to note that since the Quantitative Real-

Time PCR for P. berghei and P. falciparum were normalized for different housekeeping genes,

expression ratios cannot be compared between the two.

Figure 8: P. falciparum TLP gene expression occurs in the sporozoite

TLP gene expression occurs in the gametocyte, zygote and sporozoite. No expression occurs in the host asexualstages (ring, early trophozoite, late trophozoite, schizont and merozoite). AMA-1 (Apical Membrane Antigen 1)is a positive control expressed in the merozoite and sporozoite stages. Glutamic acid tRNA synthase is a positivecontrol expressed in all life cycle stages.

Conclusion & Discussion

Through Quantitative Real-Time Polymerase Chain Reaction (QRT-PCR), we have determined

that TLP, TRAP-Like Protein, is expressed predominately in the sporozoite stage. In addition to

TLPs domain homology with CSP and TRAP, both sporozoite proteins known to mediate

hepatocyte invasion, TLP is hypothesized to be involved with sporozoite recognition and

invasion of hepatocytes. The overall protein expression and localization of CSP, TRAP, CTRP

and TSP are summarized in Table 2. TLP protein expression was derived from preliminary

Immunofluoresce Assays (IFA).

To study the function of TLP, TLP knockout strains of P. berghei and P. falciparum were

created via gene disruption. We verified the inclusion of an integrated cassette by diagnostic

PCR in both P. berghei and P. falciparum. These results, along with the circumstantial evidence

CSP TRAP CTRP TLP

membranecytoplasmmembranecytoplasmmembranecytoplasmmembranecytoplasm

SalivaryGland

Sporozoite+ - + + - - + -

HemocoelSporozoite + - + - - - - -Ookinete - - - - + + - -AsexualStages - - - - - - - -

Table 2: Expression and localization of several Plasmodium invasion mediating proteins

CSP, TRAP and CTRP are related proteins that play a role in Plasmodium recognition and invasion during thesporozoite (CSP and TRAP) and ookinete (CTRP) life cycle stages. TLP is an uncharacterized protein that hasdomain homology to these three known invasion-mediating proteins. This knowledge has led to the hypothesisthat TLP, like CSP and TRAP, might be involved in host cell recognition and invasion. Quantitative Real-TimePCR has revealed that the TLP gene is expressed during the sporozoite stage. Preliminary IFA suggest that theTLP protein is only expressed in salivary gland sporozoites. To date, the sub-cellular localization is unknown.

of pyrimethamine resistance in the TLP-knockout parasites, suggest that it is likely that the

cassette is properly inserted. To further verify the knockout, Southern blot analysis is necessary.

Future work includes hepatocyte invasion assays to assess the significance of TLP in sporozoite

and Immunofluoresce Assays (IFA) to determine the cellular localization of TLP. We expect

TLP is either localized to the cell surface, similar to CSP, or localized to the micronemes, similar

to TRAP. Depending on the outcomes of these characterization steps, TLP could become a very

early drug target candidate.

References

Centers for Disease Control. National Center for Infectious Diseases, Division of Parasitic Diseases.

Deitsch KW, Driskill CL, Wellems TE. Transfer motion of malaria parasites by the spontaneous uptake and expression ofDNA from human erythrocytes. Nucleac Acids Res. 2001;pp850-853.

Dessens JT, Beetsma AL, Dimopoulos G, Wengelnik K, Crisanti A, Kafatos FC, Sinden RE. CTRP is essential formosquito infection by malaria ookinetes. The EMBO Journal. 1999;Vol. 18 No22 pp6221-6227.

Duraisingh MT, Triglia T, Corman AF. Negative selection of Plasmodium falciparum parasites. Nucleic Acids Res.2002;pp716-724.

Fairhurst RM, Baruch DI, Brittain NJ, Ostera GR, Wallach JS, Hoang HL, Hayton K, Guindo A, Makobongo MO,Schwartz OM, Tounkara A, Doumbo OK, Diallo DA, Fujioka H, Ho M, Wellems TE. Abnormal display ofPfEMP-1 on erythrocytes carrying haemoglobin C may protect against malaria. Nature. 2005 Jun23;435(7045):1117-21.

Fairhurst RM, Wellems TE. Modulation of malaria virulence by determinants of Plasmodium falciparum erythrocytemembrane protein-1 display. Curr Opin Hematol. 2006 May;13(3):124-30.

Gardner MJ, Hall N, Fung E, White O, Berriman M, Hyman RW, Carlton JM, Pain A, Nelson KE, Bowman S, Paulsen IT,James K, Eisen JA, Rutherford K, Salzberg SL, Craig A, Kyes S, Chan MS, Nene V, Shallom SJ, Suh B,Peterson J, Angiuoli S, Pertea M, Allen J, Selengut J, Haft D, Mather MW, Vaidya AB, Martin DM, FairlambAH, Fraunholz MJ, Roos DS, Ralph SA, McFadden GI, Cummings LM, Subramanian GM, Mungall C, VenterJC, Carucci DJ, Hoffman SL, Newbold C, Davis RW, Fraser CM, Barrell B. Genome sequence of the humanmalaria parasite Plasmodium falciparum. Nature. 2002 Oct 3;419(6906):498-511.

Greenwood B & Mutabingwa T. Malaria in 2002. Nature 415, 670-672 (7 February 2002)

Guinovart C, Navia MM, Tanner M, Alonso PL. Malaria: burden of disease. Curr Mol Med. 2006 Mar;6(2):137-40.

Hayward RE, Derisi JL, Alfadhli S, Kaslow DC, Brown PO, Rathod PK. DNA microarrays and stage-specific geneexpression in Plasmodium falciparum malaria. Mol Microbiol. 2000 Jan;35(1):6-14.

Kaneko O, Templeton TJ, Iriko H, Tachibana M, Otsuki H, Takeo S, Sattabongkot J, Torii M, Tsuboi T. The Plasmodiumvivax homolog of the ookinete adhesive micronemal protein, CTRP. Parasitol Int. 2006 Sep;55(3):227-31. Epub2006 Jul 5.

Miller LH, Baruch DI, Marsh K, Doumbo OK. The pathogenic basis of malaria. Nature. 2002 Feb 7;415(6872):673-9.

Sachs J & Malaney P. The economic and social burden of malaria. Nature. 2002 Feb 7;415(6872):680-5.

Sambrook, J., Fritsch, E.M. and Maniatis, T. (1989) Molecular cloning: a laboratory manual, 2nd edition, Cold SpringHarbor Laboratory, Cold Spring Harbor, New York.

Templeton TJ, Deitsch KW. Targeting malaria parasite proteins to the erythrocyte. Trends Parasitol. 2005 Sep;21(9):399-402.

Wengelnik K, Spaccapelo R, Naitza S, Robson KJ, Janse CJ, Bistoni F, Waters AP, Crisanti A. The A-domain and thethrombospondin-related motif of Plasmodium falciparum TRAP are implicated in the invasion process ofmosquito salivary glands. 1999 Oct 1;18(19):5195-204.

Yuda M, Sakaida H, Chinzei Y. Targeted disruption of the Plasmodium berghei CTRP gene reveals its essential role inmalaria infection of the vector mosquito. J Exp Med. 1999 Dec 6;190(11):1711-6.Click here to read