chromatin structure at the flanking regions of the human beta-globin locus control region dnase i...

www.bba-direct.com

Biochimica et Biophysica Acta 1679 (2004) 201–213

Chromatin structure at the flanking regions of the human beta-globin locus

control region DNase I hypersensitive site-2: proposed nucleosome

positioning by DNA-binding proteins including GATA-1

Neil Davies, John Freebody, Vincent Murray*

School of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney NSW 2052, Australia

Received 7 January 2004; received in revised form 6 April 2004; accepted 8 April 2004

Available online 10 May 2004

Abstract

The human beta-globin locus control region DNase I hypersensitive site-2 (LCR HS-2) is erythroid-specific and is located 10.9 kb

upstream of the epsilon-globin gene. Most studies have only examined the core region of HS-2. However, previous studies in this laboratory

indicate that positioned nucleosomes are present at the 5V- and 3V-flanking regions of HS-2. In addition, footprints were observed that

indicated the involvement of DNA-binding proteins in positioning the nucleosome cores. A consensus GATA-1 site exists in the region of the

3V-footprint. In this study, using an electrophoretic mobility shift assay (EMSA) and DNase I footprinting, we confirmed that GATA-1 binds

in vitro at the 3V-end of HS-2. An additional GATA-1 site was found to bind GATA-1 in vitro at a site positioned 40 bp upstream. At the 5V-end of HS-2, DNase I footprinting revealed a series of footprints showing a marked correlation with the in vivo footprints. EMSA indicated

the presence of several erythroid-specific complexes in this region including GATA-1 binding. Sequence alignment for 12 mammalian

species in HS-2 confirmed that the highest conservation to be in the HS-2 core. However, a second level of conservation extends from the

core to the sites of the proposed positioning proteins at the HS-2 flanking regions, before declining rapidly. This indicates the importance of

the HS-2 flanking regions and supports the proposal of nucleosome positioning proteins in these regions.

Crown Copyright D 2004 Published by Elsevier B.V. All rights reserved.

Keywords: Gene expression; Nucleosome; Phylogenetic footprinting; GATA-1

1. Introduction

The human beta-globin locus contains five genes that are

expressed in a developmental stage-specific manner that

reflects their order in the beta-globin array [1]. The regula-

tion of expression is mainly at the transcriptional level and

is mediated by both proximal and distal DNA-regulatory

elements. The major distal regulatory element in the human

beta-globin locus is the locus control region (LCR) [2–4]

which is located 6-22 kb upstream of the epsilon globin

gene (Fig. 1), and consists of at least five erythroid-specific

DNase I hypersensitive sites (HS-1 to HS-5). The LCR is

required for conferring high-level globin gene expression at

all stages of erythroid development [5].

The HS-2 and HS-3 core elements of 200–300 bp

contain most of the LCR activity, and HS-2 appears to be

0167-4781/$ - see front matter. Crown Copyright D 2004 Published by Elsevier

doi:10.1016/j.bbaexp.2004.04.002

* Corresponding author. Tel.: +61-2-9385-2028; fax: +61-2-9385-

1483.

E-mail address: [email protected] (V. Murray).

necessary and sufficient for full LCR activity in transgenic

mice [6,7]. HS-2 contains multiple protein binding sites [8]

and has enhancer activity in transient expression experi-

ments [9,10]. The trans-acting factors binding in this region

include GATA-1 [11–13], NF-E2 [14] and CACC-binding

proteins [13].

DNase I hypersensitive sites (DHS) are classically

regarded as regions that are free from nucleosomes

(although this is an area of debate). This permits tran-

scription factors to bind in the region, leading to the

induction of gene expression [15]. The results of Cairns

and Murray [16] and Kim and Murray [17,18], using

bleomycin and hedamycin in vivo footprinting agents,

support the proposal that the HS-2 core region is nucle-

osome-free in erythroid cells. The results of Kim and

Murray [17,18] show evidence for positioned nucleosomes

at the 5V- and 3V-flanking regions of HS-2 in erythroid

cells in vivo. Positioned nucleosomes are often found at

the flanking regions of DHS [19–21]. The study pre-

sented here addresses the question of the identity of the

B.V. All rights reserved.

Fig. 1. Schematic of the human beta-globin gene cluster and LCR HS-2. The five expressed globin genes and their promoter regions are shown. The exploded

view of the LCR HS-2 shows ‘‘positioned’’ nucleosomes at the 5V- and 3V-boundaries, as well as the position of the putative ‘‘positioning’’ proteins. GATA-1B(the 3V-positioning protein candidate) and GATA-1A are indicated at the 3V-boundary of HS-2. The locations of transcription factor binding elements within

HS-2 are also indicated (figure adapted from Kim and Murray [18]).

N. Davies et al. / Biochimica et Biophysica Acta 1679 (2004) 201–213202

bound proteins at the 5V- and 3V-ends of HS-2. It

additionally provides information on the mechanism by

which the nucleosomes are positioned. It should be noted

that for this study, in vivo indicates that an experiment

was performed in intact cells while in vitro indicates that

cell extracts were used.

In the presence of ATP, nucleosomes can slide along

DNA [22]. Therefore, the maintenance of a nucleosome-free

HS requires a mechanism to prevent the sliding of nucleo-

somes into the site. There are two known mechanisms by

which nucleosomes can be positioned, thereby preventing

sliding. The mechanism that has been most experimentally

documented is positioning via certain DNA sequences. In

many instances, a strong correlation was found for the

dominant nucleosome positions in vivo and in vitro [23–

26]. However, results from other studies suggest the use of

caution in using in vitro nucleosome positions to predict in

vivo nucleosome positions [27].

The second mechanism by which nucleosomes can be

translationally positioned is via DNA binding proteins

which actively position or prevent the sliding of a nucleo-

some. Examples of genes in which this has been observed

include yeast STE6 and BAR1 [28], promoters in yeast

GAL1/GAL10 [29], and the promoter in Drosophila hsp 26

[30]. This is our favoured proposal for nucleosome posi-

tioning at the flanking regions of HS-2, for two reasons.

First, the results of Kim and Murray [18] show footprints in

intact erythroid cells, adjacent to the footprint deduced to be

caused by binding of a nucleosome. These footprints were

obtained using four different nitrogen mustards as damaging

agents. We propose that these adjacent footprints are caused

by transcription factors, which contribute to the establish-

ment of positioned nucleosomes in these regions. At the 3V-end of HS-2, a consensus GATA-1 site exists at the site of

the in vivo footprint, and is our candidate for nucleosome

positioning in this region. The second reason why we favour

DNA binding proteins as the major nucleosome positioning

factors at the HS-2 flanking regions is that the deduced in

vivo nucleosome footprints are found in erythroid K562

cells but not in non-erythroid HeLa cells, although the DNA

sequence is the same in both cell lines [18]. Therefore, the

DNA sequence alone cannot position the nucleosomes. The

lack of nucleosome footprints in HS-2 in HeLa cells

suggests that the nucleosomes are randomly assorted

throughout HS-2 in these cells.

GATA-1 was the first member of the GATA family of

zinc finger transcription factors to be described. It is a

haematopoietic cell-specific transcription factor that binds

to the consensus sequence (A/T)GATA(A/G) [31]. The

DNA binding domain consists of two zinc fingers of the

Cys2–Cys2 type, but generally only the C-terminal finger

and adjacent basic region are thought to be significantly

involved in DNA binding at most sites [32,33]. GATA-1

contacts DNA in both the major and minor grooves [34].

GATA-1 is essential for erythroid cell development [35–

37], and has been demonstrated to be involved in the

generation of active chromatin over almost all of the globin

and other erythroid-specific genes [38,39].

N. Davies et al. / Biochimica et Biophysica Acta 1679 (2004) 201–213 203

In this study, we investigated the proposal that nucleo-

some-positioning factors are present at the flanking regions

of HS-2. This was accomplished by in vitro methods and by

examination of the level of nucleotide conservation for HS-

2 in 12 species of mammal.

Fig. 2. DNase I footprinting analysis at the 3V-end of HS-2. A [32P]-end

labelled PCR product containing the 3V-end of HS-2 (bp 8831 to 9110) was

used for the DNase I footprinting experiments with K562 or HeLa nuclear

extracts. The sites of protection at GATA-1A, GATA-1C and GATA-1B by

K562 nuclear extract are shown. Dideoxy sequencing lanes are indicated.

2. Materials and methods

2.1. Nuclear extract preparation

K562 and HeLa cells were harvested and washed twice

with ice cold phosphate buffered saline (PBS). All subse-

quent steps were carried out on ice or at 4 jC. Cells were

split into 1.5-ml eppendorf tubes to give approximately

3� 107 cells per tube. Cells were centrifuged at 10,000

rpm for 30 s in a microfuge, the PBS was removed and the

cells resuspended in 800-Al buffer A consisting of 10 mM

HEPES, pH 7.8, 10 mM KCl, 15 mM MgCl2, 0.1 mM

EDTA, 0.1 mM EGTA, 1 mM PMSF, 10 Ag/ml aprotinin, 5

Ag/ml leupeptin and 1 mM dithiothreitol. The suspension

was incubated for 15 min before the addition of 50 Al of10% NP-40 and the suspension was vortexed for exactly 30

s. The homogenate was centrifuged at 14,000 rpm for 1 min

in a microfuge, and the supernatant discarded. Buffer C (80

Al) was added to the pellet, consisting of 0.4 M NaCl, 20

mM HEPES, pH 7.8, 7.5 mM MgCl2, 2 mM EDTA and 1

mM EGTA, 0.1 mM dithiothreitol, 0.1 mM PMSF, 10 Ag/ml

aprotinin and 5 Ag/ml leupeptin. The pellet (after checking

that the pellet was white and not yellow) was resuspended in

buffer C by flicking the eppendorf. The dithiothreitol,

PMSF, aprotinin and leupeptin were added to buffers A

and C immediately before use. The pellet was incubated in

buffer C for 20 min on a rotary shaker. The tubes were

centrifuged for 15 min, and the supernatant transferred to

another 1.5-ml eppendorf tube; 3 Al was set aside for proteinconcentration determination, and the remainder frozen in

30-Al aliquots at � 70 jC. The protein concentration was

determined using the Bradford reagent with bovine serum

albumin as a standard [40].

2.2. Oligonucleotides

The primers used to amplify the flanking regions of HS-2

for DNase I footprinting were: at the 3V-end, ND191—

ggatgcctgagacagaatgtgac, and ND193—catgccttcctcttcca-

tatcc; and at the 5V-end, ND112—ggagctgagcttgtaaaaagta-

tag and ND228—ctgagatcgtgccactgcactccag.

The following double-stranded oligonucleotide sequen-

ces were used as probes in the gel shift analyses: PCG

(Positive Control GATA-1)—cctgggtcttatcaggga [41];

GATA-1B—caaatatttatcttgcaggt; GATA-1A—tatatatttgttgt-

tatcaattgc; GATA-1C—atagaatgattagttattgt; 5VHS2—ggaa-

taagatacatgttttatt.

Competitor oligonucleotides were as follows: PCG,

GATA-1B, PCG(� )—cctgggtcttatgaggga [41], GATA-

1B(� )—caaatatttatgttgcaggt, Sp1—attcgatcggggcggggc-

gagc [42]; YY1—ctgcagtaacgccattttgcaaggcat [43].

2.3. Antibodies

Anti-GATA-1 antibodies were obtained from Santa Cruz

Biotechnology (SC-265) and Sigma (G0290). The Sigma

anti-GATA-1 antibody caused a supershift on EMSA gels,

while the Santa Cruz antibody did not produce a supershift

but inhibited formation of the GATA-1/DNA complex.

2.4. Gel mobility shift assay and DNase I footprinting

For gel mobility shift assays, oligonucleotides were

[32P]-labelled, hybridised and gel purified on a 15% (w/v)

native polyacrylamide gel. Binding reactions were carried

out at 0 jC in 20 Al of 10 mM HEPES, pH 7.8, 50 mM

potassium glutamate, 5 mM MgCl2, 1 mM EDTA, 1 mM

dithiothreitol, 5% (v/v) glycerol, and 1 Ag of poly (dI–

dC) [44]. Nuclear extract (5–10 Ag) was added to the

binding mix and incubated for 15 min. Where indicated,

1 Al of Sigma or Santa Cruz GATA-1 antibody was added

prior to the nuclear extract. [32P]-labelled purified double-

stranded oligonucleotide (100 fmol) was added and the

reaction mixtures incubated for a further 15 min. Where


indicated, competitor oligonucleotides were added prior to

the probe at molar excess of 150- to 200-fold. The

resulting complexes were separated by electrophoresis

through 4% (w/v) polyacrylamide gels at 4 jC in 0.5�Tris–borate–EDTA buffer. Gels were dried and subjected

to autoradiography.

For DNase I footprinting, primer ND193was labelled with32P using polynucleotide kinase, and used with primer

ND191 to amplify the region from bp 8831 to 9110 contain-

ing the 3V-end of HS-2. At the 5V end of HS-2, primer ND112

was labelled with 32P and used with primer 228 to amplify the

region from bp 8247 to 8449. The resultant fragments were

purified on a 6% (w/v) native polyacrylamide gel, then used

in a DNase I footprinting reaction using the binding buffer

and procedure described above, except that the reaction was

scaled up to 30 Al. After the binding procedure described

above, 2 Al of a solution containing 2 mM CaCl2 and 2 mM

MgCl2 was added and mixed; then 0.003 to 0.12 Kunitz units

of DNase 1 (Progen) was added and incubated for 1 min at 25

jC. The reaction was stopped by the addition of 9 Al of 10%SDS and 4.5 Al of 0.1 M EDTA. Proteinase K was added (2

Fig. 3. Gel shift analysis at the proposed positioning protein site GATA-1B. The [3

14—GATA-1B. Lanes 1, 3–6—PCG. Free DNA probes (no nuclear extract) are

nuclear extract used in all other lanes. SigAb (lanes 4 and 8) indicates the additio

addition of 1 Al of Santa Cruz GATA-1 antibody. Competitor oligonucleotides (1

GATA-1B (lane 12), GATA-1B(� ) (lane 13) and Sp1 (lane 14). The GATA-1 ba

Al of 10 mg/ml) and the reaction incubated for 30 min at 37

jC. H2O (50 Al) was added, and phenol/chloroform extrac-

tion was performed followed by ethanol precipitation. The

pellet was resuspended in 7 Al of 10 mM Tris–HCl, pH 8.0,

0.1 mM EDTA, and 2 Al loaded onto a 6% denaturing

polyacrylamide gel with 2 Al of denaturing formamide dye.

Dideoxy sequencing reactions (obtained using the same

oligonucleotide primers and unlabelled PCR product) were

included on the gel. Gels were dried and subjected to

autoradiography.

2.5. HS-2 nucleotide conservation analysis

A phylogenetic footprinting analysis of the beta globin

HS-2 was performed. Sequences from 12 species of

mammal were compared using programs (Pretty Plot

and Eplotsimilarity) accessed online from the Australian

National Genome Information Service (ANGIS). The 12

species of mammal were human, chimpanzee, olive ba-

boon, cat, dog, galago, rabbit, pig, mouse, cow, goat and

rat.

2P]-labelled double-stranded oligonucleotide probes used were: Lanes 2, 7–

shown in lanes 1 and 2, HeLa nuclear extract was present in lane 6, K562

n of 1 Al of Sigma GATA-1 antibody. SCAb (lanes 5 and 9) indicates the

50-fold molar excess) were added for PCG (lane 10), PCG(� ) (lane 11),

nd and the GATA-1/Antibody supershift are shown.


3. Results

3.1. Analysis at the 3V-end of HS-2

Nuclear extracts were prepared from K562 and HeLa

cells and utilised in DNase I footprinting experiments and

electrophoretic gel mobility shift assays (EMSA). The

[32P]-end labelled PCR products were produced by am-

plification of the region from bp 8831 to 9110 containing

the 3V-end of HS-2 and used in the DNase I footprinting

experiments.

DNase I footprinting at the 3V-end of HS-2 (Fig. 2)

revealed protection at both consensus GATA-1 sites, GATA-

1A (8940–8945) and GATA-1B (8980–8985). These foot-

prints were obtained using a nuclear extract from erythroid

K562 cells which express the globin genes, but not with

nuclear extract from HeLa cells. A faint footprint occurred

at the GATA-1C site. These experiments demonstrate that an

erythroid-specific protein binds to the proposed NPP site

GATA-1B in vitro.

Radiolabelled double-stranded oligonucleotides were

produced containing the GATA-1B sequence and used in

gel mobility shift assays (Fig. 3). A major protein/DNA

complex (indicated as GATA-1 in Fig. 3) was observed with

the K562 nuclear extract (lane 7) which was not observed

with HeLa extract (lane 6). The addition of Sigma GATA-1

Fig. 4. Gel shift analysis of GATA-1 sites at 3V-HS-2. Double-stranded oligonucle

Lanes 6–10: GATA-1A. Lanes 11–15: GATA-1C. HeLa nuclear extract was pres

lanes. SigAb (lanes 2, 7 and 12) indicates the addition of Sigma GATA-1 antibody

(lanes 3, 8 and 13), PCG(� ) (lanes 4, 9 and 14). The GATA-1 band and the GA

antibody (lane 8) yielded a large ‘‘supershifted’’ complex

identifying the bound protein as GATA-1. The use of Santa

Cruz GATA-1 antibody (lane 9) resulted in almost complete

loss of complex formation. A 150-fold molar excess of

competitor GATA-1 oligonucleotides PCG and GATA-1B

(self) (lanes 10 and 12) resulted in loss of complex forma-

tion, while the use of competitor oligonucleotides with

mutated GATA-1 sites (11 and 13) did not. The GATA-1

sites of these latter competitor oligonucleotides were abol-

ished by replacing the G residue of the GATA motif with a

C, as this mutation is known to disrupt GATA-1 binding

[41]. The use of a competitor oligonucleotide containing an

Sp1 site (lane 14) had no significant effect on complex

formation.

Lanes 3, 4 and 5 represent EMSA using PCG, a positive

control oligonucleotide sequence which has been shown to

bind GATA-1 and is found in the EKLF gene promoter [41].

A band can be seen (lane 3) that co-migrated with the major

GATA-1B band (lane 6), and which is supershifted with

Sigma GATA-1 antibody (lane 4).

Gel mobility shift assays were conducted to investigate

the GATA-1A and GATA-1C sites. Using the K562 nuclear

extract (Fig. 4, lane 6), probe GATA-1Awas gel shifted and

gave a band that co-migrated with the GATA-1 band, but

HeLa nuclear extract (lane 10) did not produce this band.

This K562-specific complex was recognised by Sigma

otides for the 3 GATA-1 sites at 3V-HS-2 were used. Lanes 1–5: GATA-1B.

ent in lanes 5, 10 and 15 while K562 nuclear extract was used in all other

. Competitor oligonucleotides (200-fold molar excess) were added for PCG

TA-1/Antibody supershift are shown.

N. Davies et al. / Biochimica et Biophy206

GATA-1 antibody (lane 7) and gave a supershift. Loss of

complex formation was observed with addition of a 200-

fold molar excess of competitor oligonucleotide containing

a consensus GATA-1 site (PCG, lane 8) but not with a

competitor oligonucleotide with a mutated GATA-1 site

(PCG(� ), lane 9).

Probe GATA-1C was not gel shifted by an erythroid-

specific nuclear protein (lanes 11 and 15), and the minor

bands observed were not significantly affected by the

addition of Sigma GATA-1 antibody (lane 12) or com-

petitor oligonucleotides (lanes 13 and 14). This indicated

that GATA-1 binds in vitro at site GATA-1A but not

GATA-1C.

A phylogenetic footprinting analysis of the human beta

globin HS-2 was attempted. Sequences from 12 species of

mammal were investigated for this region. Fig. 5 shows a

depiction of nucleotide conservation at the 3V-end of HS-

2 (Pretty Plot). This indicated areas of sequence conser-

vation, but these regions were not conserved in all

species. Sequence conservation was also observed at the

GATA-1 sites, but again the conservation was not found

in all species.

Fig. 5. Nucleotide conservation (Pretty Plot) for the 3V-end of HS-2 GATA-1 sites.GATA-1 sites are indicated. For GATA-1A and GATA-1B, the actual GATA site

sequence alignment. The consensus sequence is indicated below the alignment and

that nucleotide. The species are arranged in decreasing order of similarity to hum

3.2. Analysis at the 5V-end of HS-2

[32P]-end labelled PCR products were amplified from the

5V-end of HS-2 (bp 8247 to 8449) and used for the DNase I

footprinting experiments (Fig. 6). Utilising K562 and HeLa

nuclear extracts, a series of footprints and enhancements

between bp 8330 and 8390 can be observed in Fig. 6. This

large footprinted region is composed of several smaller

footprints that are bordered by sites of enhancement at bps

8330, 8368, 8378 and 8390. The results are similar for K562

and HeLa nuclear extracts. However, there are several

erythroid-specific footprints including: the AGATAC site

(bp 8334–8339) that is a potential GATA-1 binding site;

and at bp 8360. These in vitro DNase I footprinting results

at 5V-HS-2 correlated with the in vivo results obtained by

Kim and Murray [17].

The erythroid-specific protein binding at the AGATAC

site (bp 8334–8339) was further investigated by gel

mobility shift analysis (Fig. 7). The AGATAC double-

stranded oligonucleotide probe is from the 8328–8349-bp

region. Two erythroid-specific bands were detected (la-

belled GATA-1 and YY1 +GATA-1) using this AGATAC

sica Acta 1679 (2004) 201–213

Sequence alignment for 12 species of mammal is shown. The three potential

is found on the other (non-coding) DNA strand, and is shown above the

a dash (in the consensus sequence) indicates that there is no consensus for

an.

Fig. 6. DNase I footprinting analysis at the 5V-end of HS-2. A [32P]-end

labelled PCR product containing the 5V-end of HS-2 (bp 8247 to 8449) was

used for the DNase I footprinting experiments with K562 or HeLa nuclear

extracts. Two footprints between bp 8330 and 8390 are shown as well as

enhancements at bps 8330, 8368, 8378 and 8390 (indicated by arrows). The

erythroid-specific footprint at the AGATAC site is indicated. The in vivo

footprint described by Kim and Murray [17] is indicated by the open

rectangle. Dideoxy sequencing lanes are indicated.


oligonucleotide (lane 6). Loss of complex formation was

observed at both band positions with the addition of a

200-fold molar excess of competitor PCG, containing a

consensus GATA-1 site (lane 7), but not by PCG(� ),

containing a mutated GATA-1 site (lane 8). Use of Sigma

GATA-1 antibody (lane 9) also causes loss of complex

formation at both bands. The lower band co-migrates with

a GATA-1/PCG complex (PCG, lane 3) which was super-

shifted by Sigma GATA-1 antibody (lane 4). This indi-

cated that GATA-1 protein is complexed with the

AGATAC oligonucleotide at this lower erythroid-specific

band.

The upper erythroid-specific band (YY1 +GATA-1) and

a band (YY1) were competed out by an oligonucleotide

containing a characterised YY1 site (lane 10), but not by an

oligonucleotide which does not bind YY1 (lane 11). Band

YY1 co-migrated with the characterised YY1/DNA com-

plex (lane 12). This suggested that the upper erythroid-

specific band is a complex of YY1 and GATA-1 with the

AGATAC oligonucleotide.

A phylogenetic footprinting analysis of 12 species of

mammal was also performed at the 5V-end of HS-2. Fig.

8 shows a depiction of nucleotide conservation at the 5V-endof HS-2 (Pretty Plot). This indicated areas of sequence

conservation especially between bps 8333–8341, 8353–

8366 and 8370–8387. These areas were highly correlated

with the DNase I footprints obtained in vitro (Fig. 6).

4. Discussion

4.1. GATA-1 and nucleosome positioning at the 3V-end of

HS-2

GATA-1 was found to be the dominant protein binding in

vitro at the site of the proposed nucleosome positioning

protein (GATA-1B) (Figs. 2 and 3). Therefore, the footprints

obtained at this site in vivo in erythroid cells [12,18] are

likely to be due to GATA-1 binding at this site in vivo. The

location of this footprint adjacent to a positioned nucleo-

some [18] suggests a role for GATA-1 in the maintenance of

the nucleosome position at this site. A role for GATA-1 has

recently been proposed in nucleosome positioning in the

human beta-globin intron 2 [45].

This study was initiated following the results of Kim and

Murray [17,18]. However, evidence for the in vivo binding

of GATA-1 at 3V-HS-2 is also found in an earlier study [12],

in which erythroid-specific footprints were observed at sites

GATA-1B and GATA-1A, using DMS as a footprinting

agent. Surprisingly, in view of our in vitro results (Fig. 4,

lanes 11–15), an erythroid-specific footprint was also ob-

served at GATA-1C, the non-consensus GATA-1 site. Fur-

thermore, all three in vivo footprints changed character

when the cells were treated with haemin, which is used to

induce globin gene expression [46].

Chromatin immunoprecipitation (ChIP) analysis has

been performed for GATA-1 over the entire beta-globin

cluster, a region of 75 kb, using arrays [47]. Two major sites

of in vivo GATA-1 binding were found: at the core of HS-2,

and upstream of the gamma-globin gene. Some evidence of

GATA-1 binding at the 3V-end of HS-2 was observed, but

not regarded as significant under the parameters of the

study. Although a powerful technique, ChIP is open to

some criticism because it requires that a specific region of

the protein of interest is accessible to the antibody being

used. It has been said that ChIP ‘‘requires well behaved

antibodies’’ [48]. GATA-1 is known to interact with itself

[49], with Friend of GATA (FOG) [50], EKLF and SP1 [51],

and may be involved in recruitment of histone acetylase

[52,53] and RNA polymerase II [54]. In addition, our

proposal suggests that GATA-1B would be in close prox-

imity to a positioned nucleosome. Any of these factors

could hinder the access of the antibody to the protein of

interest, especially as formaldehyde, used in ChIP to cross-

link the factor of interest to DNA, and cross-links protein to

protein. Horak et al. [47] used three antibody types to

attempt to circumvent this potential problem. However,

possible weaknesses of the ChIP technique are highlighted

by the fact that they did not observe additional in vivo

GATA-1 binding sites previously detected using ChIP in the

beta-globin region [55].

Fig. 7. Gel mobility shift analysis of the AGATAC site at the 5V-boundary of HS2. The labelled double-stranded oligonucleotide probes used were PCG (lanes

1, 3, 4), YY1 (lane 12) and 5VHS2 (lanes 2, 5–11). The 5VHS2 probe covers the region from bp 8328–8349 at the 5V-boundary of HS2 and contains the

AGATAC motif. The YY1 oligonucleotide contains a known high-affinity YY1 binding site. Free DNA probes are shown in lanes 1 and 2. HeLa nuclear

extract was in lane 5, while K562 nuclear extract was used in all other lanes. SigAb (lanes 4 and 9) indicates the addition of 1 Al of Sigma GATA-1 antibody.

Competitor oligonucleotides (200-fold molar excess) were added for PCG (lane 7), PCG(� ) (lane 8), YY1 (lane 10), and Sp1 (lane 11). The GATA-1 and YY1

bands are indicated by arrows. The band thought to represent simultaneous binding of GATA-1 and YY1 is indicated.


It should be noted that GATA-2, which is also present in

erythroid cells, may also bind at the GATA-1B site. The use

of Santa Cruz GATA-1 antibody (Fig. 2, lane 9) results in

loss of the GATA-1 complex, but a minor band slightly

above this can be seen, which may be due to GATA-2

binding. This is very similar to results previously obtained

for GATA-2 gel migration relative to GATA-1 [56]. Why

Sigma GATA-1 antibody (Fig. 2, lane 8) does not produce

this result is unclear, though the two antibodies clearly have

a dissimilar effect on GATA-1 binding in EMSA.

GATA-1 was also shown to be the dominant protein

binding in vitro at the GATA-1A site (Fig. 4, lanes 6–10).

As stated previously, an in vivo haemin-inducible erythroid-

specific footprint has been reported at this site [12]. In

addition, the results of Kim and Murray [18] suggest a

possible in vivo footprint at this site, though the location of

the site at the extreme end of the gel makes interpretation

difficult. We can only speculate on the role, if any, of the

GATA-1A site at the 3V-end of HS-2. Although we propose

that the GATA-1 protein at the GATA-1B site is involved in

nucleosome positioning, it is possible that GATA-1B as well

as GATA-1A perform a combination of roles at the 3V-end

of HS-2. GATA-1 has been shown to perform a number of

functions, including perturbation of nucleosome binding

[57], recruitment of histone acetylase [52] including at

HS-2 [53], and recruitment of RNA polymerase II, includ-

ing at HS-2 [54]. These functions could all be considered to

be involved in activation of chromatin.

The observation that GATA-1 can disrupt a nucleosome

[57] could be linked to our proposal that GATA-1 is

positioning a nucleosome. GATA-1 is one of the earliest

markers of red cell differentiation [58] and could be in-

volved in chromatin remodelling at a very early stage, both

by recruitment of remodelling activities (e.g. histone acety-

lase), and directly (by nucleosome perturbation). If GATA-1

is directly involved in nucleosome disruption at the HS-2

region, this would indicate that the protein would then be

ideally placed to adopt the role of preventing the nucleo-

somes from sliding into the newly created HS. The proposal

that GATA-1B recruits histone acetylase is also attractive,

due to the hypothesised proximity of GATA-1B to the

positioned nucleosome.

The results of the clustal alignment for the nucleotide

sequences of 12 mammal species support our proposal for

Fig. 8. Nucleotide conservation (Pretty Plot) for 5V-HS-2. Sequence alignment for 12 species of mammal is shown. The site of the non-consensus AGATAC

site at bp 8334–8339 is highlighted. The sites of in vitro enhancement at bp 8330, 8368, 8378 and 8390 are indicated. The consensus sequence is shown below

the alignment and a dash (in the consensus sequence) indicates that there is no consensus for that nucleotide. The species are arranged in decreasing order of

similarity to human.


nucleosome positioning at the 3V-end of HS-2 (Fig. 9).

These alignments were generated after the predicted sites of

the nucleosome and positioning proteins were formulated

from in vivo and in vitro results, and the Eplotsimilarity

graph shows a striking correlation to the schematic outline

of our proposal (Fig. 9). It can be seen from this ‘‘similar-

ity’’ plot that there are in general three tiers of conservation.

The region of highest conservation is shown to lie within the

374-bp XbaI–HindIII fragment which is historically taken

to represent the core of HS-2 and is the minimal region

capable of conferring position independent expression of the

beta-globin gene [8,13]. There is a secondary tier of

conservation that extends from this core region to points

that are very close to the sites of the proposed positioning

proteins at the 5V and 3V ends of HS-2. After these points,

there is then a rapid decline in sequence conservation to a

‘‘background’’ level of conservation.

The sites of GATA-1A and GATA-1B are shown to lie

within the region of secondary conservation, before it

declines to background level. This is a compelling result,

which did not form any part of our original positioning

protein proposal. It can be seen that there is strong

conservation of the GATA-1B site, except for the second

‘‘A’’ of the GATA site (Fig. 5). GATA-1 has been shown to

bind to a variety of sites in addition to the consensus

GATA-1 site [44], and GATA-1 may recognise these varia-

tions in vivo.

The site of GATA-1A (Fig. 5) is less conserved, but is

conserved across the human, chimpanzee, olive baboon,

galago and rabbit. This may reflect differences that have

arisen between species over the course of evolution, and the

GATA-1A site may play a significant role in those species in

which it is found. This may also apply to the incomplete

conservation at GATA-1B. Examples of these ‘‘differential

footprints’’ and their significance can be found in the globin

genes. One example is the SSP-binding site in the gamma-

globin gene promoter [59], which is conserved in anthro-

poid primates only. This factor is implicated in the differ-

ential expression of gamma-globin and beta-globin genes

[60].

4.2. Nucleosome positioning at the 5V-end of HS-2

The footprints observed between bp 8330 and 8390 (Fig.

6) show a marked correlation to the in vivo footprinting

results previously reported [17], in which the in vivo

footprint is reported to be from 8332 to 8385. The DNase

I footprinting results are similar for K562 and HeLa nuclear

extract, however, there are some erythroid-specific foot-

prints, for example at positions 8336 and 8360. Examination

of the results of Kim [17] reveals partial footprinting in the

region 8330 to 8390 in HeLa cells, though the adjacent

positioned nucleosome is found in K562 cells only. This

suggests that a series of ubiquitous factors bind in this

Fig. 9. Summary diagram of the human beta-globin HS-2 and areas of sequence conservation. The horizontal bar indicates the XbaI/HindIII fragment taken to

represent the accepted HS-2 core. The positions of GATA-1A and GATA-1B are shown. The position of the 5V-HS-2 footprints obtained in vivo and in vitro is

indicated. Numbering is from the human beta-globin sequence (GenBank accession NG 000007). The exploded diagram shows the relation of the

Eplotsimilarity graph to known and proposed features of HS-2. The Eplotsimilarity graph was obtained using a 12-bp moving window. The diagram is

approximately to scale.


region, but that a small number of erythroid-specific factors

are responsible for key activities in this region, including the

establishment of nucleosome positioning. Nucleosome rear-

rangement by erythroid proteins at the 5V-end of HS-2 has

been reported in an in vitro chromatin-assembled LCR

system [61].

An erythroid-specific DNase I footprint is observed at

position 8334–8339 at the 5V-boundary of HS-2 (Fig. 6). In

view of the 3V-HS-2 GATA-1 sites, it is provocative that a

(non-consensus) GATA-1 site exists at this point—AGA-

TAC. A probe containing this site suggested the binding of

GATA-1 at the lower erythroid-specific band in gel shift

analysis (Fig. 7). Evidence from both competitor oligonu-

cleotides and GATA-1 antibody indicates that GATA-1

protein is bound at this sequence. We speculate that

GATA-1 could be involved in nucleosome positioning at

the 5V-end of HS-2.

There was a second erythroid-specific (upper) band.

Surprisingly, addition of GATA-1 antibody or competitor

oligonucleotide results in loss of this complex. Competitor

oligonucleotide results tentatively suggest that this band is

due to the simultaneous or co-operative binding of YY1

and GATA-1. The site in the AGATAC oligonucleotide

thought to bind YY1 is the sequence TACATGTT, which

is similar to a known high affinity YY1 binding consensus

GACATNTT [62]. Further experiments are required to

clarify this point. Simultaneous and co-operative binding

of GATA-1 and YY1 has been previously reported, at the

core of HS-3 [63] and at the epsilon globin silencer

[64,65].


For the sequence alignment (Fig. 9) at the 5V-end of

HS-2, the results are similar to the 3V-end, with the

secondary tier of conservation extending to the site of

the in vitro and in vivo footprints reported [17], after

which conservation declines rapidly to background level.

The sequence alignment in this region (Fig. 8) reveals a

series of blocks of high conservation which show a

correlation to the series of sub-footprints in vitro (Fig.

6). The AGATAC site at 8334–8339 is not highly con-

served. However, it is possible that the site may play a

significant role in the human HS-2.

4.3. General discussion of HS-2 nucleosome positioning

From previous studies [12,18], it appears that occupation

of the GATA-1B site and the sites at the 5V-HS-2 is

continuous rather than transient, since continuous occupa-

tion would be required to produce the reported footprints.

This is in agreement with a nucleosome positioning protein

proposal [22] that nucleosome positioning by a DNA

binding factor requires that the factor be continuously bound

to the DNA binding site, due to the phenomenon of ATP-

dependent nucleosome movement.

The LCR HS core elements are responsible for most of

the activity of the LCR in transgenic assays [66–69]. The

question then arises as to the role of the HS-2 flanking

regions—the significance of which is supported by the

existence of the second ‘‘tier’’ of conservation which

extends out to the points of the proposed positioning

proteins (Fig. 9). There is evidence that the LCR HS

flanking regions may lead to synergistic enhancement of

expression, whereas the cores alone yield only additive

expression [70]. In addition, in beta-thalassemic mice,

therapeutic levels of beta-globin gene expression are

attained in the presence of the HS-2, -3 and -4 cores and

flanking regions, but not with the HS cores alone [71]. In

the LCR holocomplex model [66,72], the flanking sequen-

ces may help position the HS cores in a manner that aids

their interaction [70].

The results of previous in vivo studies of HS-2 in this

laboratory [16–18] conflict with the results of other

researchers [73,74], who report that nucleosomes are found

in vivo throughout the HS-2 region in both erythroid K562

cells and non-erythroid HeLa cells, and are positioned by

sites of DNA bending found 5V and 3V of the HS-2 core. We

believe the results of Kim and Murray [17,18] and Cairns

and Murray [16] to more truly represent the in vivo

situation, since they were obtained solely in intact cells.

The results of Onishi et al [73] and Onishi and Kiyama

_Hlt70162939[[74], while compelling, were in part deduced

using plasmid DNA and intact, extracted nuclei. Despite

this, it is possible that histone octamers are present along the

entirety of HS-2, but that they are modified; for example by

SWI/SNF complexes or histone acetylation. This could

explain why they do not produce in vivo footprints in the

studies of Cairns and Murray [16] and Kim and Murray

[17,18]. In this alternative proposal, the bound factors at the

flanking regions of HS-2 would then define the boundaries

of, and perhaps play a part in the creation and maintenance

of, this region of modified chromatin.

Acknowledgements

This research was supported by the National Health and

Medical Council of Australia. NPD was supported by an

Australian Postgraduate Award.

References

[1] G. Stamatoyannopoulos, A.W. Nienhuis, in: G. Stamatoyannopoulos,

A.W. Nienhuis, P.J. Majerus, H. Varmus (Eds.), TheMolecular Basis of

Blood Diseases, 2nd ed., Saunders, Philadelphia, 1994, pp. 107–156.

[2] W.C. Forrester, S. Takegawa, T. Papayannopoulou, G. Stamatoyan-

nopoulos, M. Groudine, Evidence for a locus activation region: the

formation of developmentally stable hypersensitive sites in globin-

expressing hybrids, Nucleic Acids Res. 15 (1987) 10159–10177.

[3] F. Grosveld, G.B. van Assendelft, D.R. Greaves, G. Kollias, Position-

independent, high-level expression of the human beta-globin gene in

transgenic mice, Cell 51 (1987) 975–985.

[4] D. Tuan, W. Solomon, Q. Li, I.M. London, The ‘‘beta-like-globin’’

gene domain in human erythroid cells, Proc. Natl. Acad. Sci. U. S. A.

82 (1985) 6384–6388.

[5] D.R. Higgs, Do LCRs open chromatin domains? Cell 95 (1998)

299–302.

[6] J.A. Lloyd, J.M. Krakowsky, S.C. Crable, J.B. Lingrel, Human gam-

ma- to beta-globin gene switching using a mini construct in transgenic

mice, Mol. Cell. Biol. 12 (1992) 1561–1567.

[7] B.J. Morley, C.A. Abbott, J.A. Sharpe, J. Lida, P.S. Chan-Thomas,

W.G. Wood, A single beta-globin locus control region element (5Vhypersensitive site 2) is sufficient for developmental regulation of

human globin genes in transgenic mice, Mol. Cell. Biol. 12 (1992)

2057–2066.

[8] D. Talbot, S. Philipsen, P. Fraser, F. Grosveld, Detailed analysis of the

site 3 region of the human beta-globin dominant control region,

EMBO J. 9 (1990) 2169–2177.

[9] P.A. Ney, B.P. Sorrentino, K.T. McDonagh, A.W. Nienhuis, Tandem

AP-1-binding sites within the human beta-globin dominant control

region function as an inducible enhancer in erythroid cells, Genes

Dev. 4 (1990) 993–1006.

[10] D.Y. Tuan, W.B. Solomon, I.M. London, D.P. Lee, An erythroid-

specific, developmental-stage-independent enhancer far upstream of

the human ‘‘beta-like globin’’ genes, Proc. Natl. Acad. Sci. U. S. A.

86 (1989) 2554–2558.

[11] P.M. Reddy, C.K. Shen, Protein –DNA interactions in vivo of an

erythroid-specific, human beta-globin locus enhancer, Proc. Natl.

Acad. Sci. U. S. A. 88 (1991) 8676–8680.

[12] T. Ikuta, Y.W. Kan, In vivo protein–DNA interactions at the beta-

globin gene locus, Proc. Natl. Acad. Sci. U. S. A. 88 (1991)

10188–10192.

[13] J.J. Caterina, D.J. Ciavatta, D. Donze, R.R. Behringer, T.M. Townes,

Multiple elements in human beta-globin locus control region 5V HS 2

are involved in enhancer activity and position-independent, transgene

expression, Nucleic Acids Res. 22 (1994) 1006–1011.

[14] Q. Gong, A. Dean, Enhancer-dependent transcription of the epsilon-

globin promoter requires promoter-bound GATA-1 and enhancer-

bound AP-1/NF-E2, Mol. Cell. Biol. 13 (1993) 911–917.

[15] Q. Li, S. Harju, K.R. Peterson, Locus control regions: coming of age

at a decade plus, Trends Genet. 15 (1999) 403–408.


[16] M.J. Cairns, V. Murray, Detection of protein–DNA interactions at

beta-globin gene cluster in intact human cells utilizing hedamycin

as DNA-damaging agent, DNA Cell Biol. 17 (1998) 325–333.

[17] A. Kim, V. Murray, A large ‘‘footprint’’ at the boundary of the human

beta-globin locus control region hypersensitive site-2, Int. J. Biochem.

Cell Biol. 32 (2000) 695–702.

[18] A.R. Kim, V. Murray, Chromatin structure at the 3V-boundary of the

human beta-globin locus control region hypersensitive site-2, Int. J.

Biochem. 33 (2001) 1183–1192.

[19] A. Almer, W. Horz, Nuclease hypersensitive regions with adjacent

positioned nucleosomes mark the gene boundaries of the PHO5/

PHO3 locus in yeast, EMBO J. 5 (1986) 2681–2687.

[20] G.H. Thomas, S.C. Elgin, Protein/DNA architecture of the DNase I

hypersensitive region of the Drosophila hsp26 promoter [erratum

appears in EMBO J 1988 Oct;7(10):3300], EMBO J. 7 (1988)

2191–2201.

[21] S.D. Willis, M.A. Seyfred, Pituitary-specific chromatin structure of

the rat prolactin distal enhancer element, Nucleic Acids Res. 24

(1996) 1065–1072.

[22] M.J. Pazin, P. Bhargava, E.P. Geiduschek, J.T. Kadonaga, Nucleo-

some mobility and the maintenance of nucleosome positioning, Sci-

ence 276 (1997) 809–812.

[23] T. Agalioti, S. Lomvardas, B. Parekh, J. Yie, T. Maniatis, D. Thanos,

Ordered recruitment of chromatin modifying and general transcription

factors to the IFN-beta promoter, Cell 103 (2000) 667–678.

[24] G. Fragoso, S. John, M.S. Roberts, G.L. Hager, Nucleosome posi-

tioning on the MMTV LTR results from the frequency-biased occu-

pancy of multiple frames, Genes Dev. 9 (1995) 1933–1947.

[25] M.S. Roberts, G. Fragoso, G.L. Hager, Nucleosomes reconstituted in

vitro on mouse mammary tumor virus B region DNA occupy mul-

tiple translational and rotational frames, Biochemistry 34 (1995)

12470–12480.

[26] E.Y. Shim, C. Woodcock, K.S. Zaret, Nucleosome positioning by

the winged helix transcription factor HNF3, Genes Dev. 12 (1998)

5–10.

[27] S. Belikov, B. Gelius, O. Wrange, Hormone-induced nucleosome

positioning in the MMTV promoter is reversible, EMBO J. 20

(2001) 2802–2811.

[28] M. Shimizu, S.Y. Roth, C. Szent-Gyorgyi, R.T. Simpson, Nucleo-

somes are positioned with base pair precision adjacent to the alpha

2 operator in Saccharomyces cerevisiae, EMBO J. 10 (1991)

3033–3041.

[29] M.J. Fedor, N.F. Lue, R.D. Kornberg, Statistical positioning of nucle-

osomes by specific protein-binding to an upstream activating se-

quence in yeast, J. Mol. Biol. 204 (1988) 109–127.

[30] Q. Lu, L.L. Wallrath, H. Granok, S.C. Elgin, (CT)n (GA)n repeats and

heat shock elements have distinct roles in chromatin structure and

transcriptional activation of the Drosophila hsp26 gene, Mol. Cell.

Biol. 13 (1993) 2802–2814.

[31] D.I. Martin, S.H. Orkin, Transcriptional activation and DNA binding

by the erythroid factor GF-1/NF-E1/Eryf 1, Genes Dev. 4 (1990)

1886–1898.

[32] J.G. Omichinski, C. Trainor, T. Evans, A.M. Gronenborn, G.M. Clore,

G. Felsenfeld, A small single-‘‘finger’’ peptide from the erythroid tran-

scription factor GATA-1 binds specifically to DNA as a zinc or iron

complex, Proc. Natl. Acad. Sci. U. S. A. 90 (1993) 1676–1680.

[33] C.D. Trainor, J.G. Omichinski, T.L. Vandergon, A.M. Gronenborn,

G.M. Clore, G. Felsenfeld, A palindromic regulatory site within ver-

tebrate GATA-1 promoters requires both zinc fingers of the GATA-1

DNA-binding domain for high-affinity interaction, Mol. Cell. Biol. 16

(1996) 2238–2247.

[34] J.G. Omichinski, G.M. Clore, O. Schaad, G. Felsenfeld, C. Trainor, E.

Appella, S.J. Stahl, A.M. Gronenborn, NMR structure of a specific

DNA complex of Zn-containing DNA binding domain of GATA-1,

Science 261 (1993) 438–446.

[35] Y. Fujiwara, C.P. Browne, K. Cunniff, S.C. Goff, S.H. Orkin, Arrested

development of embryonic red cell precursors in mouse embryos

lacking transcription factor GATA-1, Proc. Natl. Acad. Sci. U. S. A.

93 (1996) 12355–12358.

[36] M.J. Weiss, G. Keller, S.H. Orkin, Novel insights into erythroid de-

velopment revealed through in vitro differentiation of GATA-1 em-

bryonic stem cells, Genes Dev. 8 (1994) 1184–1197.

[37] M.J. Weiss, S.H. Orkin, Transcription factor GATA-1 permits survival

and maturation of erythroid precursors by preventing apoptosis, Proc.

Natl. Acad. Sci. U. S. A. 92 (1995) 9623–9627.

[38] J. Boyes, G. Felsenfeld, Tissue-specific factors additively increase the

probability of the all-or-none formation of a hypersensitive site,

EMBO J. 15 (1996) 2496–2507.

[39] J.A. Stamatoyannopoulos, A. Goodwin, T. Joyce, C.H. Lowrey, NF-

E2 and GATA binding motifs are required for the formation of DNase

I hypersensitive site 4 of the human beta-globin locus control region,

EMBO J. 14 (1995) 106–116.

[40] H.S. Choi, Z. Lin, B.S. Li, A.Y. Liu, Age-dependent decrease in the

heat-inducible DNA sequence-specific binding activity in human dip-

loid fibroblasts, J. Biol. Chem. 265 (1990) 18005–18011.

[41] M. Crossley, A.P. Tsang, J.J. Bieker, S.H. Orkin, Regulation of the

erythroid Kruppel-like factor (EKLF) gene promoter by the ery-

throid transcription factor GATA-1, J. Biol. Chem. 269 (1994)

15440–15444.

[42] T. Tamaki, K. Ohnishi, C. Hartl, E.C. LeRoy, M. Trojanowska, Char-

acterization of a GC-rich region containing Sp1 binding site(s) as a

constitutive responsive element of the alpha 2(I) collagen gene in

human fibroblasts, J. Biol. Chem. 270 (1995) 4299–4304.

[43] J.R. Flanagan, K.G. Becker, D.L. Ennist, S.L. Gleason, P.H. Driggers,

B.Z. Levi, E. Appella, K. Ozato, Cloning of a negative transcription

factor that binds to the upstream conserved region of Moloney murine

leukemia virus, Mol. Cell. Biol. 12 (1992) 38–44.

[44] M. Merika, S.H. Orkin, DNA-binding specificity of GATA family

transcription factors, Mol. Cell. Biol. 13 (1993) 3999–4010.

[45] R.R. Bharadwaj, C.D. Trainor, P. Pasceri, J. Ellis, LCR-regulated

transgene expression levels depend on the Oct-1 site in the AT-rich

region of beta -globin intron-2, Blood 101 (2003) 1603–1610.

[46] T.R. Rutherford, D.J. Weatherall, Deficient heme synthesis as the

cause of noninducibility of hemoglobin synthesis in a Friend eryth-

roleukemia cell line, Cell 16 (1979) 415–423.

[47] C.E. Horak, M.C. Mahajan, N.M. Luscombe, M. Gerstein, S.M.

Weissman, M. Snyder, GATA-1 binding sites mapped in the beta-

globin locus by using mammalian chIp-chip analysis, Proc. Natl.

Acad. Sci. U. S. A. 99 (2002) 2924–2929.

[48] R. Martienssen, Chipping away at chromatin [comment], Nat. Genet.

27 (2001) 240–241.

[49] M. Crossley, M. Merika, S.H. Orkin, Self-association of the erythroid

transcription factor GATA-1 mediated by its zinc finger domains,

Mol. Cell. Biol. 15 (1995) 2448–2456.

[50] A.P. Tsang, J.E. Visvader, C.A. Turner, Y. Fujiwara, C. Yu, M.J. Weiss,

M. Crossley, S.H. Orkin, FOG, a multitype zinc finger protein, acts as a

cofactor for transcription factor GATA-1 in erythroid and megakaryo-

cytic differentiation, Cell 90 (1997) 109–119.

[51] M. Merika, S.H. Orkin, Functional synergy and physical interactions

of the erythroid transcription factor GATA-1 with the Kruppel family

proteins Sp1 and EKLF, Mol. Cell. Biol. 15 (1995) 2437–2447.

[52] C.M. Kiekhaefer, J.A. Grass, K.D. Johnson, M.E. Boyer, E.H.

Bresnick, Hematopoietic-specific activators establish an overlapping

pattern of histone acetylation and methylation within a mammalian

chromatin domain, Proc. Natl. Acad. Sci. U. S. A. 99 (2002)

14309–14314.

[53] D.L. Letting, C. Rakowski, M.J. Weiss, G.A. Blobel, Formation of a

tissue-specific histone acetylation pattern by the hematopoietic tran-

scription factor GATA-1, Mol. Cell. Biol. 23 (2003) 1334–1340.

[54] K.D. Johnson, J.A. Grass, M.E. Boyer, C.M. Kiekhaefer, G.A. Blobel,

M.J. Weiss, E.H. Bresnick, Cooperative activities of hematopoietic

regulators recruit RNA polymerase II to a tissue-specific chromatin

domain, Proc. Natl. Acad. Sci. U. S. A. 99 (2002) 11760–11765.

[55] Z. Duan, G. Stamatoyannopoulos, Q. Li, Role of NF-Y in in vivo


regulation of the gamma-globin gene, Mol. Cell. Biol. 21 (2001)

3083–3095.

[56] Y.L. Yu, Y.J. Chiang, J.J. Yen, GATA factors are essential for tran-

scription of the survival gene E4bp4 and the viability response of

interleukin-3 in Ba/F3 hematopoietic cells, J. Biol. Chem. 277

(2002) 27144–27153.

[57] J. Boyes, J. Omichinski, D. Clark, M. Pikaart, G. Felsenfeld, Pertur-

bation of nucleosome structure by the erythroid transcription factor

GATA-1, J. Mol. Biol. 279 (1998) 529–544.

[58] M. Hu, D. Krause, M. Greaves, S. Sharkis, M. Dexter, C. Heyworth,

T. Enver, Multilineage gene expression precedes commitment in the

hemopoietic system, Genes Dev. 11 (1997) 774–785.

[59] R. Hardison, Hemoglobins from bacteria to man: evolution of differ-

ent patterns of gene expression, J. Exp. Biol. 201 (1998) 1099–1117.

[60] S.M. Jane, P.A. Ney, E.F. Vanin, D.L. Gumucio, A.W. Nienhuis,

Identification of a stage selector element in the human gamma-globin

gene promoter that fosters preferential interaction with the 5V HS2

enhancer when in competition with the beta-promoter, EMBO J. 11

(1992) 2961–2969.

[61] K.M. Leach, K. Nightingale, K. Igarashi, P.P. Levings, J.D. Engel,

P.B. Becker, J. Bungert, Reconstitution of human beta-globin locus

control region hypersensitive sites in the absence of chromatin assem-

bly, Mol. Cell. Biol. 21 (2001) 2629–2640.

[62] S.R. Yant, W. Zhu, D. Millinoff, J.L. Slightom, M. Goodman, D.L.

Gumucio, High affinity YY1 binding motifs: identification of two

core types (ACAT and CCAT) and distribution of potential binding

sites within the human beta globin cluster, Nucleic Acids Res. 23

(1995) 4353–4362.

[63] D.A. Shelton, L. Stegman, R. Hardison, W. Miller, J.H. Bock, J.L.

Slightom, M. Goodman, D.L. Gumucio, Phylogenetic footprinting

of hypersensitive site 3 of the beta-globin locus control region,

Blood 89 (1997) 3457–3469.

[64] B. Peters, N. Merezhinskaya, J.F. Diffley, C.T. Noguchi, Protein–

DNA interactions in the epsilon-globin gene silencer, J. Biol. Chem.

268 (1993) 3430–3437.

[65] N. Raich, C.H. Clegg, J. Grofti, P.H. Romeo, G. Stamatoyannopoulos,

GATA1 and YY1 are developmental repressors of the human epsilon-

globin gene, EMBO J. 14 (1995) 801–809.

[66] J. Bungert, U. Dave, K.C. Lim, K.H. Lieuw, J.A. Shavit, Q. Liu, J.D.

Engel, Synergistic regulation of human beta-globin gene switching by

locus control region elements HS3 and HS4, Genes Dev. 9 (1995)

3083–3096.

[67] E. Milot, J. Strouboulis, T. Trimborn, M. Wijgerde, E. de Boer, A.

Langeveld, K. Tan-Un, W. Vergeer, N. Yannoutsos, F. Grosveld, P.

Fraser, Heterochromatin effects on the frequency and duration of

LCR-mediated gene transcription, Cell 87 (1996) 105–114.

[68] P.A. Navas, K.R. Peterson, Q. Li, E. Skarpidi, A. Rohde, S.E. Shaw,

C.H. Clegg, H. Asano, G. Stamatoyannopoulos, Developmental spec-

ificity of the interaction between the locus control region and embry-

onic or fetal globin genes in transgenic mice with an HS3 core

deletion, Mol. Cell. Biol. 18 (1998) 4188–4196.

[69] J. Bungert, K. Tanimoto, S. Patel, Q. Liu, M. Fear, J.D. Engel, Hy-

persensitive site 2 specifies a unique function within the human beta-

globin locus control region to stimulate globin gene transcription,

Mol. Cell. Biol. 19 (1999) 3062–3072.

[70] J.M. Molete, H. Petrykowska, E.E. Bouhassira, Y.Q. Feng, W. Miller,

R.C. Hardison, Sequences flanking hypersensitive sites of the beta-

globin locus control region are required for synergistic enhancement,

Mol. Cell. Biol. 21 (2001) 2969–2980.

[71] C. May, S. Rivella, J. Callegari, G. Heller, K.M. Gaensler, L. Luzzatto,

M. Sadelain, Therapeutic haemoglobin synthesis in beta-thalassaemic

mice expressing lentivirus-encoded human beta-globin, Nature 406

(2000) 82–86.

[72] M. Wijgerde, F. Grosveld, P. Fraser, Transcription complex stability

and chromatin dynamics in vivo, Nature 377 (1995) 209–213.

[73] Y. Onishi, Y. Wada-Kiyama, R. Kiyama, Expression-dependent per-

turbation of nucleosomal phases at HS2 of the human beta-LCR:

possible correlation with periodic bent DNA, J. Mol. Biol. 284

(1998) 989–1004.

[74] Y. Onishi, R. Kiyama, Enhancer activity of HS2 of the human beta-

LCR is modulated by distance from the key nucleosome, Nucleic

Acids Res. 29 (2001) 3448–3457.

chromatin structure at the flanking regions of the human beta-globin locus control region dnase i...

Documents