Gene 543 (2014) 253–258

Contents lists available at ScienceDirect

Gene

j ourna l homepage: www.e lsev ie r .com/ locate /gene

Chromium downregulates the expression of Acetyl CoA Carboxylase 1gene in lipogenic tissues of domestic goats: a potential strategy for meatquality improvement

Mohammad Javad Najafpanah ⁎, Mostafa Sadeghi ⁎, Abolfazl Zali,Hossein Moradi-shahrebabak, Hojatollah MousapourDepartment of Animal Science, College of Agriculture and Natural Resources, University of Tehran, Karaj, Iran

Abbreviations: ACC1, Acetyl CoA Carboxylase 1; ACC2,90, Heat shock protein 90 gene; ACC2, Acetyl CoA Capalmitoyltransferase 1; BW, Body Weight; H, Hour; RTPCR; Q-RT-PCR, Quantitative Real-time PCR (Real-timeQuGeneral Linier Model procedure; cDNA, DNA complemeRNA; DNase, deoxyribonuclease; dNTP, deoxyribonucleos⁎ Corresponding authors.

E-mail addresses: mjnajafpanah@ut.ac.ir (M.J. Najafpa(M. Sadeghi).

http://dx.doi.org/10.1016/j.gene.2014.04.0060378-1119/© 2014 Elsevier B.V. All rights reserved.

a b s t r a c t

a r t i c l e i n f o

Article history:Received 21 January 2014Received in revised form 31 March 2014Accepted 2 April 2014Available online 3 April 2014

Keywords:Expression of ACC1Adipose tissueDownregulationMeat qualityChromium

Acetyl CoA Carboxylase 1 (ACC1) is a biotin-dependent enzyme that catalyzes the carboxylation of Acetyl CoA toformMalonyl CoA, the key intermediate metabolite in fatty acid synthesis. In this study, themRNA expression ofthe ACC1 gene was evaluated in four different tissues (liver, visceral fat, subcutaneous fat, and longissimus mus-cle) of the domestic goat (Capra hircus) kids feeding on four different levels of trivalent chromium (0, 0.5, 1, and1.5 mg/day) as food supplementation. RT-qPCR technique was used for expression analyses and heat shockprotein 90 gene (HSP-90) was considered as reference gene for data normalization. Our results revealed that1.5 mg/day chromium significantly reduced the expression of the ACC1 gene in liver, visceral fat, and subcutane-ous fat tissues, but not in longissimusmuscles (P b 0.05). Wemeasured some phenotypic traits of kid's carcassesto detect their probable correlations with chromium-mediated downregulation of ACC1 expression. Interesting-ly, changes in ACC1 expression were accompanied with decreased accumulation of fats in adipose tissues suchthat the subcutaneous fat thickness and heart fat percentage decreased in kids feeding on chromium. By contrast,chromium supplemented kids showed higher percentage ofmuscles despite the fact that their total bodyweightdid not differ from that of non-supplemented kids. Our study suggests that trivalent chromium alters the direc-tion of energy accumulation towardsmuscles rather than fats and provides insights into application of chromiumsupplementation as a useful strategy for improvement of meat quality in domestic animals.

© 2014 Elsevier B.V. All rights reserved.

1. Introduction

The Fertile Crescent region, stretching from the southern Levant insoutheastern Turkey and northern Syria to the high Zagros mountainpastures of Iran, is thought to be the center of domestication for someof the most important arrays of agricultural crops and livestock animalsincluding barley, wheat, sheep, and goat (Zeder and Hesse, 2000). Thedomestic goats, Capra hircus, are one of the oldest domesticated animals(Zeder and Hesse, 2000) that are extensively reared throughout theworld due to their excellent importance as sources of milk, meat, fiberand pelt (Dong et al., 2012). A recent study revealed that goat meat is

Acetyl CoA Carboxylase 2; HSP-rboxylase 1; CPT-1, Carnitine-qPCR, Real-time Quantitativeantitative PCR); GLMprocedure,ntary to RNA; rRNA, ribosomalide triphosphate.

nah), sadeghimos@ut.ac.ir

the most widely consumed red meat eaten by more than 70% of theworld population (www.agric.wa.gov.au).

The fat present in red meat supplies essential fatty acids and vita-mins and plays an essential role in sensory perception of juiciness, flavorand texture. However, redmeat is usually considered a foodwith exces-sively high fat concentration and is believed to cause a variety of humandiseases because of its high proportion of detrimental fatty acids (Daleyet al., 2010; Moloney, 2002; Wood et al., 2003). Hence, health profes-sionals recommend a reduction in the overall consumption of inferiorfats especially saturated fatty acids (Daley et al., 2010). This may beachieved by reducing the total fat content or improving the fat compo-sition of meat (Wood et al., 2003).

Acetyl-CoA carboxylase (ACC) is a biotin-dependent enzyme thatcatalyzes the carboxylation of acetyl-CoA to produce malonyl-CoAsubstrate for the biosynthesis of fatty acids (Bengtsson et al., 2011).Mammalian ACC exists as two isoforms: ACC1 and ACC2 that aredifferently distributed across tissues (Oh et al., 2005). At energy surplus,ACC1 converts acetyl-CoA into malonyl-CoA for lipogenesis in the cytosolof lipogenic tissues such as liver and adipose tissue, while the ACC2, pres-ent typically on themitochondrial surface, stimulates the same process togenerate malonyl-CoA for the inhibition of carnitine palmitoyltransferase

Table 1Ingredient and chemical composition of basal standard diet fed to goat kids.

Ingredient % of DM Ingredient % of DM

Alfalfa hay 16.49 Soybean meal 2.21Corn silage 8.32 Calcium carbonate 1.3Wheat straw 5.19 Mineral–vitamin supplementa 0.91Barley grain 51 Sodium bicarbonate 0.78Wheat bran 9.09 Salt 0.52Canola meal 4.55

Nutrient fractionsDM (%) 80.78 ME (Mcal/kg DM) 36.6CP (% DM) 13.5 Calcium (% DM) 0.89Ether extract (% DM) 2.6 Phosphorus (% DM) 0.49NDF (% DM) 36.6 Chromium (% DM) 0.83Ash (% DM) 9

a Containing per kg DM: calcium, 195 g; phosphor, 80 g;magnesium, 21,000 mg; sodi-um, 50 g; manganese, 2200 mg; iron, 3000 mg; copper, 300 mg; iodine, 120 mg; cobalt,100 mg; zinc, 300 mg; selenium, 1.1 mg; antioxidant, 2500 mg; vitamin A, 600,000 IU;Vitamin D3, 200,000 IU; vitamin E, 200 mg.

254 M.J. Najafpanah et al. / Gene 543 (2014) 253–258

1 (CPT-1) and mitochondrial fatty acid oxidation (Bengtsson et al., 2011;Oh et al., 2005). Therefore, the two ACC isoforms play crucial roles in fattyacid biosynthesis in human and some other living organisms (Tong andHarwood, 2006). Because of its unique position in lipid metabolism (Ohet al., 2005), inhibition of ACCs has been proposed to reduce lipogenesisand favor lipid oxidation, therebypreventing deleterious lipids fromaccu-mulating in oxidative tissues such as muscles, heart, and liver (Bengtssonet al., 2011; Tong and Harwood, 2006). In recent years, the use of ACCenzymes as suitable targets for reducing tissue fatty acids and treatingmetabolic disorders (e.g. obesity, diabetes, and hyperlipidemia) has expe-rienced increasing attention (Abu-Elheiga et al., 2003; Bengtsson et al.,2011; Bhadauriya et al., 2013; Savage et al., 2006). For example, it hasbeen suggested that mice lacking ACC2 gene show high levels of fattyacid oxidation and accumulate 50% less fat in their adipose tissue whencompared to wild-type mice (Abu-Elheiga et al., 2003). In anotherstudy, suppression of ACC1 and ACC2 gene expression using antisenseoligonucleotides has been shown to stimulate fat oxidation in rat hepato-cytes (Savage et al., 2006). These findings incline us to think about theidea that themodification of ACC or its encoding genemay potentially de-crease the accumulation of fatty acids in muscles and improve meatquality.

Chromiumhas beenwidely applied as an essential supplemental nu-trition for human and laboratory animals (Swanson et al., 2000). The tri-valent form of chromium (Cr+3) is an important structural element ofglucose tolerance factor (GTF) which increases glucose tolerance by po-tentiating the action of insulin and so, shunts more energy towardsgrowth and reproduction (Swanson et al., 2000). Therefore, it is awell-knownultra-trace element essential for normalmetabolismof car-bohydrates, lipids, proteins, and nucleic acids besides its extra roles inhormonal regulation, weight gain, improved dressing percentage andlongissimus muscle area, and immunity against pathogens (Anderson,1994; Emami et al., 2012; Haldar et al., 2009; Pechova et al., 2002). Ina previous study carried out aimed at selection of a suitable referencegene in the domestic goats, we found unexpectedly that the geneencodingACC1 enzyme (ACC1) showed highdegrees of instability in ex-pression status when different levels of chromium were added to theirstandard diet (unpublished data). We hypothesized that downregula-tion of ACC1 expression by chromiummay eventually leads to decreasein the overall fat content of goat carcass, a process that can be effectivelyapplied to improve red meat quality for human consumption. To testthis hypothesis, in the current study,we evaluated the expression statusof ACC1 in goat kids feeding on different levels of chromium.

2. Materials and methods

2.1. Animal husbandry and experimental design

This study was conducted at the Research Station of Department ofAnimal Science, College of Agriculture andNatural Resources, Universityof Tehran, Iran. The studied animals include twenty-four, 4 to 5-monthold male goat kids belonging to the native Iranian breed, Mahabadi.Complete random design (CRD) with 4 treatments and 6 replicates ineach treatmentwas the experimental design. All procedures of immuni-ty and nutrition were conducted under protocols approved by thisstation.

After weighing (BW=22±2 kg), the kidswere randomly allocatedto one of the four following dietary treatments: standard diet plus 0, 0.5,1, and 1.5 mg chromium per day as chromium-methionine (Availa®Cr1000, Zinpro Corporation, USA). The standard diet was balanced andprepared using NRC computer software (see Table 1). Chromium sup-plementation was exposed to the kids before each morning nutritionmeal as a pulverized powder mixed with 50 g barley. The kids were in-dividually penned for 100 days (10 days for adaptation and 90 days forfeeding period), with accessibility to enough water, and provided withthe prepared diets twice a day (08:00 h and 17:00 h). The kids wereweighed before the morning feeding meal triweekly (i.e. after 14–16 h

of starvation) throughout the experiment period to determine changesin their body weight.

2.2. Slaughtering and tissue sampling

Slaughtering, transport and invasive procedures on these animals in-clude a statement indicating approval by the appropriate ethics/welfarecommittee confirming compliancewith all requirements of the countryin which the experiments were conducted. After feeding on the pre-pared diets for 90 days, the kids were transferred to the departmentalabattoir, where they were kept for 12 h under starvation with free accessto water. They were then slaughtered via decapitation and samples weretaken from the liver, visceral fat, subcutaneous fat, and longissimus mus-cle. The samples were immediately frozen in liquid nitrogen (−196 °C)and transferred to the laboratory, where they were maintained at−80 °C until used.

2.3. Total RNA isolation, clean up and cDNA synthesis

Total RNA was extracted according to the method of Chomczynskiand Sacchi (2006) using Trizol Reagent (Invitrogen Co., Carlsbad, CA,USA). The extracted RNA was then treated with RNase-free DNase I inorder to remove the remnant genomic DNA from the samples (TaKaRa,Shuzo, Kyoto, Japan). RNA concentrations were estimated by Nanodropspectrophotometry at 260 nmand their puritieswere checked by deter-mining the absorption ratios at 260/280 nm. The quality of extractedRNA was assessed by electrophoresis at 1% agarose-gel containingEthidium Bromide. First-strand cDNA was synthesized from 100 ng oftotal RNA using an oligo (dT) primer, random hexamers and a commer-cially available kit (AccuPower® RocketScript™ RT PreMix) accordingto the manufacturer's instructions. The process of cDNA synthesis initi-ates by connection of the primers at 37 °C for 1 min followed by cDNAsynthesis at 50 °C for 60 min and terminates by inactivation of the re-verse transcriptase enzyme at 90 °C for 5 min. The synthesized cDNAwas incubated at−20 °C until used.

2.4. Reference gene

It iswidely argued that some factors includingRNA stability, RNAex-traction, retrotranscription efficiency, PCR steps, etc., may negatively af-fect the accuracy and reliability of the results obtained for RT-qPCR andgene expression analysis studies (Han et al., 2012). To overcome thisproblem, a common procedure is to normalize the total amounts ofRNA or a single internal reference gene known as HouseKeeping gene(Bustin, 2002). An ideal reference gene is expected to be stable interms of expression level across various experimental conditions suchas developmental stages, tissue types, treatments, and external stimuli

255M.J. Najafpanah et al. / Gene 543 (2014) 253–258

(Fan et al., 2013). We have previously studied the stability of nine can-didate reference genes in four different tissues (liver, visceral fat, subcu-taneous muscle, and longissimus muscle) and for kids feeding on twonutritional diets based on presence or absence of chromium. In the re-cent project we found that the gene encoding for the heat shock protein90 (HSP-90) showed the most stability in expression across all studiedtissues and experimental conditions (Najafpanah et al., 2013). Thus,HSP-90 was selected as reference gene for normalization of expressiondata at the current study.

2.5. Primer designing

The nucleotide sequences of the ACC gene and HSP-90 referencegene belonging to the domestic goat (C. hircus) were obtained fromthe public databases (GenBank, National Center for BiotechnologyInformation). Primer pairs were designed from these sequences(optimal Tm at 59.8 °C and GC% between 45 and 50%) usingprimer3Plus (Untergasser et al., 2007) and Primer3 (Rozen andSkaletsky, 2000) online software programs (Table 2) and checkedfor suitability using OligoAnalyzer 3.1 (http://eu.idtdna.com/analyzer/applications/oligoanalyzer/) and OligoCalc (Kibbe, 2007).The specificity of the designed primers was evaluated usingPrimerBLAST software of NCBI database (Ye et al., 2012).

2.6. Real-time RT-PCR

Real-time Quantitative PCRwas performed using SYBR Green I tech-nology on iQ5 System (BioRad, USA). The reactions consisted of 10 μLSYBR Green PCR Master Mix (SYBR biopars, GUASNR, Iran), 10 pMol(1 μL) of each specific forward and reverse primers, 3 μL of cDNA, and5 μL nuclease free water to a final volume of 20 μL. RT-qPCR was per-formed for samples taken from four different tissues, and six biologicalreplicates, 3 experimental replicates, and one control were consideredfor each reaction.

The PCR temperature profiles consisted of an initial denaturation at95 °C for 30 s followed by 35 cycles at 95 °C (denaturation, 10 s),59.8 °C (annealing, 10 s), and 72 °C (elongation, 10 s) and a final exten-sion at 72 °C for 5 min. The amplified DNAwas incubated at 4 °C. 5.5 μLof the PCR amplified product was purified by use of horizontal electro-phoresis in a 2% agarose gel and visualized by ethidium bromide to con-firm the specificity of amplified fragments.

The efficiency of real-time RT-PCR was assessed for each gene basedon the slope of a linear regressionmodel (Pfaffl, 2001). The bulks of eachcDNA sample were used as PCR template to produce a graph of thresh-old cycle (CT) in a range of 10-fold dilution series. The correspondingreal-time RT-PCR efficiencies were calculated based on the slope of thestandard curve using the following equation: (E = 10 − 1 / slope − 1)(Radonic et al., 2004). A melting curve analysis was conducted for eachamplificationbetween55 and95 °C to eliminate anynon-specific productsuch as primer-dimers.

2.7. Correlation with phenotypic traits

In order to clarify any correlation between the chromium-mediatedalterations in ACC1 expression and phenotypic traits of the domesticgoats, a set of animal properties including the subcutaneous fat thick-ness, heart weight, heart fat weight and percentage, body weight at

Table 2Sequence and some characterization of specific primer pairs for ACC1 gene and the selected re

Gene name Accession number Sense primer sequence5′ → 3′

HSP-90 AF548366.1 GCCCGAGATAGAAGACGTTGACAC AB232537.1 CGCTATGGAAGTCGGCTGTG

the time of slaughtering, and the area of the longissimus muscle werecompared among goat kids fed on different levels of chromium.

2.8. Data analysis

Analysis of RT-qPCR data was performed according to themethod ofLivak and Schmittgen (2001). In our study, HSP-90 was served as refer-ence gene to calculate the initial Ct values. The mean Ct value was calcu-lated for both HSP-90 and ACC1 genes and theΔCt valuewas determinedusing the following formula:

ΔCt ¼ CtACC1ð Þ

–CtHSP−90ð Þ

:

After calculation of ΔCt for all samples taken from different tissuesand from kids fed on different chromium levels, the expression statusof ACC1 relative to HSP-90 was estimated using the following formula(Livak and Schmittgen, 2001):

RE ¼ 2−ΔΔCt ¼ 2− ΔCt ACC1ð Þ−ΔCt HSP−90ð Þ:ð

All data were statistically analyzed using SAS computer softwareversion 9.1 (SAS Institute Inc., Cary, NC, USA). The average expressionvalues of different diets were exposed to analysis of variance (ANOVA)using the GLM procedure of SAS software at the level of 0.05. Themodel included treatment, tissue and slaughter weight as fixed effectsand animal effect as random effect and the interaction effect amongdiets and tissues. As many factors were not significant in the model,the final model included only treatment and animal effects.

3. Results

In this study, four different levels of chromium (0, 0.5, 1, and1.5 mg/day) were used for feeding of the domestic goat kids and ef-fects of these diets on ACC1 gene expression in four different tissues,including liver, visceral fat, subcutaneous fat, and longissimus mus-cles were evaluated using Real-time qPCR technique. The specificityof our amplifications was validated by analysis of melting curve,which was generated at the end of each reaction. Both ACC1 andHSP-90 genes provided a single peak in the melting curve implyingon the absence of primer-dimer formation during the reaction, thusconfirming the specificity of our amplifications.

The efficiency and linearity of our RT-qPCR reactionswere evaluatedusing the 10-fold serial dilutions. The relationship between thresholdcycle (Ct) and the log copy numbers of cDNA for the two studiedgenes was linear. Moreover, the efficiency of our amplifications wasconfirmed near the theoretical optimum level of 2 (Wilkening andBader, 2004), where the efficiency values ranged from 1.81 to 2.08.

Ct values in the different tissues and groups ranged from 26.2 to30.86 for ACC1 and from 26.8 to 30.84 for HSP-90. The nearly equal Ctvalue for ACC1 and HSP-90 indicates that these genes reach the detec-tion thresholdwith the same amounts of amplification cycles, indicatingthat they are nearly equal in abundance in the four studied tissues.

The mRNA expression for the ACC1 gene showed a descendingpattern in liver of the studied goat kids by increasing chromium intheir diet (Fig. 1). There was a significant difference in expression ofACC1 gene in kids feeding on 1.5 mg chromium per day compared toother treatments. Although, ACC1 was downregulated in liver of kidsfeeding on 0.5 and 1.5 mg chromium per day compared to the control,

ference gene, HSP-90.

Anti-sense primer sequence5′ → 3′

Length(bp)

Tm(°C)

AGTCGTTGGTCAGGCTCTTG 197 59.8CAGGAAGAGGCGGATGGGAA 105 59.8

Fig. 1. Relative expression of ACC1 gene in four different tissues (liver, visceral fat, subcutaneous fat, and longissimus muscle) of goat kids feeding on four different levels of chromium(0, 0.5, 1, and 1.5 mg/day).

Fig. 2. The distribution of subcutaneous fat thickness (n = 6) in goat kids feeding on fourdifferent levels of chromium for a 90-day period.

256 M.J. Najafpanah et al. / Gene 543 (2014) 253–258

there was no significant difference between these treatments (one wayANOVA: P = 0.02) (Fig. 1).

A descending trend, similar to liver tissue, was observed inexpression of ACC1 in visceral fat of goat kids when the quantityof chromium was elevated from 0 to 1.5 mg per day (Fig. 1). Inthis tissue, 1 and 1.5 mg chromium per day significantly decreasedthe expression of ACC1; however, there was no significant differ-ence between expression status of ACC1 in the two first treatments(one-way ANOVA: P = 0.002) (Fig. 1).

In subcutaneous muscles, the mRNA expression was greater in kidsfeeding on 0.5 mg chromium per day followed by those feeding on 0,1, and 1.5 mg/day (Fig. 1). The expression of ACC1 in kids feeding on1.5 mg chromium per day was statistically different from other treat-ments (one way ANOVA: P = 0.05) (Fig. 1). The expression of mRNAin the longissimus muscle was not affected by increase in chromiumsupplementation (one way ANOVA: P = 0.30). In this tissue, most ofthe expression intensitywas observed in kids feeding on 0.5mg chromi-um per day followed by those feeding on 0, 1, 1 and 1.5 mg chromiumper day, respectively (Fig. 1). Altogether, the expression of mRNA inkids feeding only on standard diet without any chromium supplemen-tation (i.e. control) was greater in subcutaneous muscles followed byliver, visceral fat, and longissimus muscle, respectively (see Fig. 1).

The thickness of subcutaneous fat was significantly different amongkids feeding on different levels of chromium. The least thicknesswas re-corded in kids feeding on1.5 mg/day chromium followedby those feed-ing on 1, 0.5, and 0 mg/day (one-wayANOVA, df=23, P b 0.05) (Fig. 2).We found a positive correlation between chromium-mediated mRNAexpression of ACC1 and subcutaneous fat thickness in liver of kids treat-ed with chromium (r = 0.43, P b 0.01). Similar correlations wereobserved between ACC1 expression and subcutaneous fat thicknessin visceral fat (r = 0.61, P b 0.01) and subcutaneous fat (r = 0.50,P b 0.01) tissues. No correlation was observed between ACC1 ex-pression and subcutaneous fat thickness in the longissimus muscle(r = −0.18, P N 0.05).

Strong positive correlations were observed between ACC1 expres-sion and the weight (r = 0.59) and heart fat percentage (r = 0.69) insubcutaneous fat tissue. In other tissues, however, the weight and fat

percentage of the heart were not affected by alterations in mRNA ex-pression of ACC1. The weight of the heart was not correlated tochromium-mediated alterations in ACC1 expression in the liver (r =0.02, P N 0.05), visceral fat (r = −0.33, P N 0.05), and subcutaneousfat (r =−0.21, P N 0.05). However, heart weight was negatively corre-lated to ACC1 expression in the longissimusmuscle (r= 0.47, P b 0.01).

Significant differences were observed in the area of the longissimusmuscle among kids fed on different levels of chromium with those fedon 1.5 mg/day chromium showed the highest area of the longissimusmuscle (Fig. 3). The area of the longissimusmusclewas positively corre-lated to ACC1 expression in the liver (r = −0.45, P b 0.05), but nega-tively correlated in the longissimus muscle (r = 0.57, P b 0.01). Theaverage weight of kids feeding on chromium was slightly higher thanthat of non-supplemented kids at the time of slaughtering, howeverthe differences between the four nutritional treatments were not statis-tically significant (one-wayANOVA, df=23, P= 0.90) (Fig. 4). A strongnegative correlation was observed between ACC1 expression and theweights of kids at the time of slaughtering in the longissimus muscle(r = 0.57, P b 0.01). However, kid weight was not affected by changesin ACC1 expression in other studied tissues. The carcass weights were

Fig. 3. The distribution of longissimus muscle area (n = 6) in goat kids feeding on fourdifferent levels of chromium for a 90-day period.

257M.J. Najafpanah et al. / Gene 543 (2014) 253–258

not statistically different among the four treatments (one-way ANOVA,df = 23, P = 0.65).

4. Discussion

In this study, we report, for the first time, some inhibitory effects ofthe chromium on mRNA expression of ACC1 in four different tissues ofthe domestic goat, C. hircus (Fig. 1). Chromium occurs preliminarily intwo valence states: trivalent chromium (Cr III) and hexavalent chromi-um (Cr VI). Although, the toxicity of hexavalent chromium is wellestablished, trivalent chromium has been known as an essential tracenutrient involved in a variety of biological phenomenon includingpotentiation of insulin action, normal metabolism of lipid and carbohy-drate, immunity against pathogens, hormonal regulation, fat accumula-tion, etc. (Anderson, 1994; Emami et al., 2012; Pechova et al., 2002; Yeand Shi, 2001). Strong evidence indicate that both trivalent andhexavalent states of chromium can alter the expression of a variety ofgenes in human and laboratory animals (Clancy et al., 2012; Maplesand Bain, 2004; Permenter et al., 2011; Ye and Shi, 2001). For example,a comprehensive study using GeneChip technology revealed that out of2400 genes, the expression of 150 genes was upregulated and that of 70genes was downregulated in response to hexavalent chromium-induced cellular stress (Ye and Shi, 2001). Similarly, trivalent chromiumhas been suggested to alter the expression of twenty genes in the fish,Fundulus heteroclitus (Maples and Bain, 2004).

In this study, we demonstrated that ACC1 is expressed at the highestrates in subcutaneous fat, followed by liver and visceral fat of thedomestic goats. The mRNA expression of ACC1 in the longissimus mus-cle was nearly one-tenth as other studied tissues (see Fig. 1), indicatingthe relatively low ACC1 expression in muscles compared to adiposetissues. Additionally, we found that goat kids supplementedwith differ-ent levels of trivalent chromium showed some degrees of reduced

Fig. 4. The weight distribution (n = 6) in goat kids feeding on four different levels ofchromium for a 90-day period.

expression of ACC1 in the liver, visceral fat, and subcutaneous fat, butnot in the longissimusmuscle (see Fig. 1). These observations can be ex-plained by the two facts that i) liver and adipose tissues (i.e. subcutane-ous and visceral fats) are the main centers for lipogenesis and ACC1seems to play crucial role in fat biosynthesis in these tissues (Abu-Elheiga et al., 2003). On the other hand, the oxidative tissues such asliver, heart, and skeletal muscles are major centers for beta-oxidationa process by which, long chain fatty acids are broken in mitochondriato produce energy; and ii) the two isoforms of ACC have distinct rolesand display differential distribution across tissues. While ACC1 is abun-dant in lipogenic tissues and contributes to fatty acid biosynthesis, ACC2is highly expressed in heart, skeletal muscle, and liver and plays an im-portant role in beta-oxidation (Abu-Elheiga et al., 1997). Therefore, theconstant expression of ACC1 in longissimusmuscles is not surprising be-cause it does not play any considerable role in these tissues. Although,we did not investigate the effects of chromium supplementation on ex-pression of ACC2 in these tissues, it is expected to see higher impacts ofchromium on expression of ACC2 in longissimus muscles compared tothe adipose tissues. This means that chromium, on the one hand, de-creases fat accumulation through inhibiting genes or enzymes involvedin lipogenesis (as we observed in our current study), and on the otherhand, increases the activity of enzymes or the expression of genesresponsible for lipogenesis. Evidence for this hypothesis is the study ofKim et al. (1996) who showed that chromium supplementationimposed a dual effect on inhibition of lipogenesis and stimulation of li-polysis in broiler chicks. Similarly, Xi et al. (2001) reported that supple-mentation of pigs with 200 μg/kg chromium-picolinate, on the onehand, increased the activity of hormone sensitive lipase (by 80.29%), akey enzyme responsible for lipolysis, and on the other hand, decreasedthe activity of the two enzymes, isocitrate dehydrogenase (by 54.53%)and malate dehydrogenase (by 15.06%), that are involved in the path-way of NADPH synthesis, an important coenzyme for fatty acid biosyn-thesis and lipogenesis. Interestingly, pigs fed with chromium showedlarger longissimusmuscle area, lower back fat thickness, and lower car-cass fat percentage implying both increased lipolysis and decreasedlipogenesis (Xi et al., 2001).

We found that the chromium-mediated changes in mRNA expres-sion of ACC1were negatively correlated to qualitative properties of ox-idative tissues such as heart and longissimus muscle. For example, thearea of the longissimusmuscle increased following decrease in ACC1 ex-pression (Fig. 3) and these decreaseswere negatively correlated to ACC1expression only in longissimusmuscles of kids fed with chromium sup-plementation. However, these characteristics were unrelated or posi-tively correlated to ACC1 expression in the liver, visceral fat, andsubcutaneous fat tissues. By contrast, decrease in expression of ACC1was positively correlated to characteristicsmeasured in adipose tissues.For example, subcutaneous fat thickness and theweight and percentageof heart fat were positively correlated to ACC1 expression in the threeadipose tissues, liver, visceral fat, and subcutaneous fat, but unrelatedor negatively correlated in the longissimus muscle. These findingsimply that chromium, on the one hand, improves the favorable qualita-tive properties of redmeat (e.g. longissimus muscle area, Fig. 3) and, onthe other hand, reduces the unfavorable properties such as subcutane-ous fat thickness (Fig. 2), heart fat, lean carcass fat, and back fat thick-ness. Although, parts of these changes are expected to arise fromdecreased lipogenesis due to chromium-mediated decrease in expres-sion of ACC1, the precise impacts of chromium on other enzymes andgenes (such as ACC2) involved in fat metabolism remain to be cleared.

Although, the body weight at the time of slaughtering showed aslight ascending pattern by increase in chromium dose, it did not differsignificantly amongkids fed on different levels of chromium (Fig. 4). De-crease in fat content without any decrease in total body weight of stud-ied animals implies that digested foods are stored in energy fractionsother than fat. A large body of evidence shows that animals feeding onchromium supplementation reserve higher crude protein (Kim et al.,1996) and have higher percentages of muscles (Jackson et al., 2009;

258 M.J. Najafpanah et al. / Gene 543 (2014) 253–258

Page et al., 1993; Wang et al., 2009) that are protein rich tissues, butlower adipose tissues (e.g. back fat, visceral fat, and subcutaneous fat)(Page et al., 1993; Uyanik, 2001; Wang et al., 2009) that are main cen-ters for accumulation of fats. This means that chromium does notchange the overall carcassweight, but alters thepathway of energy stor-age from fats towards proteins. Therefore, chromium supplementationseems to be a useful strategy to improve meat quality through decreas-ing fat content and increasing muscle areas.

Conflict of interest

There is no conflict of interest.

Acknowledgments

The authors appreciate Dr. Mohammad Reza Bakhtiarizadeh, Mr. AliEmami and Dr. Mehdi Ganjghanlo for their great helps with this work.This research was financially supported by the University of Tehran,Iran.

References

Abu-Elheiga, L., Almarza-Ortega, D.B., Baldini, A., Wakil, S.J., 1997. Human acetyl-CoA car-boxylase 2. Molecular cloning, characterization, chromosomal mapping, and evidencefor two isoforms. Journal of Biological Chemistry 272, 10669–10677.

Abu-Elheiga, L., Oh,W., Kordari, P.,Wakil, S.J., 2003. Acetyl-CoA carboxylase 2mutantmiceare protected against obesity and diabetes induced by high-fat_high-carbohydratediets. Proceedings of the National Academy of Sciences of the United States ofAmerica 100, 10207–10212.

Anderson, R.A., 1994. Stress effects on chromium nutrition of humans and farm animals.In: Lyons, P., Jacques, K.A. (Eds.), Biotechnology in the Feed Industry, Proceedings ofAlltech's 10th Annual Symposium. Nottingham University Press, pp. 267–274.

Bengtsson, C., Blaho, S., Saitton, D.B., Brickmann, K., Broddefalk, J., Davidsson, O., 2011. De-sign of small molecule inhibitors of acetyl-CoA carboxylase 1 and 2 showing reduc-tion of hepatic malonyl-CoA levels in vivo in obese Zucker rats. Bioorganic andMedicinal Chemistry 19, 3039–3053.

Bhadauriya, B., Dhoke, G.V., Gangwal, R.P., Damre, M.V., Sangamwar, A.T., 2013. Identifica-tion of dual Acetyl-CoA carboxylases 1 and 2 inhibitors by pharmacophore based vir-tual screening and molecular docking approach. Molecular Diversity 17, 139–149.

Bustin, S.A., 2002. Quantification of mRNA using real-time reverse transcription PCR(RT-PCR): trends and problems. Journal of Molecular Endocrinology 29, 23–39.

Chomczynski, P., Sacchi, N., 2006. The single-step method of RNA isolation by acidguanidinium thiocyanate–phenol–chloroform extraction: twenty-something yearson. Nature Protocols 1, 581–585.

Clancy, H.A., Sun, H., Passantino, L., Kluz, T., Munoz, A., Zavadil, J., Costa, M., 2012. Geneexpression changes in human lung cells exposed to arsenic, chromium, nickel or va-nadium indicate the first steps in cancer. Metallomics 4, 784–793.

Daley, C.A., Abbott, A., Doyle, P.S., Nader, G.A., Larson, S., 2010. A review of fatty acid pro-files and antioxidant content in grass-fed and grain-fed beef. Nutrition Journal 9, 10.

Dong, Y., Xie, M., Jiang, Y., Xiao, N., Du, X., Zhang, W., et al., 2012. Sequencing and auto-mated whole-genome optical mapping of the genome of a domestic goat (Caprahircus). Nature Biotechnology 31, 135–141.

Emami, A., Zali, A., Ganjkhanlou, M., Akbari Afjani, A., 2012. Nutrient digestibility, carcasscharacteristics and plasma metabolites in kids fed diets supplemented with chromi-um methionine. Online Journal of Animal and Feed Research 2, 127–132.

Fan, C., Ma, J., Guo, Q., Li, X., Wang, H., et al., 2013. Selection of reference genes for quan-titative real-time PCR in bamboo (Phyllostachys edulis). PLoS ONE 8, e56573.

Haldar, S., Mondal, S., Samanta, S., Ghosh, T.K., 2009. Effects of dietary chromium supple-mentation on glucose tolerance and primary antibody response against peste despetits ruminants in dwarf Bengal goats (Capra hircus). Animal 3, 209–217.

Han, X., Lu, M., Chen, Y., Zhan, Z., Cui, Q., et al., 2012. Selection of reliable reference genesfor gene expression studies using real-time PCR in Tung tree during seed develop-ment. PLoS ONE 7, e43084.

Jackson, A.R., Powell, S., Johnston, S.L., Matthews, J.O., Bidner, T.D., Valdez, F.R., Southern, L.L., 2009. The effect of chromium as chromium propionate on growth performance,carcass traits, meat quality, and the fatty acid profile of fat from pigs fed no supple-

mented dietary fat, choice white grease, or tallow. Journal of Animal Science 87,4032–4041.

Kibbe, W.A., 2007. OligoCalc: an online oligonucleotide properties calculator. NucleicAcids Research 35, W43–W46.

Kim, Y.H., Han, I.K., Choi, Y.J., Shin, I.S., Chae, B.J., Kang, T.H., 1996. Effects of dietary levelsof chromium picolinate on growth performance, carcass quality, and serum traits inbroiler chicks. Asian Australasian Journal of Animal Sciences 9, 341–347.

Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data with real-timequantitative PCR and the 2(−ΔΔ Ct) method. Methods 4, 402–408.

Maples, N.L., Bain, L.J., 2004. Trivalent chromium alters gene expression in the mum-michog (Fundulus heteroclitus). Environmental Toxicology and Chemistry 23,626–631.

Moloney, A.P., 2002. The fat content of meat and meat products. In: Kerry, Joseph, Kerry,John, Ledward, David (Eds.), Meat Processing—Improving Quality. Woodhead Pub-lishing Limited, Cambridge, England, pp. 137–153.

Najafpanah, M.J., Sadeghi, M., et al., 2013. Reference genes selection for quantitative real-time PCR using RankAggreg method in different tissues of Capra hircus. PLoS ONE 8(12), e83041.

Oh, W., Abu-Elheiga, L., Kordari, P., Gu, Z., Shaikenov, T., Chirala, S.S., Sj, Wakil, 2005. Glu-cose and fat metabolism in adipose tissue of acetyl-CoA carboxylase 2 knockout mice.Proceedings of the National Academy of Sciences of the United States of America 109,1384–1389.

Page, T.G., Southern, L.L., Ward, T.L., Thompson Jr., D.L., 1993. Effect of chromiumpicolinate on growth and serum and carcass traits of growing–finishing pigs. Journalof Animal Science 71, 656–662.

Pechova, A., Podhorsk, A., Lokajova, E., Pavlata, L., Illek, J., 2002. Metabolic effects of chro-mium supplementation in dairy cows in the peripartal period. Acta Veterinaria 71,9–18.

Permenter, M.G., Lewis, J.A., Jackson, D.A., 2011. Exposure to nickel, chromium, or cadmi-um causes distinct changes in the gene expression patterns of a rat liver derived cellline. PLoS ONE 6, e27730.

Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Research 29, 2002–2007.

Radonic, A., Thulke, S., Mackay, I.M., Landt, O., Siegert, W., Nitsche, A., 2004. Guideline toreference gene selection for quantitative real-time PCR. Biochemical and BiophysicalResearch Communications 313, 856–862.

Rozen, S., Skaletsky, H.J., 2000. Primer3 on the WWW for general users and for biologistprogrammers. In: Krawetz, S., Misener, S. (Eds.), Bioinformatics Methods and Proto-cols: Methods in Molecular Biology. Humana Press, Totowa, NJ, pp. 365–386.

Savage, D.B., Choi, C.S., Samuel, V.T., Liu, Z.X., Zhang, D., Wang, A., Zhang, X.M., Cline, G.W.,Yu, X.X., Geisler, J.G., Bhanot, S., Monia, B.P., Shulman, G.I., 2006. Reversal of diet-induced hepatic steatosis and hepatic insulin resistance by antisense oligonucleotideinhibitors of acetyl-CoA carboxylases 1 and 2. Journal of Clinical Investigation 116,817–824.

Swanson, K.C., Harmon, D.L., Jacques, K.A., Larson, B.T., Richards, C.J., Bohnert, D.W., Paton,S.J., 2000. Efficacy of chromium-yeast supplementation for growing beef steers. Ani-mal Feed Science and Technology 86, 95–105.

Tong, L., Harwood Jr., H.J., 2006. Acetyl-coenzyme A carboxylases: versatile targets fordrug discovery. Journal of Cellular Biochemistry 99, 1476–1488.

Untergasser, A., Nijveen, H., Rao, X., Bisseling, T., Geurts, R., Leunissen, J.A.M., 2007.Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Research 35,W71–W74.

Uyanik, F., 2001. The effects of dietary chromium supplementation on some blood param-eters in sheep. Biological Trace Element Research 84, 93–101.

Wang, M.Q., He, Y.D., Lindemann, M.D., Jiang, Z.G., 2009. Efficacy of Cr (III) supplementa-tion on growth, carcass composition, blood metabolites, and endocrine parameters infinishing pigs. Asian Australasian Journal of Animal Sciences 22, 1414–1419.

Wilkening, S., Bader, A., 2004. Quantitative real-time polymerase chain reaction: method-ical analysis and mathematical model. Journal of biomolecular techniques 15 (2),107.

Wood, J.D., Richardson, R.I., Nute, G.R., Fisher, A.V., Campo, M.M., Kasapidou, E., Sheard, P.R., Enser, M., 2003. Effects of fatty acids on meat quality: a review. Meat Science 66,21–32.

Xi, G., Xu, Z., Wu, S., Chen, S., 2001. Effect of chromium picolinate on growth performance,carcass characteristics, serum metabolites, and metabolism of lipids in pigs. AsianAustralasian Journal of Animal Sciences 14, 258–262.

Ye, J., Shi, X., 2001. Gene expression profile in response to chromium induced cell stress inA549 cells. Molecular and Cellular Biochemistry 222, 189–197.

Ye, J., Coulouris, G., Zaretskaya, I., Cutcutache, I., Rozen, S., Madden, T.L., 2012. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMCBioinformatics 13, 134.

Zeder, M.A., Hesse, B., 2000. The initial domestication of goats (Capra hircus) in the ZagrosMountains 10,000 years ago. Science 287, 2254–2257.