Chromosomal translocations induced at specified lociin human stem cellsErika Bruneta, Deniz Simseka, Mark Tomishimaa,b, Russell DeKelverc, Vivian M. Choic, Philip Gregoryc, Fyodor Urnovc,David M. Weinstockd,e, and Maria Jasina,1

aDevelopmental Biology Program and bSloan-Kettering Institute Stem Cell Research Facility, dDepartment of Medicine, Memorial Sloan-Kettering CancerCenter, New York, NY; cSangamo BioSciences, Inc., Richmond, CA; and eDana-Farber Cancer Institute, Boston, MA

Edited by Frederick W. Alt, Harvard Medical School, Boston, MA, and approved May 8, 2009 (received for review February 25, 2009)

The precise genetic manipulation of stem and precursor cells offersextraordinary potential for the analysis, prevention, and treatment ofhuman malignancies. Chromosomal translocations are hallmarks ofseveral tumor types where they are thought to have arisen in stem orprecursor cells. Although approaches exist to study factors involvedin translocation formation in mouse cells, approaches in human cellshave been lacking, especially in relevant cell types. The technology ofzinc finger nucleases (ZFNs) allows DNA double-strand breaks (DSBs)to be introduced into specified chromosomal loci. We harnessed thistechnology to induce chromosomal translocations in human cells bygenerating concurrent DSBs at 2 endogenous loci, the PPP1R12C/p84gene on chromosome 19 and the IL2R� gene on the X chromosome.Translocation breakpoint junctions for t(19;X) were detected withnested quantitative PCR in a high throughput 96-well format usingdenaturation curves and DNA sequencing in a variety of human celltypes, including embryonic stem (hES) cells and hES cell-derived mesen-chymal precursor cells. Although readily detected, translocations wereless frequent than repair of a single DSB by gene targeting or nonho-mologous end-joining, neither of which leads to gross chromosomalrearrangements. While previous studies have relied on laborious geneticmodification of cells and extensive growth in culture, the approachdescribed in this report is readily applicable to primary human cells,including mutipotent and pluripotent cells, to uncover both the under-lying mechanisms and phenotypic consequences of targeted transloca-tions and other genomic rearrangements.

double-strand break repair (DSB repair) � zinc finger nucleases �mesenchymal cells � gene targeting � nonhomologous end-joining (NHEJ)

Recurrent chromosomal translocations are associated with manycancers where they are considered to be the initiating event for

tumorigenic transformation. As many as half of hematologicalmalignancies have a specific translocation signature, as do a numberof tumors of mesenchymal origin, including Ewing’s sarcoma,rhabdomyosarcoma, and synovial sarcoma (1, 2). Recurrent onco-genic chromosomal rearrangements have also recently been iden-tified in some carcinomas, including tumors of the prostate (3) andsmall cell lung cancer (4), raising the possibility that they have amore widespread contribution to the etiology of solid tumors ofepithelial origin than was previously recognized (5).

Given the prevalence of chromosomal translocations in humanmalignancy, understanding how translocations are formed in hu-man cells and the factors involved in their formation could lead tomeasures to prevent their occurrence. The initiating lesions in mostcases are likely to be contemporaneous DNA double-strand breaks(DSBs) on heterologous chromosomes that are misjoined (2, 6).Sequencing of numerous breakpoint junctions from human trans-locations indicates that a nonhomologous end-joining (NHEJ)pathway of DSB repair gives rise to the misjoining events, since littleor no homology is found at the ends of the translocating chromo-somes. A set of NHEJ factors have been identified in mammaliancells, including the Ku DNA end-binding protein and an associatedkinase DNA-PKcs, DNA ligase IV and an associated bindingpartner XRCC4, and a number of DNA end-processing factors (7).Because some level of NHEJ can occur in the absence of these

canonical factors, ‘‘alternative’’ NHEJ pathway(s) have also beenproposed.

Mechanisms and factors affecting chromosomal translocationshave been investigated in mouse cells in several contexts. Embry-onic stem cells have provided a genetically tractable system to targetDSBs to 2 chromosomal loci to induce translocations (6). Thesestudies have investigated the contribution of DSB repair pathwaysto translocation formation and have surprisingly shown that NHEJ-based translocations are increased in the absence of the canonicalNHEJ factor Ku, suggesting that an alternative NHEJ pathway isinvolved in translocation formation (8). Moreover, the immunesystem has provided a unique system to investigate translocationsarising from DNA damage induced by the activation-inducedcytidine deaminase or RAG recombinase (8–12). Translocationsincrease in the absence of the canonical NHEJ factor XRCC4,again suggesting the involvement of a noncanonical NHEJ pathwayin mouse lymphocyte translocations (12), although junctions werenot analyzed.

While valuable, these approaches in mouse cells have limitedapplication to human cells which are more difficult to clone andgenetically manipulate. And although basic mechanisms of DSBrepair are shared between mammalian species, differences havebeen noted between mouse and humans. For example, human cellsappear to have higher levels of DNA-PK activity compared withmouse cells (13). In addition, sequence elements that participate inoncogenic translocations are typically located in noncoding regionswhich are not well-conserved between mouse and human. Thus, thedevelopment of a human system to investigate translocation for-mation has been an imperative.

In this report, we present an approach to induce and recovertranslocations in human cells at specified loci. DSBs are introducedcontemporaneously into 2 loci using endonucleases with longrecognition sites (‘‘meganucleases’’), one of which is the commonlyused I-SceI homing endonuclease (14, 15). Key to this approach isthe technology of zinc finger nucleases (ZFNs) in which zinc fingerDNA-binding modules are assembled to recognize specified sites inthe genome and then fused to the FokI endonuclease domain toproduce a site-specific nuclease (16, 17). To identify and quantifytranslocations, we used a 96-well quantitative PCR format. Withthis approach, translocation breakpoint junctions were obtained in3 cell types: a human embryonic kidney 293 derivative cell line(TOS4A), human embryonic stem (hES) cells, and hES-derivedmesenchymal precursor (hES-MP) cells. The translocation fre-quency was lower than that of repair of a single-break by other DSB

Author contributions: E.B., D.M.W., and M.J. designed research; E.B., D.S., M.T., and V.M.C.performed research; E.B., M.T., R.D., P.G., and F.U. contributed new reagents/analytic tools;E.B., D.S., and M.J. analyzed data; and E.B. and M.J. wrote the paper.

Conflict of interest statement: Russell DeKelver, Philip Gregory, and Fyodor Urnov arefull-time employees of Sangamo BioSciences, Inc.

This article is a PNAS Direct Submission.

Freely available online through the PNAS open access option.

1To whom correspondence should be addressed. E-mail: m-jasin@ski.mskcc.org.

This article contains supporting information online at www.pnas.org/cgi/content/full/0902076106/DCSupplemental.

10620–10625 � PNAS � June 30, 2009 � vol. 106 � no. 26 www.pnas.org�cgi�doi�10.1073�pnas.0902076106

Dow

nloa

ded

by g

uest

on

Nov

embe

r 24

, 202

1

repair pathways, and translocation breakpoint junctions were foundto recapitulate characteristics of patient-derived junctions. With thisapproach, genetically unmodified human cells can be used todetermine how DSBs give rise to translocations in human cells andthe factors involved. Further, our results suggest an approach toderive translocations in human cells relevant to tumor formation.

ResultsRecovery of Induced Chromosomal Translocations from Human Em-bryonic Kidney 293 Cells (TOS4A). Our approach for inducing definedchromosomal translocations in human cells relies on the formationof 2 concurrent DSBs in heterologous chromosomes using site-specific endonucleases. To determine the feasibility of our ap-proach, we used the 293-derived cell line TOS4A (18). TOS4A cellscontain a unique 18 bp I-SceI endonuclease recognition site ran-domly integrated into their genome in the context of a single copyof the DR-GFP reporter (Fig. 1A; see also below). We performedfluorescence in situ hybridization (FISH) to determine the chro-mosomal location of DR-GFP, which revealed that DR-GFPintegrated very close to the centromere in 1 of the 3 chromosomes6 present in the 293 cell line (Fig. S1A).

The second site in the genome targeted for DSB formation iscleaved by a ZFN. The ZFN cleavage site is within exon 5 of theIL2R� gene on the X chromosome (Xq13) (19). The 2 subunits ofthe ZFNIL2R� are designed to bind two 12-bp sequences spaced 5bp apart; cleavage occurs within the spacer, typically producing a5-base 5� overhang (J. C. Miller, personal communication). TOS4Acells contain a normal X chromosome with a ZFNIL2R� site and arearranged X chromosome that apparently also has a ZFNIL2R� site(Fig. S1 A and B). After concurrent DSB formation at the I-SceIand ZFNIL2R� sites, DNA ends on chromosomes 6 and X can inprinciple be misjoined to produce chromosomal translocations witheither monocentric or dicentric/acentric derivative chromosomes(Fig. 1A). PCR products consistent with translocation breakpointjunctions have been previously reported (20), although cells har-boring translocations were not recovered and conditions for quan-tification of translocations were not established.

To verify translocation formation, we set out to recover cellsharboring t(6;X) chromosomes. TOS4A cells were transfected withthe I-SceI and ZFNIL2R� expression vectors and sib-selection wasperformed over several cell generations using PCR screening forbreakpoint junctions (SI Materials and Methods). Two sets of PCRprimers were used to screen for alternative translocation outcomes(Figs. 1B and S1B), and FISH was used to detect the translocationchromosomes. One set of primers led to the identification of areciprocal translocation between chromosomes 6 and X, as de-tected by whole chromosome painting (Fig. 1C). The chromosomeswere monocentric, allowing us to infer that DR-GFP had integratedoriented toward the centromere during the generation of theTOS4A cell line. Screening with the second set of primers led to theidentification of what appeared to be a dicentric chromosomeinvolving the rearranged X chromosome (Fig. S1B), indicating thatthe genetically compromised 293 cells are able to stabilize whatwould otherwise be a mitotically unstable chromosome. The recip-rocal acentric chromosome was not detected by either PCR orFISH. These cells may not be able to propagate an acentricchromosome, or, alternatively, the reciprocal chromosome maynever have been formed.

Sequences of the breakpoint junctions in both translocationconfigurations showed joining by NHEJ with surprisingly littlemodification of the DNA ends. For the monocentric der(6) andder(X) chromosomes, a net gain of 3 bp was observed as a result ofpartial fill-in of the 5� and 3� overhangs at the chromosome ends(Fig. 1C). For the apparently dicentric chromosome, the breakpointjunction was also formed by fill-in of the 5� and 3� overhangs (Fig.S1B).

Development of a Quantitative Assay for Chromosomal TranslocationFormation. To quantify translocations, we developed a highthroughput 96-well format screen for breakpoint junctions (Fig.S1C). After transfection with the I-SceI and ZFNIL2R� expressionvectors, TOS4A cells were seeded at 104 cells per well. Forty-eighthours later, cells in each well were lysed and PCR was performedto detect the breakpoint junctions. Nested PCR was performed toamplify the translocations, with the second round of PCR per-formed in the presence of SYBR Green. A well was considered tobe positive when it gave a PCR product with the expected meltingtemperature (�85 °C) for a breakpoint junction (Fig. S1C). Se-

DR-GFP3’

Xq13

Chr(6) Chr(X)

DR-GFP3’

6p11

A DR-GFP

B

ZFNI-SceI

Der(6) Der(X) Dicentric Acentric

5’-DR-GFP

TGTTCGGAGCCGCTTTAACCC ATAACAGGGTAATACCTACG ACAAGCCTCGGCGAAATTGGG TATTGTCCCATTATGGATGC

Der(6)

IL2Rγ

GTGTCCGGCTAGGGATAA CAGGGTAATACCTACGCACAGGCCGATCCC TATTGTCCCATTATGGATGC

TGTTCGGAGCCGCTTT AACCCACTCTGTGGAAGTGCT ACAAGCCTCGGCGAAATTGGG TGAGACACCTTCACGA

5’-DR-GFP

5’-DR-GFP IL2Rγ-3’

AGCGTGTCCGGCTAGGGATAA AACCCACTCTGTGGAAGTGCT TCGCACAGGCCGATCCCTATT TTGGGTGAGACACCTTCACGA

Der(X)

936bpTr(X-6)-2F Tr(X-6)-2R

472bpTr(X-6)-2N-F Tr(X-6)-2N-R

911bpTr(X-6)-1F Tr(X-6)-1R

484bpTr(X-6)-1NF Tr(X-6)-1NR

AGCGTGTCCGGCTAGGGATAA .ACCCACTCTGTGGAAGTGCT TCGCACAGGCCGATCCCTATT .TGGGTGAGACACCTTCACGA

Der(6)

Der(X)

TGTTCGGAGCCGCTTTA.... .TAACAGGGTAATACCTACG ACAAGCCTCGGCGAAAT.... .ATTGTCCCATTATGGATGC

I-SceI ZFN IL2RγDR-GFP

5’-IL2Rγ DR-GFP3’C

D

uncut I-SceI I-SceI+LweI

Z S+Z Z S+Z Z S+Z

0.0021 ± 0.00025

HR: GFP+

Single-break NHEJ: Imprecise repair

Translocation frequency

IL2Rγ −3’ DR-GFP3’

5’-IL2Rγ DR-GFP3’

0.0023 ± 0.00038

28.8 ± 1.8

2.8 ± 0.5

ZFNIL2Rγ, I-SceIhi

(%) DNA transfected: ZFNIL2Rγ

(%)

<0.0001<0.0001

0

<0.01

I-SceI site loss*

IL2Rγ-3’

5’-IL2Rγ

5’-IL2Rγ

IL2Rγ-3’

IL2RγIL2Rγ

LweI I-SceI

Fig. 1. Induction of chromosomal translocations in TOS4A cells. (A) Design ofthe translocation system. DSBs are induced at the I-SceI and ZFNIL2R� sites in thegenome of TOS4A cells. After concurrent DSB formation and misjoining, trans-locations can in principle lead to either monocentric derivative chromosomes,der(6) and der(X), or dicentric and acentric chromosomes. (B) PCR approach toidentify translocation breakpoint junctions for der(6) and der(X). Fragment sizesare calculated with the overhangs filled in (black). (C) Recovery of t(6;X) translo-cation after 2 rounds of PCR enrichment for the der(X) breakpoint junction. FISHusing whole chromosome paints to chromosome 6 (green) and the X chromo-some (red) verified the translocation. Breakpoint junction sequences are shown.(D) Translocation NHEJ, single-break NHEJ, and HR in TOS4A cells after expressionof I-SceI and ZFNIL2R�. Translocation frequency is evaluated with 2 primer sets.Single-break NHEJ is measured with primers that flank the I-SceI site. To differ-entiate imprecise NHEJ from HR and SSA, PCR fragments are cleaved with I-SceIand/or LweI. Imprecise NHEJ products are resistant to both (*), whereas HR andSSA products are cleaved by LweI but not I-SceI. (See also Fig. S2C.) Z, ZFNIL2R�; S,I-SceIhi. HR is the percent GFP� cells. Results from 3 independent experiments areshown with 1 standard deviation from the mean.

Brunet et al. PNAS � June 30, 2009 � vol. 106 � no. 26 � 10621

BIO

CHEM

ISTR

Y

Dow

nloa

ded

by g

uest

on

Nov

embe

r 24

, 202

1

quencing confirmed that these were bona fide breakpoint junctions(see below). The translocation frequency was then calculated as theratio of the number of positive wells to the total number oftransfected cells; if the number of positive wells was 14–30, statis-tical analysis was performed following a beta cumulative distribu-tion function to correct for wells with more than 1 translocation (SIMaterials and Methods).

Using this method, we compared the recovery of the 4 possiblebreakpoint junctions, reproducibly obtaining translocation frequen-cies of approximately 2 � 10�5 per cell for each junction (see Fig.1D). These results confirm that the 96-well format is a valid methodfor quantifying translocation formation. Further, these results sug-gest that all 4 chromosome configurations [monocentric der(6) andder(X), dicentric, and acentric] are equally likely, and that the 48-htime frame of the assay permits the detection of unstable chromo-somes. However, it should be noted that the presence of rearrangedX chromosomes in the parental 293 cells complicates the certainassignment of a breakpoint junction to a particular chromosomeconfiguration without supporting FISH analysis. We also analyzedeach well of a 96-well plate for all 4 translocation breakpointjunctions. Reciprocal translocation products were obtained in somebut not all wells (Fig. S1D), raising the possibility that nonreciprocaltranslocations are frequent in these cells, even for the monocentricchromosomes. Although the reciprocal chromosome product mayhave failed to amplify, PCR products were reproducibly obtainedfrom positive wells, suggesting that PCR failure is not typical.

Translocation Breakpoint Junctions Have Characteristics of OncogenicTranslocations. About 90% of patient-derived translocation break-point junctions exhibit modifications to the DNA ends beforejoining. Such modifications are typical of an NHEJ-based repairmechanism (6). We sequenced 57 translocation breakpoint junc-tions from the TOS4A cells to determine what types of DNA endmodifications occur in our induced translocations (Fig. S2A). Aportion of the translocations (14/57, 25%) had junctions in whichthe DNA ends were joined without modification, as defined byretention of the DNA overhangs without further alteration (Fig.S2A). Thus, human cells have the capability to completely ‘‘fill-in’’both 5� and 3� overhangs to maintain DNA end sequences. Theremaining junctions had deletions at one or both ends. Of these,14% of junctions (8/57) had only lost bases from the overhangswithout further modification. Altogether, the deletions were short,with 93% of junctions (53/57) having lost � 35 bp from the DNAends (Fig. S2B). We estimate the limit of detection for deletions is� 350 bp; thus, while translocations with large deletions will not bescored in this assay, the majority of translocation breakpointjunctions appear to be recoverable from these cells. Nine of thebreakpoint junctions had insertions (Fig. S2A). Five of the inser-tions were small (1–13 bp), while the remaining 4 were larger(41–117 bp) and included sequences duplicated from the IL2R�gene that were originally located either adjacent to the breakpointor at some distance.

Microhomologies are frequently observed at translocationbreakpoint junctions in oncogenic translocations (6, 21), andthey were also observed at the breakpoint junctions we recov-ered. Overall, 44% of junctions (21/48) had microhomologieswhich ranged from 1–4 bp, with 27% of the junctions (13/48)showing greater than or equal to 2 bp of microhomology (Fig.S2B). It is notable that although 4 base repeats flank 2 of thebreakpoints, only 2 of 52 breakpoint junctions used this micro-homology (Fig. S2 A). Thus, while microhomology is commonlyobserved, moderate stretches of microhomology (e.g., 4 bp) donot appear to drive human translocations.

Simultaneous Evaluation of Multiple DSB Repair Pathways in TOS4ACells. Translocations are infrequent outcomes of DSB repair, asmost DSB repair events maintain overall genomic integrity. Typi-cally, the 2 ends of a single chromosome break are simply rejoined

through an NHEJ pathway or repaired by precise homologousrecombination (HR). The TOS4A system allows simultaneousquantification of all 3 DSB repair pathways (translocation NHEJ,single-break NHEJ, and HR). As previously described, the DR-GFP reporter quantifies HR by reconstitution of a functional GFPgene, since DSB formation by I-SceI induces gene conversion at theGFP repeats (Fig. 1D) (22). Single-break NHEJ is measured at theDR-GFP reporter by modification of the I-SceI site during rejoining(I-SceI ‘‘site loss’’), as NHEJ is frequently imprecise, producingnucleotide modifications at DNA ends similar to translocationNHEJ. Imprecise NHEJ is distinguished from HR in the I-SceIsite-loss assay by the restriction enzyme LweI, because HR resultsin mutation of the I-SceI site with concomitant gain of an LweI sitefrom the downstream GFP repeat while NHEJ does not (Fig. S2C).

To quantify all 3 DSB repair pathways in the same experiment,the I-SceI expression vector was transfected into the TOS4A cellsat a higher concentration than the ZFNIL2R� expression vector(I-SceIhi). Transfected cells were then divided into 2 plates: a96-well plate for translocation formation and a 10-cm dish for HRand imprecise NHEJ quantification. Under these defined condi-tions, HR was determined to have occurred at a frequency of 2.8%using flow cytometry for GFP� cells, imprecise NHEJ at 29% usingI-SceI site-loss PCR (Fig. S2C), and translocations at approximately2 � 10�5 assaying for 2 breakpoint junctions by PCR (Fig. 1D). Ifboth the I-SceI and ZFNIL2R� expression vectors were transfectedat high concentrations, translocations increased to approximately10�4 and so were more difficult to quantify. With the ZFNIL2R�/I-SceIhi combination of vectors, each of the DSB repair pathwayscan be simultaneously quantified, allowing the assessment of factorsthat may change the balance of these pathways.

Inducing Defined Chromosomal Translocations in Genetically Unmod-ified hES and hES-MP Cells. In addition to ZFNIL2R�, ZFNs haverecently been described that cleave other endogenous loci in thehuman genome (17, 23). This development allows DSB formationat 2 endogenous loci in human cells, abrogating the need for priorgenetic modification of cells. This approach is particularly powerfulfor nontransformed human cell types which are difficult to clone.We made use of a zinc finger nuclease, ZFNp84, that cleaves thePPP1R12C/p84 locus on chromosome 19 (Fig. 2A). The site of DSBinduction by ZFNp84 is close to the AAV integration site (24), whichcan be used as a universal site for gene insertion. Co-expression ofZFNp84 and ZFNIL2R� would lead to concurrent formation of DSBson chromosomes 19 and X; misjoining of the DSBs would lead tot(19;X) translocations (Fig. 2A). We focused on the formation ofthe monocentric derivative chromosomes, der(19) and der(X),although events corresponding to the formation of the dicentricchromosome were also detected. A PCR method similar to thatdescribed above was used to detect the appearance of chromosomaltranslocation breakpoint junctions (Fig. 2B). Using TOS4A cells,we recovered both der(19) and der(X) translocation junctions in amanner dependent on expression of both ZFNp84 and ZFNIL2R�

(Fig. 2B). We obtained similar translocation frequencies for t(19;X)as with t(6;X) (10�4–10�5). In addition to TOS4A cells, we werealso able to efficiently recover translocation breakpoint junctionsfrom SV40-transformed human fibroblast cell lines.

We next applied this approach to genetically unmodified hEScells and hES-MP cells which are proficient at multilineage differ-entiation into fat, cartilage, bone, and skeletal muscle (25). Multi-potent mesenchymal cells are likely to be precursors for somesarcomas harboring characteristic translocations (26, 27). Usingnucleofection, hES and hES-MP cells can be efficiently co-transfected, as measured by GFP and DsRed expression. Forexample, approximately 80% of hES-MP cells express either pro-tein, and 70% of successfully transfected cells express both proteins(Fig. S3A). To assay translocations, cells were cotransfected withexpression vectors for ZFNp84 and ZFNIL2R� and then plated into96-well plates at 4 � 104 cells per well (Fig. S3B). Four days later,

10622 � www.pnas.org�cgi�doi�10.1073�pnas.0902076106 Brunet et al.

Dow

nloa

ded

by g

uest

on

Nov

embe

r 24

, 202

1

cells in each well were lysed and quantification by PCR wasperformed using primers for der(X), as the PCR was more robustfor this derivative chromosome, although in some experiments,der(19) was also characterized (Fig. S3C). In hES cells, the fre-quency of translocations cells was 2.2 � 0.7 � 10�6; in hES-MPcells, it was 7.5 � 1.0 � 10�6. These results indicate that translo-cations can readily be detected in non-transformed cells types atspecified endogenous loci. The frequency of translocations did notreach the level found in TOS4A cells, suggesting that hES orhES-MP cells may be less prone to genomic rearrangements;however, we cannot exclude that differences in transfection or DSBefficiency effect translocation formation.

We sequenced 27 translocation breakpoint junctions from thehES-MP cells and 19 from the hES cells for der(X) (Fig. 2D andFig. S3C). Because the results were similar, we combined thejunctions from both cell types for analysis. Compared with theI-SceI/ZFNILR2� induced translocations, the breakpoint junc-tions from ZFNp84/ZFNIL2R� induced translocations were nota-ble in that fewer junctions were found without end modifications(3/46, 7% vs. 25%, P � 0.0167, Fisher’s exact test), as defined byfill-in of the two 5� overhangs, but significantly more hadjunctions that had deleted bases only from the overhangs (34/46,74% vs. 19%, P � 0.0001). As a result, overall the deletions weresmaller, such that 93% of junctions (43/46) had deleted � 17 bp(vs. � 35 bp) (Fig. S3D). This fine structure junctional differencemay be due to the different type of overhangs and particularsequence of the overhangs, since bases from the two 5� overhangscan anneal. For example, the junction using the ‘‘CC’’ or ‘‘CCA’’microhomology in the overhangs appears to be overrepresented incomparison to other junctions. It is worth noting that the primarycleavage of the ZFNp84 is expected to result in a 4-base 5� overhangas shown (Fig. 2A); however, ZFNs in which the zinc finger bindingsites are spaced 6 bp apart, as for the ZFNp84, can generate minorcleavage products (28), which in this case would result in anadditional “C” to the overhang for a “CCAC” microhomology.

Insertions were also observed in 11% (5/46) of junctions. Threebreakpoint junctions had small insertions of 1–3 bp, while theremaining 2 were larger (67 and 231 bp). The largest insertioninvolved a duplication of p84 sequences located adjacent to the

breakpoint as well as unidentified DNA; insertions of multiplesegments of DNA in tumor cell rearrangements have been termed‘‘genomic shards’’ (29). Microhomologies were also observed at thebreakpoint junctions. Overall, 49% of junctions (20/41) had micro-homologies, ranging from 1–3 bp, with 27% of the junctions (11/41)showing greater than or equal to 2 bp of microhomology (Fig. S3D).These results are comparable to those obtained in the t(6;X) junctions.

DSB Repair Pathways in Human Multipotent Stem Cells. Humanmultipotent stem cells offer the potential for diverse studies,including oncogenesis and lineage analysis, yet approaches togenetic modification and understanding DNA instability are lim-ited. Using ZFNs, HR can be assayed by DSB-mediated genetargeting, as has been used in mouse cells (14). Specifically, DSBspromote integration of a marker gene flanked by DNA sequenceshomologous to the target gene. We used a promoter-less GFP geneflanked by p84 sequences to target p84. The donor plasmid consistsof two 750-bp sequences that flank the ZFNp84 site interrupted bya splice acceptor and a GFP ORF followed by a polyadenylationsignal sequence (pGFPp84 donor) (Fig. 3A). When ZFNp84 isexpressed in cells transfected with the pGFPp84 donor, DSB-promoted gene targeting will result in GFP expressed from theendogenous p84 promoter. Random integration may also fortu-itously lead to GFP expression, but at a much lower frequency.

In conjunction with the translocation assays, we co-transfectedhES-MP cells with the pGFPp84 donor plasmid and the ZFNexpression vectors and incubated cells for 4 days. In experimentsthat included ZFNp84, we obtained 2.9 � 0.2% GFP� cells, whilein the absence of ZFNp84, we obtained only 0.07 � 0.04% GFP�cells (Fig. 3B), indicating that a DSB stimulates targeted integrationof GFP in the hES-MP cells. The level of GFP� cells was stableover 2-week incubation at which time GFP� cells were sorted byflow cytometry for genomic DNA isolation. Targeted integrationwas confirmed by PCR of the GFP� sorted cells (Fig. 3C).

To complete the DSB repair analysis, single-break NHEJ wasalso examined. PCR amplification was performed with primersthat flanked the ZFNp84 site; PCR fragments were purified,cloned, and sequenced. From cells transfected with ZFNp84, 3 of67 sequences were modified, whereas in the absence of ZFNp84,

Fig. 2. Induction of chromosomal translocations at endogenous human loci. (A) Design of the translocation system. DSBs are induced at the ZFNIL2R� and ZFNp84 sites,as indicated. Only der(19) and der(X) monocentric chromosomes are shown. The PCR approach to identify translocation breakpoint junctions for der(6) and der(X) isshown. Fragment sizes are calculated with the overhangs filled in (black). (B) PCR for der(19) and der(X) breakpoint junctions in TOS4A cells after ZFNp84 and ZFNIL2R�

expression. (C) Sequences of der(X) breakpoint junction sequences from hES-MP cells. Microhomologies are underlined. The boxed C indicates that ZFNp84 cleavage maysometimes result in an alternative overhang. The 231-bp insertion is described in Fig. S3C legend.

Brunet et al. PNAS � June 30, 2009 � vol. 106 � no. 26 � 10623

BIO

CHEM

ISTR

Y

Dow

nloa

ded

by g

uest

on

Nov

embe

r 24

, 202

1

none of 86 sequences were modified. Interestingly, the 3 NHEJevents were simple fill-in reactions to the 5� overhangs (Fig. 3D).Overhang fill-in followed by blunt end ligation was also observedin DSB repair studies in worms (30) and human T cells (23).Given that fill-in of the 5� overhangs appeared to be the mostfrequent single-break NHEJ event, we performed colony hy-bridization with probes to the fill-in products (Fig. S4). Using thisapproach, we obtained 33 fill-in products from 1,655 coloniesanalyzed, which is 1.9% p84 allele modification; assuming thatmost products represent a modification of just one of the two p84alleles in a cell, the frequency of p84 site modification for cellsis 3.8% for the fill-in product.

More recently, ZFNIL2R� has been modified to promote ahigher specificity of cleavage, termed HiFiZFNIL2R� (31). Wetested HiFiZFNIL2R� with ZFNp84 and obtained an approximate2-fold higher translocation frequency (Fig. S4), suggesting thatcleavage may be somewhat higher than with ZFNIL2R� due toincreased specificity. We also measured single-break NHEJ atthe IL2R� site for the common fill-in product using colonyhybridization; similar to p84, we obtained a frequency of IL2R�site modification for cells of 3.4% for the fill-in product (Fig. S4).

DiscussionThe analytic and therapeutic modification of human primary,precursor, or stem cells requires the least possible geneticmanipulation and the shortest possible duration of in vitro

culture. To overcome the need for genetic modification of cellsbefore induced chromosomal translocation, 2 sets of ZFNs thateach target an endogenous locus were expressed in human cells.Translocation formation was quantified using nested PCR, andscreening for denaturation temperature in a 96-well format inconjunction with sequencing of translocation breakpoint junc-tions. With this approach, t(19;X) translocations were inducedwithin 96-h post-transfection in multipotent hES-MP cells andpluripotent hES cells at frequencies of 10�5 to 10�6. By com-parison, HR and single-break NHEJ were much more efficient,as measured by DSB-mediated gene targeting and impreciseNHEJ in the hES-MP cells, respectively; this greater reliance onHR and single-break NHEJ serves to maintain genomic integrityin these multipotential cells. Concurrent analysis of HR, single-break NHEJ, and translocation frequency will allow a determi-nation of how the balance of these pathways is perturbed whenvarious DSB repair pathway components are altered. This is animportant question given that these pathways are known toimpinge on each other [e.g., (32)].

Quantification of translocation frequency using the 96-wellformat was initially developed using the 293-derived cell lineTOS4A. Although 293 cells are transformed and contain nu-merous chromosome aberrations, they are easy to culture andtransfect and are a commonly used human cell line for DSBrepair analysis (e.g., ref. 18). With the TOS4A cells, we con-firmed that breakpoint junctions obtained by PCR representtranslocations on the chromosome level. Because TOS4A cellscontain an integrated DR-GFP reporter, we also simultaneouslyassayed HR using a DSB-induced gene conversion assay. Anadvantage to this assay is that the background of GFP� cells islower than that obtained with the DSB-mediated gene targetingassay (�0.01% vs. 0.07%). In the latter case, random integra-tions of the GFPp84 targeting vector near a promoter can restorea GFP� gene at a low frequency.

Breakpoint junctions for the t(19;X) translocations recoveredin these experiments have a range of DNA-end modifications,including deletions, insertions, and microhomology, which reca-pitulate characteristics of translocation breakpoint junctions inhuman tumors (2, 6). Deletions were frequent and typically short(�20 bp) with only a few having deleted �100 bp. The currentprimer sets limit detection of deletions to approximately 400 bp.Based on our previous experiments in mouse cells (6), we expectthat the majority of translocations are being captured with theseprimers; additional primers set further from the breakpoints wouldtest this. Insertions were less frequent and were often just a few bp,although one insertion was composed of 2 unrelated DNA seg-ments, similar to genomic shards found inserted at some breakpointjunctions in some tumor cell rearrangements (29). Microhomologyof 1–4 bp was found in about half of the junctions.

A key question is what factors promote chromosomal trans-location formation. Clearly, NHEJ is central to this process, butthe role of the canonical NHEJ pathway is uncertain, since, whentested, they are not required for, but rather suppress, translo-cations (8, 12). Even for single-break NHEJ, the pathwaysinvolved appear to be complex and not fully dependent oncanonical NHEJ components (7, 33). One hypothesis is that theNHEJ pathway(s) that mediates translocation transformationmay still use the same components used for single-break NHEJ,just less efficiently. Occasional failure of single-break NHEJcould lead to persistence of DSBs, allowing for loss of DNA-endsynapsis and hence the possibility of 2 DSBs joining to eachother. These persistent DSBs could be more prone to endmodification. The alternative to this long-lived DSB hypothesisis that translocations (and other 2-break events) arise fromsimilar pathways and components as single-break repair, but thatthe contribution of the canonical NHEJ pathway is greater forsingle-break repair than are alternative NHEJ pathways. Greateruse of the canonical NHEJ pathway would suppress illegitimate

A B ZFN + ZFN IL2Rγ p84

primers: HR-1 HR-2 HR-3

2

1

3

ZFN IL2Rγ + + + + + +

ZFNp84 - + - + - +

- + - + - +sorted GFP+:

C

D

CACCCCACAGTGGG.... GCCACTAGGGACAGGATT GTGGGGTGTCACCCCGGT ....GATCCCTGTCCTAA

CACCCCACAGTGGGGCCA GCCACTAGGGACAGGATT GTGGGGTGTCACCCCGGT CGGTGATCCCTGTCCTAA

ZFN IL2Rγ

100 101 102 103 104100

101

102

103

104

FL2-H

FL

1-H

100 101 102 103 104100

101

102

103

104

FL2-H

FL

1-H

HR-3R

p84

GFP+

+

ZFNp84,Targeted integration

GFP(-)GFP p84 donor

1.25kb

3.1kb1.7kb

1.95 kb

HR-1F HR-1RHR-2F HR-2R

HR-3F

HR-3F HR-3R0.5 kbHR-2F HR-2R

GFP+

Translocation frequencyDer(X)

Single-break NHEJ(p84 site modification)

Imprecise repair/ Unmodified site

0.00075 ± 0.0001

<0.00003

HR

DNA transfected:

0.07 ± 0.04 2.9 ± 0.2

ZFN IL2Rγ ,

GFPp84

(%)

Unmodified site

Imprecise repair

GFP+HR

Single-break NHEJ

5’-p84 IL2Rγ−3’Der(X)

Translocation

ZFN p84

p84

kb

2

1

3

kb

2.95%0.058%

ZFN IL2Rγ ,

ZFNp84 ,

GFPp84 (%)

0.5 kbHR-2F HR-2R

ZFNp84

3.8 ± 1.0<0.1

Fig. 3. Comparison of DSB repair pathways in multipotent hES-MP cells. (A)DSB-mediated gene targeting strategy to quantify HR. A promoterless GFPdonor (GFPp84) can target the p84 locus upon ZFNp84 cleavage and be ex-pressed from the p84 promoter. Homology arms (blue) are each approxi-mately 750 bp. (B) Flow cytometric analysis of hES-MP cells 2 weeks aftertransfection with GFPp84 and the indicated ZFNs. Cells transfected with ZFNp84

(Right) contain a significant GFP� population which was sorted for furtheranalysis. (C) PCR analysis of genomic DNA from sorted GFP� cells to verifyDSB-mediated gene targeting. PCR primers and fragment sizes are shown inA. (D) Translocation NHEJ, single-break NHEJ, and HR after ZFNIL2R� and ZFNp84

cleavage. Translocation frequency is quantified for the der(X) breakpointjunction. For single-break NHEJ, imprecise repair products were detected byPCR amplification across the ZFNp84 site and colony hybridization (Fig. S4). HRis quantified by DSB-mediated gene targeting. Results from 3 independentexperiments are shown with 1 standard deviation from the mean.

10624 � www.pnas.org�cgi�doi�10.1073�pnas.0902076106 Brunet et al.

Dow

nloa

ded

by g

uest

on

Nov

embe

r 24

, 202

1

events such as translocations, whereas greater use of alternativepathways would increase their occurrence. A clear understand-ing of alternative NHEJ will shed light on these hypotheses.

Clinically relevant chromosomal translocations found in somesarcomas have been hypothesized to occur in mesenchymal stemcells (26, 27). The use of site-specific nucleases to inducechromosomal translocations as demonstrated here in humancells provides the proof of principle to consider designing customnucleases directed toward genomic regions implicated in onco-genic translocations in multipotent cells. Creating physiologi-cally relevant translocations at endogenous loci, rather thanectopically expressing fusion proteins that arise from transloca-tions, would reproduce the cellular milieu in which fusionproteins typically arise: fusion proteins created during translo-cation formation would be expressed from the endogenouspromoter, and the copy number of the nontranslocated alleleswould be reduced from 2 to 1. Effects on proliferation and othercellular phenotypes arising from fusion gene expression can,therefore, be assessed with a much greater precision.

Multipotent mesenchymal stem cells are used in differentia-tion studies of various lineages, including chondrocytes andosteoblasts, which have the potential for use in tissue engineeringand regenerative medicine (25). Thus, the ability to geneticallymanipulate these cells at defined loci has impact beyond thestudy of DSB repair mechanisms or tumorigenesis. The exper-iments presented here with the p84 gene provide a model totarget a gene for modification in these cells. Modification ofother genes relevant to the biology of mesenchymal precursorsor their derivatives can be achieved by designing ZFNs to cleaveother sites of interest.

In addition to IL2R� and p84, ZFNs have been successfullydesigned for other loci in human cells, such as CCR5 (23), CHK2(34), and VEGF-A (17, 23). Moreover, improvements to ZFNdesign have resulted in ZFNs with increased locus specificity.For example, ZFNs have been modified to efficiently cleave

DNA only when paired together as a heterodimer (31). ZFNshave also been fused to destablization domains to regulate theirlevels (35). Like the homing endonuclease I-SceI, ZFNs can beconsidered ‘meganucleases’ because of their long recognitionsequences. Engineering of homing endonucleases to recognizean endogenous site in the genome, while challenging, hasrecently proved to be successful (36), providing an alternativeapproach to ZFNs for human genome modification. Syntheticchemical reagents have also recently been shown to lead toefficient DSB formation in the human genome (37, 38). Ourresults, as well as advances in site-specific DSB technology,suggest that modification of the human genome for a variety ofpurposes, including translocation formation, will become in-creasingly possible and efficient in the near future.

Materials and MethodsAdditional materials and methods are found in SI Materials and Methods.

TOS4A cells (18) were transfected with pCBASce (39) and ZFNIL2R� (19) usingLipofectamine and lysed for analysis 48 h later. Human ES and hES-MP cells (25)were transfected with Amaxa technology (Lonzo) nucleofector kit V (programB-16). A total of 5 � 106 cells were transfected with 2.5 �g of each ZFNIL2R� and2.5 �g ZFNp84 (�30 �g GFPp84). After transfection, 4 � 106 cells were plated ina 96-well plate and 106 cells used for HR or NHEJ analysis. After 4 days, cellswere lysed for analysis. The first round of PCR was performed with 4–7 �L celllysate from each well in a total of 50 �L per well (23 cycles, annealingtemperature of 60 °C). Then 0.5–1 �L of the first PCR was used in a secondnested PCR in a total of 20 �L per well (40 cycles, annealing temperature 60 °C)with SYBR Green for PCR (Stratagene MX3005). PCR products were purified bythe PCR gel Purification Kit (Invitrogen) and directly sequenced or first clonedinto StrataClone PCR Cloning Kit (Stratagene).

ACKNOWLEDGMENTS. We thank Margaret Leversha and Lei Zhang at theMemorial Sloan-Kettering Cancer Center Molecular Cytogenetics Core Facilityfor performing the FISH analysis, Yufuko Akamatsu, Francesca Cole, and othermembers of Jasin laboratory for helpful discussions, and Gene Bryant andDaniel Spagna in Mark Ptashne’s laboratory for technical assistance. This workwas supported by the Byrne Fund, the Heckscher Foundation for Children, andGrant R01 National Institutes of Health GM54668 (to M.J.).

1. Rowley JD (2008) Chromosomal translocations: Revisited yet again. Blood 112:2183–2189.2. Greaves MF, Wiemels J (2003) Origins of chromosome translocations in childhood leukae-

mia. Nat Rev Cancer 3:639–649.3. Tomlins SA, et al. (2005) Recurrent fusion of TMPRSS2 and ETS transcription factor genes

in prostate cancer. Science 310:644–648.4. Soda M, et al. (2007) Identification of the transforming EML4-ALK fusion gene in non-

small-cell lung cancer. Nature 448:561–566.5. Mitelman F, Johansson B, Mertens F (2004) Fusion genes and rearranged genes as a linear

function of chromosome aberrations in cancer. Nat Genet 36:331–334.6. WeinstockDM,ElliottB, JasinM(2006)Amodelofoncogenic rearrangements:Differences

between chromosomal translocation mechanisms and simple double-strand break repair.Blood 107:777–780.

7. LieberMR(2008)ThemechanismofhumannonhomologousDNAend joining. JBiolChem283:1–5.

8. Weinstock DM, Brunet E, Jasin M (2007) Formation of NHEJ-derived reciprocal chromo-somal translocations does not require Ku70. Nat Cell Biol 9:978–981.

9. Bassing CH, Alt FW (2004) The cellular response to general and programmed DNA doublestrand breaks. DNA Repair 3:781–796.

10. Jankovic M, Nussenzweig A, Nussenzweig MC (2007) Antigen receptor diversification andchromosome translocations. Nat Immunol 8:801–808.

11. Callen E, et al. (2007) ATM prevents the persistence and propagation of chromosomebreaks in lymphocytes. Cell 130:63–75.

12. Yan CT, et al. (2007) IgH class switching and translocations use a robust non-classicalend-joining pathway. Nature 449:478–482.

13. Finnie NJ, Gottlieb TM, Blunt T, Jeggo PA, Jackson SP (1995) DNA-dependent proteinkinase activity is absent in xrs-6 cells: Implications for site-specific recombination and DNAdouble-strand break repair. Proc Natl Acad Sci USA 92:320–324.

14. Rouet P, Smih F, Jasin M (1994) Introduction of double-strand breaks into the genome ofmouse cells by expression of a rare-cutting endonuclease. Mol Cell Biol 14:8096–8106.

15. Thierry A, Dujon B (1992) Nested chromosomal fragmentation in yeast using themeganuclease I-Sce I: A new method for physical mapping of eukaryotic genomes. NucleicAcids Res 20:5625–5631.

16. Carroll D (2008) Progress and prospects: Zinc-finger nucleases as gene therapy agents.Gene Ther 15:1463–1468.

17. Maeder ML, et al. (2008) Rapid ‘‘open-source’’ engineering of customized zinc-fingernucleases for highly efficient gene modification. Mol Cell 31:294–301.

18. Esashi F, et al. (2005) CDK-dependent phosphorylation of BRCA2 as a regulatory mecha-nism for recombinational repair. Nature 434:598–604.

19. UrnovFD,etal. (2005)Highlyefficientendogenoushumangenecorrectionusingdesignedzinc-finger nucleases. Nature 435:646–651.

20. WeinstockDM,BrunetE, JasinM(2008) Inductionofchromosomaltranslocations inmouseand human cells using site-specific endonucleases. J Natl Cancer Inst Monogr 20–24.

21. Tsai AG, et al. (2008) Human chromosomal translocations at CpG sites and a theoreticalbasis for their lineage and stage specificity. Cell 135:1130–1142.

22. Pierce AJ, Johnson RD, Thompson LH, Jasin M (1999) XRCC3 promotes homology-directedrepair of DNA damage in mammalian cells. Genes Dev 13:2633–2638.

23. Perez EE, et al. (2008) Establishment of HIV-1 resistance in CD4� T cells by genome editingusing zinc-finger nucleases. Nat Biotechnol 26:808–816.

24. Kotin RM, et al. (1990) Site-specific integration by adeno-associated virus. Proc Natl AcadSci USA 87:2211–2215.

25. Barberi T, Willis LM, Socci ND, Studer L (2005) Derivation of multipotent mesenchymalprecursors from human embryonic stem cells. PLoS Med 2:e161.

26. Riggi N, et al. (2008) EWS-FLI-1 expression triggers a Ewing’s sarcoma initiation programin primary human mesenchymal stem cells. Cancer Res 68:2176–2185.

27. Ren YX, et al. (2008) Mouse mesenchymal stem cells expressing PAX-FKHR form alveolarrhabdomyosarcomas by cooperating with secondary mutations. Cancer Res 68:6587–6597.

28. Smith J, et al. (2000) Requirements for double-strand cleavage by chimeric restrictionenzymes with zinc finger DNA-recognition domains. Nucleic Acids Res 28:3361–3369.

29. Campbell PJ, et al. (2008) Identification of somatically acquired rearrangements in cancerusing genome-wide massively parallel paired-end sequencing. Nat Genet 40:722–729.

30. Morton J, Davis MW, Jorgensen EM, Carroll D (2006) Induction and repair of zinc-fingernuclease-targeted double-strand breaks in Caenorhabditis elegans somatic cells. Proc NatlAcad Sci USA 103:16370–16375.

31. Miller JC, et al. (2007) An improved zinc-finger nuclease architecture for highly specificgenome editing. Nat Biotechnol 25:778–785.

32. Pierce AJ, Hu P, Han M, Ellis N, Jasin M (2001) Ku DNA end-binding protein modulateshomologous repair of double-strand breaks in mammalian cells. Genes Dev 15:3237–3242.

33. Delacote F, Han M, Stamato TD, Jasin M, Lopez BS (2002) An xrcc4 defect or Wortmanninstimulates homologous recombination specifically induced by double-strand breaks inmammalian cells. Nucleic Acids Res 30:3454–3463.

34. Pruett-Miller SM, Connelly JP, Maeder ML, Joung JK, Porteus MH (2008) Comparison ofzinc finger nucleases for use in gene targeting in mammalian cells. Mol Ther 16:707–717.

35. Pruett-Miller SM, Reading DW, Porter SN, Porteus MH (2009) Attenuation of zinc fingernuclease toxicity by small-molecule regulation of protein levels. PLoS Genet 5:e1000376.

36. Redondo P, et al. (2008) Molecular basis of xeroderma pigmentosum group C DNArecognition by engineered meganucleases. Nature 456:107–111.

37. Cannata F, et al. (2008) Triplex-forming oligonucleotide-orthophenanthroline conjugatesfor efficient targeted genome modification. Proc Natl Acad Sci USA 105:9576–9581.

38. Chin JY, Glazer PM (2008) Repair of DNA lesions associated with triplex-forming oligonu-cleotides. Mol Carcinog 48:389–399.

39. Richardson C, Moynahan ME, Jasin M (1998) Double-strand break repair by interchromo-somal recombination: Suppression of chromosomal translocations. Genes Dev 12:3831–3842.

Brunet et al. PNAS � June 30, 2009 � vol. 106 � no. 26 � 10625

BIO

CHEM

ISTR

Y

Dow

nloa

ded

by g

uest

on

Nov

embe

r 24

, 202

1