cloning and expression profiling of hpa2, a novel mammalian heparanase family member

Cloning and Expression Profiling of Hpa2, a NovelM

EMO

R

smnaiiirtaastcapHtdlh

di

alpaEvitp

5

Biochemical and Biophysical Research Communications 276, 1170–1177 (2000)

doi:10.1006/bbrc.2000.3586, available online at http://www.idealibrary.com on

0CA

ammalian Heparanase Family Member

dward McKenzie,1 Kerry Tyson,1 Alasdair Stamps, Paul Smith, Paul Turner, Richard Barry,argaret Hircock, Sonal Patel, Eleanor Barry, Colin Stubberfield, Jon Terrett, and Martin Page2

xford GlycoSciences, 10 The Quadrant, Abingdon Science Park, Abingdon, Oxon, OX14 3YS, United Kingdom

eceived August 29, 2000

of the basement membranes and the ECM of mostt

otthtpneectsbcifir(mbdmw

nalh(ha2mtlzh

Heparan sulfate proteoglycans are important con-tituents of the extracellular matrix and basementembrane. Cleavage of heparan sulfate by hepara-ase, an endoglycosidase, is implicated in the extrav-sation of leukocytes and metastatic tumour cells,dentifying this enzyme(s) as a target for anti-nflammatory and anti-metastatic therapies. The clon-ng of a cDNA encoding human heparanase (Hpa1) waseported recently, together with evidence indicatinghat the hpa1 gene is unique and unlikely to belong tofamily of related genes. Here we report the cloning ofcDNA encoding a novel human protein, HPA2, with

ignificant homology to Hpa1. Alternative splicing ofhe hpa2 transcript yields three different mRNAs, en-oding putative proteins of 480, 534, and 592 aminocids. Sequence analyses predict that all three Hpa2roteins are intracellular, membrane-bound enzymes.pa2 also shows a markedly different mRNA distribu-

ion to Hpa1 in both normal and cancer tissues. Theifference in expression profiles and predicted cellu-

ar locations suggests that Hpa2 and Hpa1 proteinsave distinct biological functions. © 2000 Academic Press

Key Words: heparanase; novel; homologue; mRNAistribution; chromosomal localization; cancer;

nflammation.

Remodelling of the extracellular matrix (ECM) playsn important role in a variety of biological and patho-ogical processes, including angiogenesis, wound re-air, inflammation and the invasion of tissues by met-static tumour cells. The enzymes that degrade theCM are thus potential targets for therapeutic inter-ention in a number of pathological conditions. Thesenclude heparanase, an endoglycosidase that cleaveshe heparan sulfate (HS) side chains of heparan sulfateroteoglycans (HSPGs), which are major components

1 The first two authors contributed equally to this study.2 To whom correspondence should be addressed. Fax: 144 1235

43283. E-mail: [email protected].

1170006-291X/00 $35.00opyright © 2000 by Academic Pressll rights of reproduction in any form reserved.

issues.Heparanase activity has been detected in a number

f cell types and tissues (1–7), and its role in the ex-ravasation of blood-borne tumour cells and inflamma-ory leukocytes has been recognised (8, 9). Indeed,eparanase activity has been shown to correlate withhe metastastic potential of mouse melanoma and lym-homa cell lines (8–10), whilst inhibitors of hepara-ase activity also inhibit tumour metastasis, angiogen-sis, inflammation and autoimmunity in somexperimental models (11–17). In addition to its role inellular migration, heparanase activity is also believedo regulate a number of other physiological processes,uch as proliferation and chemotaxis, by releasing HS-ound growth factors and cytokines from the ECM orell surface (18, 19). Recent evidence suggests thatntracellular heparanases can release growth factorsrom proteoglycans and HS fragments which have beennternalized (20), and that they may be involved in theecycling and modification of cell surface proteoglycans21, 22). HSPGs have also been implicated in the for-

ation and persistence of senile plaques and neurofi-rillary tangles in Alzheimer’s disease (23). The eluci-ation therefore of the heparanases involved and theirechanism of action in the catabolism of brain HSPGsill be important towards the study of amyloidosis.Heparanase enzymes have been purified from a

umber of different sources and species (1, 24–27), andre reported to have a wide range of molecular weights,eading to some debate regarding the number ofeparanase enzymes (28), their substrate specificities25, 29) and identity with other proteins. For example,uman platelet heparanase has been reported to havemolecular weight ranging from 8 to 137 kDa (1, 25,

7), whilst a 98-kDa heparanase was purified fromouse melanoma (24). More recently the hypothesis

hat multiple heparanase enzymes exist was chal-enged by the purification of identical heparanase en-ymes from human placenta, platelets and a humanepatoma cell line (30–33). Furthermore, recent clon-

haaii

Vol. 276, No. 3, 2000 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

FIG. 1. Nucleotide and predicted amino acid sequence of Hpa2. (a) Nucleotide (above) and predicted amino acid (below) sequence ofpa2a; the number of nucleotides and amino acid residues are indicated by the numbers on the right (amino acids in italics). Translation startnd stop codons are in bold face. The predicted transmembrane segment (bold face) and putative heparin binding motif are underlined. Therrow denotes the site for alternative splicing of hpa2. (b) Alternatively spliced exons for hpa2b and hpa2c. Identical amino acids are intalics. (c) Amino acid sequence of Hpa1 (top) aligned with the predicted amino acid sequence of Hpa2a (bottom). Identical amino acids arendicated by solid, vertical lines. The proposed linker region of Hpa1 (32) is underlined.

ignh

rm

hicnttn

ta


ng of the corresponding cDNA and analysis of humanenomic DNA lead to the conclusion that the hepara-ase gene is unique, and that a family of relatedeparanase proteins was unlikely to exist (30, 31).The discovery of hpa1 with its associated disease

elevance has greatly accelerated the need to deter-ine whether other related family members exist, per-

FIG. 2. Tissue distribution of hpa1 and hpa2 mRNAs. Levels ofumour xenografts (hatched bars), and cell lines grown in vitro (opennd fluorescent probes specific to each gene. mRNA levels are expre

1172

aps with altered substrate specificities, cellular local-sation and tissue distribution. Here we report theloning and characterization of a novel human protein,amed Hpa2, that is capable of coding for three pro-eins generated by alternative splicing of the hpa2ranscript. Our finding that hpa2 expression in humanormal and cancer tissues is markedly different to that

) hpa1 and (b) hpa2 mRNAs in normal tissues (solid bars), humanrs) were assessed by real time quantitative RT-PCR, using primersd as the number of copies ng21 cDNA.

(aba

sse

of hpa1 suggests that Hpa2 may have a biological andt

M

H(poEaphhCtGuacltmi(

ufdancicpRtsdwtTGCPmaiudahc

tartHmh

hdb

scribed above. Products amplified by RT-PCR were analysed byagarose gel electrophoresis.

hHPTChapTgahMc

R

qdofiucpfisep(hcasptqghdA

Hi1mNreiutc

caa


herapeutic role in cancer and CNS indications.

ATERIALS AND METHODS

Cloning of hpa2 cDNAs. Three non-overlapping ESTs encodingpa2 sequences were identified by searching a proprietary database

Incyte, July 1999 Release) with the Hpa1 protein sequence using therogram TBLASTN. EST1 (117316.1) corresponded to bp 727–1186f the hpa2a sequence (Fig. 1) and included the hpa2b splice exon.STs 2 (139678.1) and 3 (273691.1) corresponded to bp 1227–1729nd 1773–2003 of the hpa2a sequence, respectively. Oligonucleotiderimers were designed to PCR amplify each of the ESTs usinguman mammary gland cDNA (Clontech) as template. Primersepa2F (59 GCAGTTACCTGGCAACATTG 39) and hepa3R (59 GTC-CGTCGTCCACCATC 39) were used to PCR amplify sequences be-

ween ESTs 2 and 3. Primers hepa4F (59 GTAGACAGAGCTGCAG-TTTG 39) and hepa2R (59 GCAGCATAGGAATCGGATAG 39) weresed to amplify sequences between ESTs 1 and 2, including thelternatively spliced exons. All PCR products were cloned using a TAloning kit (Invitrogen) and subsequently sequenced with a dye-abelled dideoxy-terminator cycle sequencing kit (CEQ DTCS) andhe reactions processed on a CEQ 2000 automated sequencer (Beck-an, Coulter). The start of the open reading frame was obtained by

solating a full-length clone from an Origene heart cDNA libraryCambridge Biosciences).

RT-PCR analysis of hpa2 expression. Real time RT-PCR wassed to quantitatively measure hpa1 and hpa2 expression in RNAsrom normal human tissues (Clontech) and cell lines, and cDNAserived from the following human tumour xenografts propagated inthymic nude mice (Clontech): breast carcinoma GI-101, lung carci-oma LX-1, lung carcinoma GI-117, colon adenocarcinoma CX-1,olon adenocarcinoma GI-112, prostatic adenocarcinoma PC3, ovar-an carcinoma GI-102, and pancreatic adenocarcinoma GI-103.DNAs were synthesized from 5 mg total RNA using an oligo dTrimer and SuperscriptII reverse transcriptase (Life Technologies).eactions containing 10 ng cDNA, reagents for PCR (PE Biosys-

ems), sense and antisense primers and fluorescently labelled probepecific to either hpa1 or hpa2 were run on an ABI7700 sequenceetection system (PE Biosystems). The primer and probe sequencesere: hpa1 sense 59 GAGAAGTGATTGATTCAGTTAC 39, hpa1 an-

isense 59 GCCTGGTGCTCTCAACCACCTGGA 39, hpa1 probe 59CCCTGGTAGCAGTCCGTCCAT 39, hpa2 sense 59 GCAGTTACCT-GCAACATTGC 39, hpa2 antisense 59 GTCCCGTCGTCCACCAT-AC 39, hpa2 probe 59 CTCGCCTGTTAGACACACTCTCTG 39. TheCR conditions were 1 cycle at 50°C for 2 min, 1 cycle at 95°C for 10in, followed by 40 cycles of 95°C for 15 s, 55°C for 1 min. The

ccumulation of PCR product was measured in real time as thencrease in reporter dye fluorescence, and the data were analysedsing the Sequence Detector program v1.6.3 (PE Biosystems). Stan-ard curves relating initial template copy number to fluorescencend amplification cycle number were generated using either thepa1 or hpa2 amplified PCR product as a template, and were used toalculate hpa1 and hpa2 mRNA copy number in each sample.

Northern and RNA dot blot analysis. Hpa2 transcript size andissue distribution was examined by Northern and RNA dot blotnalyses. A full length hpa2b cDNA probe was radiolabelled byandom priming (Stratagene) and hybridized to a human muscleissue RNA blot (Clontech), using Expresshyb solution (Clontech).ybridization and wash conditions were as recommended by theanufacturer. The Northern blot was stripped and probed with auman b-actin cDNA probe to control for RNA loading.

RT-PCR analysis of hpa2 splice form tissue distribution. Primersepa4F and hepa2R (described above) were used to examine theistribution of hpa2 splice forms in human cDNAs from normalreast, testis, uterus and the breast and pancreatic xenografts de-

1173

Radiation hybrid mapping. Chromosomal localization of thepa2 gene was achieved by screening the Genebridge 4 Radiationybrid panel (Research Genetics Inc.) using the following pair ofCR primers derived from the 39 untranslated region: sense 59TCAGACATCCTAGCAACCAGC 39 and antisense 59 TATAGGTA-AGGTGATGTCTAC 39. The PCR conditions for amplification ofpa2 sequences were denaturation for 30 s at 94°C, followed bynnealing and extension for 30 s at 60°C (40 cycles), using Taq DNAolymerase and Q buffer (Qiagen) and 25 ng DNA per reaction.hese primers amplified the expected 152-bp fragment from humanenomic DNA and the positive hybrid cell line DNAs, and failed tomplify product from hamster genomic DNA (control). The radiationybrid mapping data were submitted to the Whitehead Institute/IT Center for Genome Research STS mapping server (http://

arbon.wi.mit.edu:8000/cgi-bin/contig/rhmapper.pl) for analysis.

ESULTS

Cloning of hpa2. The published amino acid se-uence of Hpa1 was used to search a proprietary ESTatabase (Incyte). Three nonoverlapping ESTs withpen reading frames homologous to Hpa1 were identi-ed. Using primers designed to these ESTs, PCR prod-cts were amplified and sequenced from human breastDNA, confirming that the ESTs constitute one generoduct, which we have designated hpa2. PCR ampli-cation of hpa2 fragments revealed that the hpa2 tran-cript is alternatively spliced to generate three differ-nt mRNAs, hpa2a, b, and c, which encode putativeroteins of 480, 534, and 592 amino acids, respectively,Fig. 1). The amplified fragments were used to screen auman heart cDNA library, and identified a full-lengthlone, corresponding to hpa2b, which also contained 59nd 39 untranslated region (UTR) sequences. A TGAtop codon is located immediately upstream of the pro-osed ATG start codon, precluding the possibility of aranslation start further upstream. Additional 59 se-uences were obtained by PCR screening of humanenomic DNA libraries. The nucleotide sequences ofpa2a, b, and c have been submitted to the GenBankatabase, under the Accession Nos. AF282885,F282886, and AF282887, respectively.Alignment of the predicted coding region of Hpa2a topa1 revealed that the two proteins have an overall

dentity of 35% (http://www.ibcp.fr/clustalw.html) (Fig.). It has been suggested that the active form of Hpa1ay exist as a heterodimer composed of an 8 kDa-terminal subunit and a 50 kDa C-terminal subunit,

esulting from protease processing and linker regionxcision of the latent full length protein (33). Interest-ngly the homology between the two proteins is partic-larly striking over both these subunits, implicatinghat this model may also apply to Hpa2. However, theorresponding linker region of Hpa2 is not obvious.Hpa2 is noticeably very rich in basic residues, espe-

ially towards the C-terminus (16% overall for Hpa2a),nd low in acidic residues (overall 7%), consistent withrole in binding negatively charged glycosaminogly-

cans. Furthermore, the region between Asn 2374 andAsbIsNn

thlpblltnitsi1tcp

btoiewechEwphpnimlppTe

awamca

tseafccnyeo

b1tmc((saP(

D

bpa

Rcms


sn 2379, inclusive, matches the heparin-binding con-ensus sequence [X-B-B-X-B-X-], where B representsasic and X represents small neutral amino acids (34).n contrast to Hpa1, Hpa2 does not appear to have aignal peptide recognition sequence, but has a putative-terminal transmembrane domain (http://psort.ibb.ac.jp).

Tissue distribution of hpa2 mRNA. Real time quan-itative RT-PCR (35) was used to measure hpa2 andpa1 mRNA expression in normal human tissues, cell

ines, and xenografts of human breast, colon, lung,rostate, ovarian and pancreatic tumours that hadeen propagated in athymic nude mice (Fig. 2). Highevels of hpa1 expression were detected in placenta andymph node (1200 and 4000 copies ng21 cDNA, respec-ively), with low levels of expression (10–400 copiesg21 cDNA) in most of the other normal tissues exam-

ned. Hpa1 mRNA levels were increased in all of theumour xenograft samples compared with the corre-ponding normal tissues, ranging from a 2- to 6-foldncrease in the colon adenocarcinoma xenografts, to a00- to 200-fold increase in the lung and pancreaticumour xenografts. This profile of hpa1 expression isonsistent with previous reports (30, 31) and the pro-osed role of heparanase in tumour biology.In contrast, levels of hpa2 mRNA were highest in

rain, mammary gland, prostate, small intestine, tes-is and uterus (150–350 copies ng21 cDNA), with littler no expression in most other normal tissues exam-ned, including placenta and lymph node (Fig. 2). Hpa2xpression within different sub-regions of the brainas highest in the caudate nucleus, thalamus and cer-bellum, whereas hpa1 expression was highest in theaudate nucleus, thalamus and cerebellum, whereaspa1 expression was highest in the corpus callosum.xpression of hpa2 in the breast carcinoma xenograftas high, although not elevated over the level of ex-ression observed in normal mammary gland. Theighest levels of hpa2 mRNA were detected in theancreatic adenocarcinoma xenograft (700–850 copiesg21 cDNA) whereas hpa2 message is barely detectable

n normal pancreas. Significant expression of hpa2RNA was also seen in the pancreatic tumour cell

ines MiaPaca-2 and Panc-1 when grown in vitro. Ex-ression of hpa2 mRNA in the colon, lung, ovarian androstate cancer xenografts was low or undetectable.hus the tissue distribution of hpa2 mRNA is mark-dly different to that of hpa1.Northern analysis using the full length hpa2b cDNA

s a probe, under high stringency hybridisation andashing conditions, detected a single mRNA species ofpproximately 4.4 kb when hybridised to a humanultiple tissue RNA blot (Fig. 3). The hpa2b probe

ontains sequences common to all three splice forms,nd should detect all hpa2 mRNAs expressed. Whilst

1174

his result might indicate that only one of the hpa2plice forms is predominantly expressed in the tissuesxamined, it is possible that the three hpa2 transcriptsre not resolved on this blot. All three hpa2 spliceorms were detected though by RT-PCR analysis ofDNAs from human breast, testis, uterus and the pan-reatic and breast cancer xenografts described (dataot shown). Northern (Fig. 3) and RNA dot blot anal-ses (data not shown) also showed high levels of hpa2xpression in normal bladder, aorta, brain medullablongata, putamen and pons.

Chromosomal localization of hpa2. Radiation Hy-rid mapping localized the hpa2 gene to chromosome0q23–24, between markers WI-5915 and WI-4209 onhe Whitehead Institute STS map. This region of chro-osome 10 defines a loss of heterozygosity (LOH) lo-

us, which includes the tumour suppressor gene PTEN35). Interestingly, the gene for PAPS synthetase 2PAPSS2), which catalyzes the formation of PAPS, theulfate donor for posttranslational protein sulfation,lso maps to 10q23 (37, 38), whilst the genes encodingAPS synthetase 1 and Hpa1 map to chromosome 4q24

38) and 4q21.3 (39), respectively.

ISCUSSION

The degradation of HSPGs impacts a wide variety ofiological and pathological processes, by removing ahysical barrier to the movement of cells into tissuesnd by releasing bioactive molecules from the ECM or

FIG. 3. Northern analysis of hpa2 transcripts. (a) Multiple tissueNA blot hybridized with a full length hpa2b probe. Each laneontains poly A1 RNA from the tissues indicated. Molecular weightarkers are indicated in the left margin. (b) b-actin probe of the

ame blot to control for RNA loading.

cell surface. The recent cloning of a mammalianhudhtchz

tllrssgititoptgeoplcciao

pHtsblqBHfioh8brccps

ms

where Hpa1 protein has been detected in invasive tro-ptpTsHwcoimcwssfitHwcpoi

shitfphcihec

htpwllommetcte

A

G


eparanase, Hpa1, will facilitate studies to further ournderstanding of the role of this enzyme in health andisease, and will aid the evaluation of heparanase in-ibitors as anti-metastatic and anti-inflammatoryherapies. Here we report the cloning of a novel humanDNA, hpa2, which encodes a protein with significantomology to Hpa1, thus expanding this family of en-ymes.Hpa2 was cloned based on its homology to Hpa1 at

he amino acid level. The two proteins are clearly re-ated, with regions of similarity along their entireength. The Hpa1 sequence contains a hydrophobicegion at the N-terminus that is characteristic of aignal peptide sequence, suggesting that Hpa1 may beecreted (30, 31). Secretion of Hpa1 would enable mi-rating cells to degrade the surrounding ECM, promot-ng their movement across basal lamina and entry intoissues and sites of inflammation. However, the activ-ty of an extracellular heparanase may need to beightly regulated to avoid the inappropriate catabolismf HSPGs. In this context, Hpa1 appears to be ex-ressed as a pro-enzyme that requires processing intowo subunits, with loss of the intervening linker re-ion, for enzyme activation (33). This putative het-rodimer model may also apply to Hpa2, as the homol-gy between the two proteins extends over bothroposed Hpa1 subunits. However, the correspondinginker region and proposed cleavage sites are not wellonserved, suggesting that the post-translational pro-essing of Hpa1 and Hpa2 may be different. At presentt is not known if Hpa2 proteins are constitutivelyctive, or if activity is regulated by protein processing,r by some as yet unidentified mechanism.Hpa2 also differs from Hpa1 in that it lacks a signal

eptide sequence. The hydrophobic N-terminus ofpa2 is predicted to be a transmembrane domain, with

he C-terminus retained inside the cell. Thus fromequence analyses, Hpa2 appears to be a membrane-ound, intracellular enzyme, although (the precise cel-ular location(s) of Hpa2 and Hpa1 proteins will re-uire experimental verification). An investigation byame et al. (28) into the intracellular degradation ofSPGs by Chinese Hamster ovary (CHO) cells identi-ed four heparanase activities. It is possible that somef these activities are encoded by a rodent homologue ofpa2, since a mouse EST (IMAGE clone 1378452) with9% homology to hpa2 has been deposited in the Gen-ank EST database. Furthermore, PCR primers de-ived from the 39 UTR of hpa2 had to be used to map itshromosomal location, as hpa2 primers designed tooding regions of the nucleotide sequence amplifiedroducts from both hamster and human genomic DNA,uggesting that the coding bodies are highly conserved.Hpa1 and Hpa2 show very different patterns ofRNA distribution. In normal tissues, hpa1 expres-

ion is restricted to haematopoietic cells and placenta,

1175

hoblasts (40). In contrast, hpa2 expression is low inhese tissues, but higher in brain, mammary gland,rostate, small intestine, testis, uterus, and bladder.his markedly different pattern of hpa2 expressionuggests that, at least in normal tissues, Hpa2 andpa1 may fulfil different functions. Hpa1 expressionas elevated in all of the tumour xenografts and cancer

ell lines examined in this study, and over-expressionf this enzyme in cell lines correlates with an increasen metastatic potential (30, 31). By comparison, hpa2

RNA was detected in only the breast and pancreaticell lines. Expression in the breast cancer xenograftas not increased compared to normal mammary tis-

ue. Preliminary analysis of hpa2 expression in clinicalamples of normal and tumour breast tissue have con-rmed that expression levels are unchanged betweenhe normal and tumour samples (data not shown).owever, hpa2 expression in the pancreatic xenograftas dramatically elevated compared to normal pan-

reas, although in a small set of clinical samples ofancreatic tumours this increase in expression was notbserved (data not shown). Further experimental stud-es are warranted though to clarify this point.

HSPGs also appear to be involved in the pathogene-is of Alzheimer’s disease (AD). In AD brains, HSPGsave been shown to colocalise with beta-amyloid (Ab)

n senile plaques, and evidence suggests that interac-ions between Ab and the proteoglycan are importantor the deposition and persistence of the amyloid de-osits (23, 42). Thus the turnover of proteoglycans byeparanase might be important for preventing the ac-umulation of Ab-proteoglycan complexes in normalndividuals (43). Our data indicate that both hpa1 andpa2 are expressed in human brain, with each mRNAxhibiting a different pattern of expression in the spe-ific brain subregions examined.In conclusion, we have cloned a novel human cDNA,

pa2, capable of encoding three new heparanase pro-eins. Functional studies using mammalian overex-ression systems are currently underway to examinehether this new family of enzymes have heparanase-

ike enzymatic activity and are able to degrade radio-abelled HS substrate. Although the hpa1 gene wasriginally identified as a unique sequence in the hu-an genome encoding a protein with no other familyembers, Hpa1 and Hpa2 are clearly related. How-

ver, Hpa1 and Hpa2 enzymes appear to have differentissue distributions and possibly different cellular lo-ations. Further studies should clarify the relative con-ributions of these proteins to human health and dis-ase, and may identify additional therapeutic utilities.

CKNOWLEDGMENTS

We thank Dr. Gordon Holt and Professor Raj Parekh at OxfordlycoSciences for helpful discussions with these studies.

REFERENCES

1

1

1

1

1

1

1

1

Baharav, E., Cohen, I. R., and Naparstek, Y. (1990) Inhibition ofT lymphocyte heparanase by heparin prevents T cell migration

1

1

2

2

2

2

2

2

2

2

2

2

3

3

3


1. Oosta, G. M., Favreau, L. V., Beeler, D. L., and Rosenberg, R. D.(1982) Purification and properties of human platelet hepariti-nase. J. Biol. Chem. 257, 11249–11255.

2. Naparstek, Y., Cohen, I. R., Fuks, Z., and Vlodavsky, I. (1984)Activated T-lymphocytes produce a matrix-degrading heparansulfate endoglycosidase. Nature 310, 241–243.

3. Sewell, R. F., Brenchley, P. E., and Mallick, N. P. (1989) Humanmononuclear cells contain an endoglycosidase specific for hepa-ran sulfate glycosaminoglycan demonstrable with the use of aspecific solid-phase metabolically radiolabelled substrate. Bio-chem. J. 264, 777–783.

4. Klein, U., and von Figura, K. (1979) Substrate specificity of aheparan sulfate-degrading endoglucuronidase from human pla-centa. Hoppe Seylers Z. Physiol. Chem. 360, 1465–1471.

5. Kosir, M. A., Quinn, C. C., Zukowski, K. L., Grignon, D. J., andLedbetter, S. (1997) Human prostate carcinoma cells produceextracellular heparanase. J. Surg. Res. 67, 98–105.

6. Godder, K., Vlodavsky, I., Eldor, A., Weksler, B. B., Haimovitz-Freidman, A., and Fuks, Z. (1991) Heparanase activity in cul-tured endothelial cells. J. Cell Physiol. 148, 274–280.

7. Bame, K. J. (1993) Release of heparan sulfate glycosaminogly-cans from proteoglycans in Chinese hamster ovary cells does notrequire proteolysis of the core protein. J. Biol. Chem. 268,19956–19964.

8. Vlodavsky, I., Fuks, Z., Bar-Ner, M., Ariav, Y., and Schirrma-cher, V. (1983) Lymphoma cell mediated degradation of sulfatedproteoglycans in the subendothelial extracellular matrix: rela-tionship to tumor cell metastasis. Cancer Res. 43, 2704–2711.

9. Vlodavsky, I., Eldor, A., Haimovitz-Friedman, A., Metzner, Y.,Ishai-Michaeli, R., Lider, O., Naparstek, Y., Cohen, I. R., andFuks, Z. (1992) Expression of heparanase by platelets and circu-lating cells of the immune system: possible involvement in dia-pedesis and extravasation. Invasion Metastasis 12, 112–127.

0. Nakajima, M., Irimura, T., DiFerrante, D., DiFerrante, N., andNicolson, G. L. (1983) Heparan sulfate degradation: Relation totumor invasive and metastatic properties of mouse B16 mela-noma sublines. Science 220, 611–613.

1. Vlodavsky, I., Mohsen, M., Lider, O., Svahn, C. M., Ekre, H. P.,Vigoda, M., Ishai-Michaeli, R., and Peretz, T. (1995) Inhibition oftumor metastasis by heparanase inhibiting species of heparin.Invasion Metastasis 14, 290–302.

2. Parish, C. R., Coombe, D. R., Jakobsen, K. B., and Underwood,P. A. (1987) Evidence that sulphated polysaccharides inhibittumor metastasis by blocking tumor cell-derived heparanase.Int. J. Cancer 40, 511–517.

3. Parish, C. R., Freeman, C., Brown, K. J., Francis, D. J., andCowden, W. B. (1999) Identification of sulfated oligosaccharide-based inhibitors of tumor growth and metastasis using novel invitro assays for angiogenesis and heparanase activity. CancerRes. 59, 3433–3441.

4. Parish, C. R., Hindmarsh, E. J., Bartlett, M. R., Staykova, M. A.,Cowden, W. B., and Willenborg, D. O. (1998) Treatment of cen-tral nervous system inflammation with inhibitors of basementmembrane degradation. Immunol. Cell Biol. 76, 104–113.

5. Willenborg, D. O., and Parish, C. R. (1988) Inhibition of allergicencephalomyelitis in rats by treatment with sulfated polysaccha-rides. J. Immunol. 140, 3401–3405.

6. Lider, O., Baharav, E., Mekori, Y. A., Miller, T., Naparstek, Y.,Vlodavsky, I., and Cohen, I. R. (1989) Suppression of experimen-tal autoimmune diseases and prolongation of allograft survivalby treatment of animals with low doses of heparins. J. Clin.Invest. 83, 752–756.

7. Lider, O., Mekori, Y. A., Miller, T., Bar-Tana, R., Vlodavsky, I.,

1176

and T cell-mediated immunity. Eur. J. Immunol. 20, 493–499.8. Bashkin, P., Doctrow, S., Klagsbrun, M., Svahn, C. M., Folkman,

J., and Vlodavsky, I. (1989) Basic fibroblast growth factor bindsto subendothelial extracellular matrix and is released by hep-aritinase and heparin-like molecules. Biochemistry 28, 1737–1743.

9. Vlodasvsky, I., Korner, G., Ishai-Michaeli, R., Bashkin, P., Bar-Shavit, R., and Fuks, Z. (1990) Extracellular matrix-residentgrowth factors and enzymes: Possible involvement in tumor me-tastasis and angiogenesis. Cancer Metastasis Rev. 9, 203–226.

0. Tumova, S., Hatch, B. A., Law, D. J., and Bame, K. J. (1999)Basic fibroblast growth factor does not prevent heparan sulphateproteoglycan catabolism in intact cells, but it alters the distri-bution of the glycosaminoglycan degradation products. Biochem.J. 337, 471–481.

1. Fransson, L. A., Edgren, G., Havsmark, B., and Schmidtchen, A.(1995) Recycling of a glycophosphatidylinositol-anchored hepa-ran sulphate proteoglycan (glypican) in skin fibroblasts. Glyco-biology 5, 407–415.

2. Edgren, G., Havsmark, B., Jonsson, M., and Fransson, L. A.(1997) Glypican (heparan sulphate proteoglycan) is palmitoy-lated, deglycanated and reglycanated during recycling in skinfibroblasts. Glycobiology 7, 103–112.

3. Snow, A. D., Sekiguchi, R., Nochlin, D., Fraser, P., Kimata, K.,Mizutani, A., Arai, M., Schreier, W. A., and Morgan, D. G. (1994)An important role of heparan sulfate proteoglycan (Perlecan) ina model system for the deposition and persistence of fibrillar Abeta-amyloid in rat brain. Neuron 12, 219–234.

4. Jin, L., Nakajima, M., and Nicolson, G. L. (1990) Immunochemi-cal localization of heparanase in mouse and human melanomas.Int. J. Cancer 45, 1088–1095.

5. Hoogewerf, A. J., Leone, J. W., Reardon, I. M., Howe, W. J., Asa,D., Heinrikson, R. L., and Ledbetter, S. R. (1995) CXC chemo-kines connective tissue activating peptide-III and neutrophilactivating peptide-2 are heparin/heparan sulfate-degrading en-zymes. J. Biol. Chem. 270, 3268–3277.

6. Goshen, R., Hochberg, A. A., Korner, G., Levy, E., Ishai-Michaeli, R., Elkin, M., de Groot, N., and Vlodavsky, I. (1996)Purification and characterization of placental heparanase andits expression by cultured cytotrophoblasts. Mol. Hum. Reprod.2, 679–684.

7. Freeman, C., and Parish, C. R. (1998) Human platelet hepara-nase: Purification, characterization and catalytic activity. Bio-chem. J. 330, 1341–1350.

8. Bame, K. J., Hassall, A., Sanderson, C., Venkatesan, I., and Sun,C. (1998) Partial purification of heparanase activities in Chinesehamster ovary cells: Evidence for multiple intracellular hepara-nases. Biochem. J. 336, 191–200.

9. Pikas, D. S., Li, J.-P., Vlodavsky, I., and Lindahl, U. (1998)Substrate specificity of heparanases from human hepatoma andplatelets. J. Biol. Chem. 273, 18770–18777.

0. Vlodavsky, I., Friedmann, Y., Elkin, M., Aingorn, H., Atzmon, R.,Ishai-Michaeli, R., Bitan, M., Pappo, O., Peretz, T., Michal, I.,Spector, L., and Pecker, I. (1999) Mammalian heparanase: Genecloning, expression and function in tumor progression and me-tastasis. Nature Med. 5, 793–802.

1. Hulett, M. D., Freeman, C., Hamdorf, B. J., Bake, R. T., Harris,M. J., and Parish, C. R. (1999) Cloning of mammalian hepara-nase, an important enzyme in tumor invasion and metastasis.Nature Med. 5, 803–809.

2. Kussie, P. H., Hulmes, J. D., Ludwig, D. L., Patel, S., Navarro,E. C., Seddon, A. P., Giorgio, N. A., and Bohlen, P. (1999) Cloning

and functional expression of a human heparanase gene. Bio-chem. Biophys. Res. Commun. 261, 183–187.

3

3

3

3

3

pressed in metastatic and non-metastatic colon carcinoma cells.Int. J. Biochem. Cell Biol. 31, 613–626.

3

3

4

4

4


3. Fairbanks, M. B., Mildner, A. M., Leone, J. W., Cavey, G. S.,Mathews, W. R., Drong, R. F., Slightom, J. L., Bienkowski, M. J.,Smith, C. W., Bannow, C. A., and Heinrikson, R. L. (1999)Processing of the human heparanase precursor and evidencethat the active enzyme is a heterodimer. J. Biol. Chem. 274,29587–29590.

4. Cardin, A. C., and Weintraub, H. R. J. (1989) Molecular model-ling of protein-glycosaminoglycan interactions. Arteriosclerosis9, 21–32.

5. Heid, C. A., Stevens, J., Livak, K. J., and Williams, P. M. (1996)Real time quantitative PCR. Genome Res. 6, 986–994.

6. Li, J., Yen, C., Liaw, D., Podsypanina, K., Bose, S., Wang, S. I.,Puc, J., Miliaresis, C., Rodgers, L., McCombie, R., Bigner, S. H.,Giovanella, B. C., Ittmann, M., Tycko, B., Hibshoosh, H., Wigler,M. H., and Parsons, R. (1997) PTEN, a putative protein tyrosinephosphatase gene mutated in human brain, breast and prostatecancer. Science 275, 1943–1947.

7. Franzon, V. L., Gibson, M. A., Hatzinikolas, G., Woollatt, E.,Sutherland, G. R., and Cleary, E. G. (1999) Molecular cloning ofa novel human PAPS synthetase which is differentially ex-

1177

8. Xu, Z. H., Otterness, D. M., Freimuth, R. R., Carlini, E. J., Wood,T. C., Mitchell, S., Moon, E., Kim, U. J., Xu, J. P., Siciliano, M. J.,and Weinshilboum, R. M. (2000) Human 39-phosphoadenosine59-phosphosulfate synthetase 1 (PAPSS1) and PAPSS2: Genecloning, characterization and chromosomal localization. Bio-chem. Biophys. Res. Commun. 268, 437–444.

9. Baker, E., Crawford, J., Sutherland, G. R., Freeman, C., Parish,C. R., and Hulett, M. D. (1999) Human HPA endoglycosidaseheparanase. Map position 4q21.3. Chromosome Res. 7, 319.

0. Dempsey, L. A., Plummer, T. B., Coombes, S. L., and Platt, J. L.(2000) Heparanase expression in invasive trophoblasts andacute vascular damage. Glycobiology 10, 467–475.

1. Brunden, K. R., Richter-Cook, N. J., Chaturvedi, N., and Fred-erickson, R. C. (1993) pH-dependent binding of synthetic beta-amyloid peptides to glycosaminoglycans. J. Neurochem. 61,2147–2154.

2. Bame, K. J., Danda, J., Hassall, A., and Tumova, S. (1997)Ab(1-40) prevents heparanase-catalyzed degradation of heparansulfate glycosaminoglycans and proteoglycans in vitro: A role forheparan sulfate proteoglycan turnover in Alzheimer’s disease.J. Biol. Chem. 272, 17005–17011.

cloning and expression profiling of hpa2, a novel mammalian heparanase family member

Documents