Deep-Sea Research II 99 (2014) 83–91

Contents lists available at ScienceDirect

Deep-Sea Research II

0967-06http://d

n CorrE-m

journal homepage: www.elsevier.com/locate/dsr2

Complete mitochondrial genomes elucidate phylogenetic relationshipsof the deep-sea octocoral families Coralliidae and Paragorgiidae

Diego F. Figueroa n, Amy R. BacoDepartment of Earth, Ocean and Atmospheric Science, Florida State University, Tallahassee, FL 32306, USA

a r t i c l e i n f o

Available online 19 June 2013

Keywords:Molecular phylogeneticsMitochondrial genomeGene rearrangementSoft coralsParagorgiaCoralliumPleurocoralliumOctocoral phylogeny

45/$ - see front matter & 2013 Elsevier Ltd. Ax.doi.org/10.1016/j.dsr2.2013.06.001

esponding author.ail address: dfigueroa@fsu.edu (D.F. Figueroa).

a b s t r a c t

In the past decade, molecular phylogenetic analyses of octocorals have shown that the currentmorphological taxonomic classification of these organisms needs to be revised. The latest phylogeneticanalyses show that most octocorals can be divided into three main clades. One of these clades containsthe families Coralliidae and Paragorgiidae. These families share several taxonomically importantcharacters and it has been suggested that they may not be monophyletic; with the possibility of theCoralliidae being a derived branch of the Paragorgiidae. Uncertainty exists not only in the relationship ofthese two families, but also in the classification of the two genera that make up the Coralliidae, Coralliumand Paracorallium. Molecular analyses suggest that the genus Corallium is paraphyletic, and it can bedivided into two main clades, with the Paracorallium as members of one of these clades. In this study wesequenced the whole mitochondrial genome of five species of Paragorgia and of five species of Coralliumto use in a phylogenetic analysis to achieve two main objectives; the first to elucidate the phylogeneticrelationship between the Paragorgiidae and Coralliidae and the second to determine whether the generaCorallium and Paracorallium are monophyletic. Our results show that other members of the Coralliidaeshare the two novel mitochondrial gene arrangements found in a previous study in Corallium konojoi andParacorallium japonicum; and that the Corallium konojoi arrangement is also found in the Paragorgiidae.Our phylogenetic reconstruction based on all the protein coding genes and ribosomal RNAs of themitochondrial genome suggest that the Coralliidae are not a derived branch of the Paragorgiidae, butrather a monophyletic sister branch to the Paragorgiidae.

While our manuscript was in review a study was published using morphological data and severalfragments from mitochondrial genes to redefine the taxonomy of the Coralliidae. Paracorallium wassubsumed into Corallium and the genus Hemicorallium was resurrected. This left two disjunct clades asCorallium, making that genus paraphyletic. One of the clades includes the type specimens of Corallium,indicating that clade should remain Corallium. For the other clade, we support the resurrection of thegenus Pleurocorallium to fix the paraphyly of Corallium. Based on congruent phylogenies in both studies,the genus Pleurocorallium includes the species C. secundum, C. kishinouyei, C. konojoi, C. elatius, andC. niveum.

& 2013 Elsevier Ltd. All rights reserved.

1. Introduction

Corals are among the dominant megafaunal taxa in areas of hardsubstrate in the deep sea, and have been noted in particularabundance on seamounts (e.g. Genin et al., 1986; Stocks, 2004),and in canyons (e.g. Hecker, 1990). Like their shallow-water counter-parts, deep-sea corals act as ecosystem engineers (sensu Jones et al.,1994) with octocorals often forming dense thickets referred to as“beds” or “gardens”. These corals provide essential habitat for avariety of invertebrates and fishes (Messing et al., 1990; Geninet al., 1992; Jones et al., 1994; Rogers, 1994; Probert et al., 1997;Stocks, 2004; DeVogelaere et al., 2005; Leverette and Metaxas, 2005;

ll rights reserved.

Baco, 2007; Mortensen and Buhl-Mortensen, 2005; Buhl-Mortensenet al., 2010; Roberts et al., 2010; Baillon et al., 2012).

Despite their ecological importance, corals are heavily impactedby fisheries activities (e.g. Koslow et al., 2001; Clark and Rowden,2009), potentially by deep-sea mining for cobalt-rich manganesecrusts (e.g. Hein, 2002; Hein et al., 2009) and likely by climatechange and ocean acidification (e.g. Guinotte et al., 2006). Corals areslow-growing, long-lived, and existing evidence suggests many arerecruitment-limited (Grigg, 1988; Krieger, 2001; Roark et al., 2006,2009; Sun et al., 2010). Thus they are very vulnerable to anthro-pogenic impacts and slow to recover from them (e.g. Williams et al.,2010).

Because of their fragility and the exploitation threats, internationalefforts have begun to focus on the conservation of deep-sea coralsand seamount fauna (Watling and Norse, 1998; Morgan et al.,2006; Lumsden et al., 2007). Recent reviews of seamount fauna and

D.F. Figueroa, A.R. Baco / Deep-Sea Research II 99 (2014) 83–9184

deep-sea corals have concluded that the global deficiency of scientificexpertise in morphological taxonomy is a significant impediment tothe understanding of deep-sea coral diversity, coral biogeography,and seamount ecology (e.g. Morgan et al., 2006; Parrish and Baco,2007; Rogers et al., 2007).

Molecular phylogenetic analyses of octocorals have shown thatthe current morphological taxonomic classification of these organ-isms needs to be revised (Berntson et al., 2001, Sanchez et al., 2003;McFadden et al., 2006, 2010). McFadden et al. (2006) presents themost comprehensive molecular phylogenetic analysis of octocorals todate. They demonstrate based on two mitochondrial protein codinggenes (nad2 andmutS) that most octocorals can be divided into threeclades. One of these clades contains the scleraxonian Corallium andthe alcyoniina Anthomastus, along with several other genera mostlybelonging to the family Alcyoniidae (McFadden et al., 2006). Thescleraxonian Paragorgia likely belongs to this clade too as suggestedby the phylogenetic analysis of Berntson et al. (2001) based on thenuclear 18S gene. A close relationship between the Coralliidae andParagorgiidae has been further demonstrated by the phylogeneticanalysis of Herrera et al. (2010) and by that of Brockman andMcFadden (2012), both based on several mitochondrial and nuclearmarkers. These two families share several taxonomically importantcharacters and it has been suggested that they may not be mono-phyletic; with the possibility of the Coralliidae being a derived branchof the Paragorgiidae (Sanchez, 2005). Additionally, the study byBrockman and McFadden (2012) places the Paragorgia and Coralliumin one clade with Paracorallium as a sister branch, adding uncertaintyto the current taxonomic position of the Paragorgiidae and Corallii-dae and questioning the validity of the genera Paracorallium andCorallium within the Coralliidae.

This uncertainty in the classification of the two genera that makeup the Coralliidae has been demonstrated in previous molecularanalyses which show that the genus Corallium is paraphyletic, (thatis, a group which is missing a subset of the descendants of a commonancestor) and it can be divided into two main clades, one of theseclades having a mix of species of Corallium with Paracorallium(Herrera et al., 2010). To help resolve the classification of themembers of the Coralliidae, Uda et al. (2011) sequenced the entiremitochondrial genome of Corallium konojoi and Paracoralliumjaponicum. Their study shows that C. konojoi and Paracoralliumjaponicum each have a unique mitochondrial gene arrangement,different from each other and from the two previously knownarrangements in octocorals. Based on these two different mitochon-drial gene arrangements and on their phylogenetic analysis of allmitochondrial protein-coding regions, Uda et al. (2011) conclude thatthe morphological classification that separates these two genera is

Table 1Specimens of Octocorallia used for this study. Each of the five specimens of Paragorgmorphology and/or color.

Species Smithsonian USNM # Collection date L

Corallium imperialea 1072449 Oct 2003 SCorallium imperialea 1072448 Oct 2003 SCorallium laauensea Oct 2003 PParacorallium japonicuma

Corallium kishinouyeia 1072441 Oct 2003 SCorallium secunduma Oct 2003 PCorallium konojoia

Paragorgia sp. 1075769 Aug 2004 GParagorgia sp. 1072339 Oct 2003 PParagorgia sp. 1075761 Aug 2004 PParagorgia sp. 1072362 Oct 2003 SParagorgia sp. 1075741 Aug 2004 DKeratoisinidae sp.Acanella eburnea

a Ardila et al. (2012) subsumed Paracorallium into Corallium (changing the genus for PC. imperiale). Adittionally we propose the resurrection of Pleurocorallium (changing the

valid. But it must be emphasized that they only sequenced themitochondrial genome of one species each of Corallium andParacorallium. In addition to their whole mitochondrial genomeanalysis, they performed a phylogenetic analysis based on twomitochondrial genes (mutS and nad2) that included more species ofCorallium. This analysis showed the same results as Herrera et al.(2010) with two Corallium clades and the Paracorallium appearing asa member of one of these. Therefore the status of Corallium andParacorallium as monophyletic (that is, containing all of the descen-dants of a common ancestor) genera remains in question.

In this study we sequenced the whole mitochondrial genome offive species of Paragorgia and of five species of Corallium to use in aphylogenetic analysis to achieve two main objectives; the first toelucidate the phylogenetic relationship between the Paragorgiidaeand Coralliidae and the second to determine whether the generaCorallium and Paracorallium are monophyletic. Our two hypoth-eses are: (1) that the family Coralliidae is not just a derived branchof the Paragorgiidae, these two families are separate, monophy-letic clades and (2) that the genus Corallium is paraphyletic,including Paracorallium within one of its clades.

2. Data and methods

2.1. Collections

Five species of the genus Corallium and five unique and distinctmorphotypes of the genus Paragorgia (Table 1) were used for thisstudy. Samples were collected from the seafloor using the submer-sibles Pisces V or Alvin from seamounts in the NorthwesternHawaiian Islands or Gulf of Alaska, respectively. Corals were placedin insulated bioboxes for return to the surface and subsamples werefrozen at −80 1C. The remainder of each specimen was deposited atthe Smithsonian.

2.2. DNA extraction, PCR, sequencing and assembly

Total genomic DNA was extracted from each specimen usingQiagen's DNeasy Blood and Tissue Kit. Two methods were used tosequence the entire mitochondrial genome of each specimen: Nextgeneration sequencing technology was used for two of the speci-mens, Corallium secundum and Corallium laauense; while multipleoverlapping PCRs were used for the remaining eight specimens.

The mitochondrial genome of Corallium secundum and Coralliumlaauense were obtained as a byproduct of a separate project thatis using next generation sequencing technology to obtain partial

ia represent a unique morphotype that was easily distinguished based on colony

ocation Genbank Acession # Sequence from

mt E of Necker Island, NWHI KC782355 Present Studymt E of Necker Island, NWHI KC782352 Present Studyioneer Bank, NWHI KC782348 Present Study

AB595189 GenBankmt Se of Laysan Island, NWHI KC782353 Present Studyioneer Bank, NWHI KC782347 Present Study

NC015406 GenBankiacomini Smt, GOA KC782349 Present Studyioneer Bank, NWHI KC782354 Present Studyratt Smt, GOA KC782350 Present Studymt E of Necker Island, NWHI KC782351 Present Studyickins Smt, GOA KC782356 Present Study

EF622534 GenBankEF672731 GenBank

. japonicum) and resurrected Hemicorallium (changing the genus for C. laauense andgenus for C. secundum, C. kishinouyei, and C. konojoi).

D.F. Figueroa, A.R. Baco / Deep-Sea Research II 99 (2014) 83–91 85

octocoral nuclear genomes. The DNA extracted from these twospecimens was used to prepare genomic libraries following theprocedure described by Meyer and Kircher (2010), with the aid ofBeckamn Coulter's SPRIworks Library Preparation System I forIllumina Genome Analyzer. The libraries were then indexed andlibrary quality and concentration was assessed using a Life Tech-nologies Qubit fluorometer and an Agilent 2100 Bioanalyzer. Thesetwo libraries were sequenced, along with three other octocorallibraries, in a paired-end multiplexed lane of the Illumina GenomeAnalyzer using 3rd generation reagents by HudsonAlpha Institutefor Biotechnology. The reads obtained were screened for quality andde-multiplexed bioinformatically. Assemblies were done de novousing the software CLC Genomics Workbench. Default settingswere used with reads mapped back to contigs (mismatch cost¼2,insertion cost¼3, deletion cost¼3, length fraction ¼0.5, similarityfraction¼0.8). The contigs obtained from the assemblies includedthe full mitochondrial genome for each specimen.

The mitochondrial genomes of the remaining 8 specimens wereobtained using a series of overlapping PCRs using the primers setsfrom Park et al. (2010) and custom primers (Table 2). The followingthermocycling conditions were used: 96 1C for 2 min, 35 cycles at94 1C for 1 min, 48 1C for 1 min, 72 1C for 1 min, and a final step at72 1C for 5 min. The PCR fragments were sent for sequencing at the

Table 2Primers used for this study. Unless otherwise noted, sequence numbers are based on m

Forward Primer Reverse Prime

1F ATGAACAAATATCTTACACG 1R ATAAR2F ACAACATTTTTTGATCCT 2R GCTAA3F ACAGGTTATAGTTATAATGA 3R GTCTG4F CTGGTCGAAGATGCGTAGTA 4R TGTGC5F TATGCGCTACATTCTCCTAT 5R CACACssRNA-F1 CTGCGTTTAATACGTACTTGGC 6R YACTG7F ATTCTAGGAATGGGCTGC 7R GACAT8F ATATTTTAAGAGACGTTAAT 8R CTCTA9Fb ATCCTTTAGTAACTCCTG msh2806R TAACT9Fb ATCCTTTAGTAACTCCTG msh3101R GATAT10F YTRCTTCAAATGGGGTTTCC mutS-3458R TSGAG10F YTRCTTCAAATGGGGTTTCC mutS-6088Rab TGTGA10F YTRCTTCAAATGGGGTTTCC 10R AGAATmutS-F5 ATTTAATTAAGAATCTCCAACTTCC mutS-6979ab TATTAmutS-6818Fab CTAAGCTATTTTTWCCCC mutS-R2 TCTAA13R CTGTTTCCAAGCCTACTT 13F CTATT14R TTTCCTCTTGAGACAGTA 14F ACTGGocto2-H CGATAAGAACTCTCCGACAATA 15F CAACTocto1-L AGACCCTATCGAGCTTTACTGG nd2-R1 GTTCAnd2-1418R ACATCGGGAGCCCACATA 16S-647F ACACA16R GCACGATAGATAATAGCGCA 16F TGGTG17R ATATTTGTTATTACTAAAGG 17F ATTRT18R TCCCAACCRATAAATARTTG 18F GTTTT19R GCATGAATRATTGAGCCTGC 19F ATTCT20R TATCATTAATGCATAATTAA 20F AGTTT21R AACATTAAACTGAGCCGACT 21F TGTCT22R TTTTATTATTAGTTAACCTTCATC nad4-F3 TTTTAT22R GTACTAGTWGAAAAAGCAGC nd4-13343Fab AATAGco3bam567F GCTGCTAGTTGGTATTGGCAT 23F ATGGT23R GCTGCTAGTTGGTATTGGCA 23F ATGGT24R TATCACCCTTATCATYTAGT 24F CTAAG25R TCWACAGCTAAYAAGGGAAC 25F TGAAAsiro-cox2-F1 AGGCCCACTCTGTATATTTC atp6-R2 ATGTA26R CATTAGSTATTAAAATGGAT 26F GTAAAcox2-16530Fab CCCCTAAAGATCACCACA nd42599F GCCAT27F GAGTGATTAGCGCCACATAA 27R GGAGCREVNRnd6b ATCGTTAGCGGGACATTATCAATT coII-8068F CCATAnd6-F TCCTTAGGAATAGTTGGAGCTAG nd3-2126R CACATsiro-nad6-R1 ATTGCCCCTATGTTAGTTCTAG 28R CCAATnd6-F REV CTAGCTCCAACTATTCCTAAGGA New NCR2R ATGAT9Fc ATCCTTTAGTAACTCCTG COII-8068F CCATAmsh2806Rc TAACTCAGCTTGAGAGTATGC RevNrND6 ATCGT

a Novel primers developed for this project, all others are from previous research (Bb Primer pairs used for mt genomes with konojoi arrangement only.c Primer pairs used for mt genomes with japonicum arrangement only.

University of Washington High Throughput Genomics Center for boththe forward and reverse strands.

The overlapping PCR fragments were assembled using the soft-ware CLC Main Workbench. Sequence quality was assessed by basequality scores and by visually inspecting each chromatogram. Anno-tation of each mitochondrial genome was done by alignment to alloctocoral genomes available in GenBank (Table 1) with the aid of thesoftware CLC Main Workbench. The mt genomes were scanned fortRNAs using the program tRNA scan-SE by Lowe and Eddy (1997).

2.3. Phylogenetic analysis

Phylogenetic analyses were based on the nucleotide sequences ofthe two ribosomal RNAs and the fourteen protein coding genespresent in all octocoral mitochondrial genomes. In addition to the tenspecimens used in this study, four mitochondrial genomes wereobtained from Genbank and included in the phylogenetic analysis:Corallium konojoi, Paracorallium japonicum, Acanella eburnea, andKeratoisinidae sp. (Table 1). Acanella eburnea and Keratoisinidae sp.were used as outgroups as they are the nearest relatives to theCoralliidae and Paragorgiidae that had a mitochondrial genomeavailable at the time of this analysis. The sequences for each geneand ribosomal RNA were sequentially concatenated and aligned with

t genomes with konojoi gene arrangement, starting with cox1.

r Start End Size bp Overlap

TGCTGRAATAAAAT 1 699 698 162ACCCAAGAAATG 667 1290 623 32CTGGCACTTAGTTAG 1223 1860 637 67TAACACTGGGTTAGA 1743 2500 757 117TTCATAGCTAATCAT 2405 3128 723 95CATCTAAACCTATCA 2680 3591 911 448TTGTCCCCAAGGTAA 3509 4126 617 82CTGGATTAGCCCCTA 3964 4726 762 162CAGCTTGAGAGTATGC 4501 5088 587 225CACATAAGATAATTCCG 4527 5354 827 561CAAAAGCCACTCC 5268 5731 463 86TAGGGTTGAGAAG 5268 5900 632 463TGTAACACTCGGG 5268 5939 671 632ATGGGTGTCGGAG 5932 6937 1005 7AGACTCATTAAGATAAACCC 6918 7875 957 19TTAGGYTGGAAGAGA 7861 8623 762 14TGTAGTAAGACTA 8516 9219 703 107GAATGGCCGCGGTAA 9134 9601 467 85AGCTCTCCTGTGGAGCC 9343 10394 1051 258GCTCGGTTTCTATCTACAA 9772 10552 780 622ACACAGCTCGGTT 9791 10590 799 761TATTTAAAGTATCTG 10527 11153 626 63TAACTAARTGGTATR 11043 11709 666 110ACAAGTTATATGAGA 11605 12323 718 104ATATCAYYTACTAAC 12299 13051 752 24CTTATCGTACTATAG 13005 13653 648 46TATTAGTTAACCTTCATC 13514 14179 665 139GTTGGTTTGAGGG 13514 14300 786 665RTTTACTTTAGCTAA 14264 14787 523 36RTTTACTTTAGCTAA 14274 14835 561 513ARCCCCACCARTAAA 14772 15508 736 63ATATARTACTGAGCC 15468 16063 595 40GATTTAGAGTATCATTAATRTA 15588 16291 703 475TACRTAGGGAAATAG 15524 16597 1073 767TATGGTTAACTATTAC 16582 17397 815 15CTATATCCTTGRGAT 16681 17468 787 716ACAGGACTAGCAGCATC 17207 17995 788 261TCATAGACCGACACTT 17935 18600 665 60CATTACTGGCATTAC 18304 233 982 296CATCTCCTAACATACTACC 18774 162 585 162ACAGGACTAGCAGCATC 4531 5123 593 –

TAGCGGGACATTATCAATT 17209 18037 829 –

rugler and France, 2008; Park et al., 2010, 2011; Uda et al., 2011).

D.F. Figueroa, A.R. Baco / Deep-Sea Research II 99 (2014) 83–9186

MUSCLE (Edgar, 2004). The alignment was visually inspected foroptimality. Intergenic spacers where not used in the alignmentbecause mitochondrial gene order is not conserved among alllineages of Octocorals; therefore homologous intergenic spacerscannot be identified with certainty. Phylogenetic analyses wereperformed with MEGA v5.05 (Tamura et al., 2011) using neighbor-joining (NJ) and maximum likelihood (ML) methods with bootstrapvalues from 10,000 replicates. A general time reversible model withgamma distribution (GTR+G) was selected by MEGA v5.05 as the bestfitting model of molecular evolution based on the Akaike InformationCriterion (AIC). Though different genes may have different evolu-tionary rates, it has been shown that the bias introduced by assuminga single evolutionary model over a concatenated multigene align-ment is insignificant relative to the increased phylogenetic signalgained from the concatenation (Gadagkar et al., 2005). A bayesiananalysis was also performed with MrBayes 3.1 (Huelsenbeck andRonquist, 2001) using a GTR+G model of evolution. The analysis was

Fig. 1. Mitochondrial gene arrangement based on Brugler and France (2008), Park et al. (line shows heavy strand, thinner line shows light strand. (A) Ancestral mt gene arrangethat have been shown to have these arrangements are listed within each arrangement. aAjaponicum) and resurrected Hemicorallium (changing the genus for C. laauense and C. imgenus for C. secundum, C. kishinouyei, and C. konojoi).

carried out for 5,000,000 generations, sampling every 500th genera-tion. The initial 25% (2500) of sampled generations were omittedfrom the analysis.

3. Results

A total of ten new octocoral mitochondrial genomes wereobtained. The mitochondrial genomes vary in length from18,757 bp (Paragorgia sp. USNM# 1072362) to 19,060 bp (Para-gorgia sp. USNM# 1072339) and contain 14 protein coding genes(atp6, atp8, cox 1–3, cob, nad 1–6, nad4L, and mutS), 2 ribosomalRNAs (rns and rnl) and 1 transfer RNA (trnM). Two gene arrange-ments were observed: All the species of Paragorgia, Coralliumkishinouyei, and Corallium secundum have the same arrangementas that discovered by Uda et al. (2011) in Corallium konojoi,(Fig. 1) further referred to as the “konojoi” arrangement; while both

2011), Uda et al. (2011) and this study. Arrows show direction of replication. Thickerment; (B) japonicum mt gene arrangement; (C) konojoi mt gene arrangement. Taxardila et al. (2012) subsumed Paracorallium into Corallium (changing the genus for P.periale). Adittionally we propose the resurrection of Pleurocorallium (changing the

D.F. Figueroa, A.R. Baco / Deep-Sea Research II 99 (2014) 83–91 87

specimens of Corallium imperiale and Corallium laauense have thesame arrangement as that in Paracorallium japonicum (Uda et al.,2011), further referred to as the “japonicum” arrangement (Fig. 1).The nucleotide lengths of all genes are similar for all ten species,with the exception of cytochrome oxidase B, where the species withthe C. konojoi mt genome arrangement have a shorter cytochromeoxidase B gene (1161 bp) than the species with the japonicumarrangement (1193 bp). In all ten mitochondrial genomes, the A+Tcontent is similar (61.2% to 61.8%) and only five genes overlap, withthe rest separated by 12 intergenic spacers, ranging in size from20 bp to 382 bp (Table 3). Two pairs of inverted repeat sequencesare present in all the Corallium and Paragorgia mitochondrialgenomes, except for Paragorgia sp. USNM# 1072362 where amember of one of the pairs is missing (Fig. 2). In the mitochondrialgenomes with japonicum gene arrangement (C. laauense and C.imperiale) these inverted repeat sequences are found in the inter-genic regions of cob and cox2 genes and of cox1 and nad6 genes;while for those genomes with konojoi gene arrangement, they arefound in the intergenic regions of cob and mutS genes and cox1 andnad6 genes.

Overall sequence divergence of the coding regions were fairlylow within the Paragorgia species sampled, ranging from 1.0% to3.0% (Table 3). Species within the 2 coralliid clades also had fairlylow levels of overall sequence divergence, within konojoi mtarrangement (range¼1.6%–2.4%) and among species within thejaponicum mt arrangement (range¼0.3%—2.2%). These findingsare consistent with observations of low mitochondrial divergenceat the interspecific level within octocorals (e.g. France and Hoover,2001; McFadden et al., 2011; Baco and Cairns, 2012).

The phylogenetic analyses using all 14 protein coding sequencesand the 2 ribosomal RNAs show the same tree topology for bothmaximum likelihood and Bayesian methods, with the sole exceptionof Corallium imperiale USNM# 1072449 branching with Coralliumimperiale USNM# 1072448 in the maximum likelihood analysis butbranching with Corallium laauense in the Bayesian analysis (Fig. 3).All other nodes are identical and both methods resulted in wellsupported branches. There are two main clades, one contains all theParagorgia and the other all the Corallium and P. japonicum. TheCorallium-P. japonicum clade is further divided into two branches,the first contains all the species that have the konojoi mitochondrialgene arrangement (C. kishinouyei, C. konojoi, C. secundum) and thesecond has all the species with the japonicum gene arrangement(P. japonicum, C. laauense, and C. imperiale).

4. Discussion

The mitochondrial genomes of the five species of Paragorgiaand of the five species of Corallium have the same compositionalelements as the mitochondrial genomes of all sixteen species ofoctocorals that have been published to date. Five different genearrangements have been identified in the Octocorallia (Beatonet al., 1998; Brugler and France, 2008; Park et al., 2011; Uda et al.,2011; Brockman and McFadden, 2012). Uda et al. (2011) discoveredtwo of these arrangements within the family Coralliidae, one inCorallium konojoi and the other in Paracorallium japonicum. Ourstudy shows that these two mitochondrial gene arrangements areshared by other members of the Coralliidae and that the konojoiarrangement is also found in the Paragorgiidae.

Molecular and ultrastructural data suggests that the closestrelative of the Paragorgiidae are the Coralliidae (Sanchez et al.,2003; Herrera et al., 2010). Our phylogenetic reconstruction showsthat these two families are closely related. And the fact that theyshare a unique gene arrangement, so far not found in otherOctocorals, strengthens this argument. The latest taxonomic revisionof the Paragorgiidae was done by Sanchez (2005). In his study,

Sanchez points out that several taxonomically important charactersthat have been used to distinguish these two families are actuallyshared by some members of both families. The Coralliidae andParagorgiidae have the same sclerite types and microcrystals formingthe sclerites, they have similar branching patterns, and both exhibitvarious degrees of sclerite fusion (Sanchez, 2005). Sanchez (2005)concludes that further studies identifying independent characters areneeded to determine whether the Coralliidae is just a derived branchof the Paragorgiidae. Our phylogenetic reconstruction clearly showsthat the Coralliidae are not a derived branch of the Paragorgiidae, butrather a monophyletic sister branch. Therefore new morphologicalcharacters that are specific to each family need to be identified foraccurate taxonomic resolution.

The fact that the mitochondrial genome of Paragorgia shares thesame, konojoi, gene arrangement as one of the Coralliidae cladeshas important phylogenetic and evolutionary implications. Udaet al. (2011) suggest two possible mechanisms by which thejaponicum and konojoi gene arrangements came to be. Theydiscovered two pairs of inverted repeat sequences present in theintergenic regions where gene inversions likely occurred leading tothe two novel arrangements of Paracorallium japonicum andCorallium konojoi. These same inverted repeat sequences arepresent in the Paragorgia and Coralliidae mitochondrial genomesobtained in this study. The two mechanisms proposed by Uda et al.(2011) are largely based on these two pairs of inverted repeatsequences. Both mechanisms call for inversions resulting in theseinverted repeat sequences that carry part of the gene to which theywere previously adjacent to. Their favored mechanism involvestandem duplication by slipped-strand mispairing followed by arandom loss of genes and inversion by intra-mitochondrial recom-bination. This mechanism leads to the japonicum gene arrangementfirst and the konojoi arrangement second.

If this is indeed the case, based on our phylogenetic reconstruc-tion, it would mean that the last common ancestor of theCoralliidae and Paragorgiidae had the japonicum gene arrange-ment, this arrangement was kept in the branch leading to Para-corallium japonicum, and the Corallium species with the japonicumarrangement. But, it would also mean that the konojoi arrange-ment had to evolve twice, once in the Paragorgia and once in theCorallium. Since we found in Paragorgia the same four pairs ofinverted repeat sequences identified by Uda et al. (2011) in theCoralliidae, it suggests that they were the product of the sameevolutionary event instead of two independent ones. Therefore thelast common ancestor of the Coralliidae and Paragorgiidae likelyhad the konojoi mitochondrial gene arrangement, which wasconserved in the Paragorgia and one of the Corallium brancheswhile the other Corallium branch developed the japonicumarrangement. Having the konojoi arrangement as ancestral to thejaponicum arrangement lends support to the second, least favoredmechanism, proposed by Uda et al. (2011). This mechanisminvolves a breakage of the nad6–nad3–nad4L segment followedby an inversion and rejoining of this segment to generate thekonojoi gene arrangement followed by a simple inversion thatleads to the japonicum arrangement. Though our results supportthis evolutionary scenario, we must be cautious since we do notknow what gene arrangement is present in the other families thatare closely related to the Coralliidae and Paragorgiidae.

McFadden et al. (2006) present the most comprehensivephylogenetic revision of the Octocorallia and they show that theCoralliidae and Paragorgiidae belong to a small clade comprised ofdeep-water Scleraxonia and several taxa of Alcyoniina. A recentstudy by Brockman and McFadden (2012) discovered the fifthnovel gene arrangement in the Octocoral, Paraminabea aldersladei,a member of this same small Scleraxonia-Alcyoniina clade identi-fied in Mcfadden et al. (2006). Brockman and McFadden (2012)suggest that the gene rearrangements in the Octocorallia can be

Table 3Percent sequence divergence for all the mitochondrial protein coding genes and RNAs used in our phylogenetic analysis.

Keratoisinidaesp.

Acanellaeburnean

Paragorgiasp. USNM#1075769

Paragorgiasp. USNM#1072339

Paragorgiasp. USNM#1075761

Paragorgiasp. USNM#1072362

Paragorgiasp. USNM#1075741

Coralliumkishinouyeia

Coralliumsecunduma

Coralliumkonojoia

Paracoralliumjaponicuma

Coralliumlaauensea

Corallium imperialeUSNM# 1072449a

Corallium imperialeUSNM#1072448a

Keratoisinidae sp.Acanella eburnea 2.6Paragorgia sp.

USNM# 10757699.2 9.2

Paragorgia sp.USNM# 1072339

9.2 9.2 1.0

Paragorgia sp.USNM# 1075761

10.0 10.0 2.0 2.7

Paragorgia sp.USNM# 1072362

10.1 10.1 1.9 2.7 2.3

Paragorgia sp.USNM# 1075741

10.3 10.3 2.2 3.0 2.6 1.2

Coralliumkishinouyeia

9.5 9.4 4.0 4.7 4.9 4.9 5.1

Coralliumsecunduma

9.3 9.2 3.7 4.3 4.6 4.6 4.8 1.7

Corallium konojoia 9.8 9.7 4.3 5.0 5.2 5.2 5.4 2.5 1.6Paracorallium

japonicuma9.2 9.2 3.4 4.2 4.4 4.3 4.2 3.2 2.8 3.6

Corallium laauensea 10.3 10.3 4.5 5.3 5.5 5.4 5.3 4.1 3.6 4.5 2.2Corallium imperial

USNM# 1072449a10.2 10.2 4.4 5.2 5.3 5.3 5.2 4.1 3.8 4.5 1.9 0.6

Corallium imperialUSNM#1072448a

10.2 10.2 4.5 5.2 5.3 5.3 5.2 4.1 3.8 4.5 2.0 0.8 0.3

a Ardila et al. (2012) subsumed Paracorallium into Corallium (changing the genus for P. japonicum) and resurrected Hemicorallium (changing the genus for C. laauense and C. imperiale). Adittionally we propose the resurrection ofPleurocorallium (changing the genus for C. secundum, C. kishinouyei, and C. konojoi).

D.F.Figueroa,A

.R.Baco

/Deep-Sea

Research

II99

(2014)83

–9188

Fig. 2. Alignment of inverted repeat sequences present in all the Corallium and Paragorgia mitochondrial genomes. These were first identified by Uda et al. (2011) and theyoccur in the intergenic spacers where gene inversions took place leading to the japonicum and konojoi mt gene arrangement. aArdila et al. (2012) subsumed Paracoralliuminto Corallium (changing the genus for P. japonicum) and resurrected Hemicorallium (changing the genus for C. laauense and C. imperiale). Adittionally we propose theresurrection of Pleurocorallium (changing the genus for C. secundum, C. kishinouyei, and C. konojoi).

D.F. Figueroa, A.R. Baco / Deep-Sea Research II 99 (2014) 83–91 89

explained by a process of intramolecular recombination requiringdouble-stranded breakage and subsequent repair of the DNAmolecule. But their proposed sequence of events does not agreewith our observation and it shows the japonicum gene arrange-ment evolving first, prior to the konojoi gene arrangement. Theirsuggestion on the sequence of evolution of these two genearrangements is largely based on their phylogenetic reconstruc-tion using two mitochondrial genes (cox1 and mutS) and a nucleargene (28S), which shows Paracorallium japonicum as a sisterbranch to Corallium konojoi and a species of Paragorgia. Ourphylogeny does not agree with this, based on complete mitochon-drial genomes of several species of both Paragorgia and Corallidae,it is clear that Paragorgia is ancestral to the Corallidae. To fullyresolve the evolutionary events leading to the japonicum andkonojoi arrangement, the mitochondrial genomes of other mem-bers of this Scleraxonia-Alcyoniina clade need to be sequenced.

4.1. Authors' note

While our manuscript was in review, Ardila et al. (2012) publisheda taxonomic revision of the family Corallidae. Their phylogeneticreconstruction based on fragments of six mitochondrial genes, wascongruent with ours, and showed that the Coralliidae can be dividedinto two main clades, referred to as Clade I and Clade II, with Clade Ifurther divided into two groups. Clade I in Ardila et al. (2012)corresponds with our branch containing species of Coralliidae witha japonicummitochondrial gene order. In Ardila et al. (2012) this cladeis further divided into Clade IA and Clade IB, Clade IB corresponds toour branch containing C. laauense and both specimens of C. imperialeand Clade IA corresponds with our branch leading to Paracoralliumjaponicum. Ardila et al. (2012) conclude that the genus Hemicorallium,as defined by Gray (1867) should be resurrected and include all thespecies in Clade IB including C. laauense and C. imperiale, (as well as

Fig. 3. Phylogenetic tree inferred by maximum likelihood, based on all mitochondrial protein coding genes and RNAs. The tree is drawn to scale, with branch lengthsmeasured in the number of substitutions per site. Tree topology inferred by Bayesian methods is identical except for Corallium imperiale USNM# 1072449 branching withCorallium imperiale USNM# 1072448 in the Bayesian topology and with Corallium laauense in the ML topology. Branch values correspond to bootstrap support for maximumlikelihood (first) and Bayesian posterior probabilities (second). Labels and coloring show proposed evolutionary sequence of the observed mt genome rearrangements.aHemicorallium has been resurrected to represent this clade by Ardila et al. (2012). bParacorallium has been subsumed into Corallium by Ardila et al. (2012). cWe propose theresurrection of Pleurocorallium for this clade.

D.F. Figueroa, A.R. Baco / Deep-Sea Research II 99 (2014) 83–9190

C. johnsoni, C. abyssale, C. niobe, C. sulcatum, C. ducale, C. halmaheirense,C. tricolor and C. maderense). Our results agree with this observation.Furthermore they show that species of Paracorallium are polyphyleticand nested within Corallium and therefore Paracorallium is synony-mized with Corallium. So all species found in Clade IA, which includesParacorallium japonicum, Paracorallium tortuosum, C. medea and thetype species for Corallium, C. rubrum, are all now species of Corallium.Though we only have the full mitochondrial genome for one memberof this group, Paracorallium japonicum, our results do not disagreewith this conclusion. In order to provide more support for this clade itwould be of extreme value to sequence the full mitochondrialgenome of the type species C. rubrum.

Clade II in Ardila et al. (2012), corresponds with our cladecontaining all Corallium species with a konojoi gene arrangement(C. kishinouyei, C. secundum and C. konojoi). According to Ardila et al.(2012) this clade also contains C. elatius, C. niveum and an unidenti-fied species of Paracorallium. This clade was not renamed by Ardilaet al. (2012) and because Paracorallium was synonymized withCorallium, then all species within this clade would be consideredCorallium. However, this makes the genus Corallium paraphyleticwith the type species for the genus found in Clade IA (Ardila et al.,2012). Our results, in combination with both the molecular andmorphological evidence of Ardila et al. (2012) for Clade II, providestrong evidence that there should be a third genus in the familyCoralliidae that includes all species with the konojoi mitochondrialgene arrangement. This clade includes Corallium secundum, the typespecies of the genus Pleurocorallium, established by Gray (1867).Therefore we propose that for this clade, the genus Pluerocorallium,should be resurrected for the species C. secundum, C. kishinouyei,C. konojoi, C. elatius, and C. niveum.

5. Conclusions

Our phylogenetic reconstruction based on all the protein codinggenes and ribosomal RNAs of the mitochondrial genome clearlyshow that the Coralliidae should be divided into three genera. Thisobservation agrees with the results of Ardila et al. (2012) and Herrera

et al. (2010). These three genera are Corallium, Hemicorallium andPleurocorallium. Our analysis only included six species of Coralliidae.The analysis by Ardila et al. (2012) only included fifteen namedspecies. To solidify the classification of the Coralliidae, more speciesof this family need to be sequenced. Currently, the Family Coralliidaeis comprised of 33 species (Bayer, 1964 and unpubl ms; Bayer andCairns, 2003). This number is certain to change in the future asseveral species of Coralliidae remain undescribed (Bayer unpubl ms)and nearly half of the coralliid specimens at the SmithsonianNational Museum of Natural history remain unidentified (Cairnspers comm). Though our results strongly support the division of theCoralliidae into three genera, fully resolving the membership of thesewill require a more comprehensive genetic analysis that includes allspecies of this family in addition to a detailed morphologicalevaluation that elucidates synapomorphies for the internal cladesof the Coralliidae.

Acknowledgments

The Paragorgia mt genome sequencing began while ARB was aguest in the Sogin lab at the Marine Biological Laboratory, WoodsHole and was supported by NOAA Office of Ocean Exploration Grant# NA07OAR4600292. This work was also supported by ARB's startupat Florida State University, Department of Earth, Ocean and Atmo-spheric Sciences. Specimens were collected by ARB with collections inHawaii funded by the Hawaii Undersea Research Laboratory andNOAAOffice of Ocean Exploration Award Nos. NA03OAR4600108, andNA03OAR4600110; collections on the Gulf of Alaska seamountsfunded by Award No. NA04OAR4600051. Successful collections atsea were possible through the help of many volunteers as well as thecrews of the Ka'Imikai-O-Kanaloa, the Pisces V submersible, and theAlvin submersible.

References

Ardila, N.E., Giribet, G., Sanchez, J.A., 2012. A time calibrated molecular phylogeny ofthe precious corals: reconciling discrepancies in the taxonomic classification

D.F. Figueroa, A.R. Baco / Deep-Sea Research II 99 (2014) 83–91 91

and insights into their evolutionary history. BioMed Central 12. PLoS ONE 7,246.

Baco, A.R., 2007. Exploration for deep-sea corals on North Pacific seamounts andislands. Oceanography 20, 108–117.

Baco, A.R., Cairns, S.D., 2012. Comparing molecular variation to morphologicalspecies designations in the deep-sea coral Narella reveals new insights intoseamount coral ranges. PLoS ONE 7, 45555.

Baillon, S., Hamel, J., Wareham, V.E., Mercier, A., 2012. Deep cold-water corals asnurseries for fish larvae. Front. Ecol. Environ. 10, 351–356.

Bayer, F.M., Cairns, S.D., 2003. A new genus of the scleraxonian family Coralliidae(Octocorallia: Gorgonacea). Proc. Biol. Soc. Wash. 116, 222.

Bayer, F.M., 1964. The Genus Corallium (Gorgonacea: Scleraxonia) in the WesternNorth Atlantic Ocean. Bull. Mar. Sci. 14, 465–478.

Beaton, M., Roger, A., Cavalier-Smith, T., 1998. Sequence analysis of the mitochon-drial genome of Sarcophyton glaucum: conserved gene order among octocorals.J. Mol. Evol. 47, 697–708.

Berntson, E.A., Bayer, F.M., McArthur, A.G., France, S.C., 2001. Phylogenetic relation-ships within the Octocorallia (Cnidaria: Anthozoa) based on nuclear 18S rRNAsequences. Mar. Biol. 138, 235.

Brockman, S.A., McFadden, C.S., 2012. The mitochondrial genome of Paraminabeaaldersladei (Cnidaria: Anthozoa: Octocorallia) supports intramolecular recom-bination as the primary mechanism of gene rearrangement in octocoralmitochondrial genomes. Genome Biol. Evol 4, 994–1006.

Brugler, M., France, S., 2008. The mitochondrial genome of a deep-sea bamboo coral(Cnidaria, Anthozoa, Octocorallia, Isididae): genome structure and putativeorigins of replication are not conserved among octocorals. J. Mol. Evol. 67,125–136.

Buhl-Mortensen, L., Vanreusel, A., Gooday, A.J., Levin, L.A., Priede, I.G., Buhl-Mortensen, P., Gheerardyn, H., King, N.J., Raes, M., 2010. Biological structuresas a source of habitat heterogeneity and biodiversity on the deep oceanmargins. Mar. Ecol. 31, 21–50.

Clark, M.R., Rowden, A.A., 2009. Effect of deepwater trawling on the macro-invertebrate assemblages of seamounts on the Chatham Rise, New Zealand.Deep Sea Res. Part I: Oceanogr. Res. Pap. 56, 1540–1554.

DeVogelaere, A., Burton, E., Trejo, T., King, C., Clague, D., Tamburri, M., Cailliet, G.,Kochevar, R., Douros, W., 2005. Deep-sea Corals and Resource Protection at theDavidson Seamount, California, U.S.A. In: Freiwald, A., Roberts, J.M. (Eds.),Springer, Berlin Heidelberg, p. 1189.

Edgar, R.C., 2004. MUSCLE: multiple sequence alignment with high accuracy andhigh throughput. Nucleic Acids Res. 32, 1792–1797.

France, S.C., Hoover, L.L., 2001. Analysis of variation in mitochondrial DNAsequences (ND3, ND4L, MSH) among Octocorallia (¼Alcyonaria) (Cnidaria:Anthozoa). Bull. Biol. Soc. Wash., 110–118.

Gadagkar, S.R., Rosenberg, M.S., Kumar, S., 2005. Inferring species phylogenies frommultiple genes: concatenated sequence tree versus consensus gene tree. J. Exp.Zool. 304B, 64–74.

Genin, A., Paull, C.K., Dilon, W.P., 1992. Anomalous abundances of deep-sea faunaon a rocky bottom exposed to strong currents. Deep-Sea Res. 39, 293–302.

Genin, A., Dayton, P.K., Lonsdale, P.F., Spiess, F.N., 1986. Corals on seamount peaksprovide evidence of current acceleration over deep-sea topography. Nature322, 59–61.

Gray, J.E., 1867. Notes on the arrangement of sponges, with the description of somenew genera. Proc. Zool. Soc. London, 492–558.

Grigg, R.W., 1988. Recruitment limitation of a deep benthic hard-bottom octocoralpopulation in the Hawaiian Islands. Mar. Ecol. Prog. Ser. 45, 121–126.

Guinotte, J.M., Orr, J., Cairns, S., Freiwald, A., Morgan, L., George, R., 2006. Willhuman-induced changes in seawater chemistry alter the distribution of deep-sea scleractinian corals? Front. Ecol. Environ. 4, 141–146.

Hecker, B., 1990. Variation in megafaunal assemblages on the continental marginsouth of New England. Deep Sea Res. Part A: Oceanogr. Res. Pap. 37, 37–57.

Hein, J.R., 2002. Cobalt-rich ferromanganese crusts: global distribution, composi-tion, origin and research activities. ISA Tech. Study 2, 36–89.

Hein, J.R., Conrad, T.A., Dunham, R.E., 2009. Seamount characteristics and mine-sitemodel applied to exploration- and mining-lease-block selection for cobalt-richferromanganese crusts. Mar. Georesour. Geotechnol. 27, 160–176.

Herrera, S., Baco, A., Sánchez, J.A., 2010. Molecular systematics of the bubblegumcoral genera (Paragorgiidae, Octocorallia) and description of a new deep-seaspecies. Mol. Phylogenet. Evol. 55, 123–135.

Huelsenbeck, J.P., Ronquist, F., 2001. MRBAYES: Bayesian inference of phylogeny.Bioinformatics 17, 754–755.

Jones, C.G., Lawton, J.H., Shachak, M., 1994. Organisms as ecosystem engineers.Oikos 69, 373–386.

Koslow, J.A., Gowlett-Holmes, V., Lowry, J.K., O'Hara, T., Poore, G.C.B., Williams, A.,2001. Seamount benthic macrofauna off southern Tasmania: Communitystructure and impacts of trawling. Mar. Ecol. Prog. Ser. 213, 111.

Krieger, K.J., 2001. Coral (Primnoa) impacted by fishing gear in the Gulf of Alaska.In: Wilson, J.H.M., Hall, J., Gass, S.E., Kenchington, E.L.R., Butler, M., Doherty, P.(Eds.), Proceedings of the First International Symposium on Deep-Sea Corals.Ecology Action Centre, Halifax, pp. 106–116.

Leverette, T.L., Metaxas, A., 2005. Predicting Habitat for two Species of Deep-waterCoral on the Canadian Atlantic Continental Shelf and Slope, pp. 467–479.

Lowe, T.M., Eddy, S.R., 1997. tRNAscan-SE: A Program for Improved Detection ofTransfer RNA Genes in Genomic Sequence. Nucleic Acids Res. 25, 0955–0964.

Lumsden, S., Horigan, T., Bruckner, A., Dorr, G., 2007. The State of Deep CoralEcosystems of the United States: 2007. NOAA Tech. Memo. Silver Springs, MD.

McFadden, C.S., Sanchez, J.A., France, S.C., 2010. Molecular phylogenetic insightsinto the evolution of octocorallia: a review. Integrative Comp. Biol. 50, 389–410.

McFadden, C.S., France, S.C., Sanchez, J.A., Alderslade, P., 2006. A molecularphylogenetic analysis of the Octocorallia (Cnidaria: Anthozoa) based onmitochondrial protein-coding sequences. Mol. Phylogenet. Evol. 41, 513–527.

McFadden, C.S., Benayahu, Y., Pante, E., Thoma, J.N., Nevarez, P.A., France, S.C., 2011.Limitations of mitochondrial gene barcoding in Octocorallia. Mol. Ecol. Resour.11, 19–31.

Messing, C.G., Neumann, A.C., Lang, J.C., 1990. Biozonation of deep-water litho-herms and associated hardgrounds in the northeastern Straits of Florida.Palaios 5, 15–33.

Meyer, M., Kircher, M., 2010. Illumina Sequencing Library Preparation for HighlyMultiplexed Target Capture and Sequencing. Cold Spring Harbor Protocols.2010, pdb.prot5448.

Morgan, L.E., Tsao, C.-F., Guinotte, J.M., 2006. Status of Deep Sea Corals in USWaters. Marine Conservation Biology Institute, Bellevue, Washington.

Mortensen, P.B., Buhl-Mortensen, L., 2005. Deep-water Corals and their Habitats inthe Gully, a Submarine Canyon off Atlantic Canada, pp. 247–277.

Park, E., Kim, B., Won, Y.-J., 2010. The complete mitochondrial genome ofDendronephthya gigantea (Anthozoa: Octocorallia: Nephtheidae). Korean J. Syst.Zool. 26, 197–201.

Park, E., Hwang, D., Lee, J., Song, J., Seo, T., Won, Y., 2011. Estimation of divergencetimes in cnidarian evolution based on mitochondrial protein-coding genes andthe fossil record. Mol. Phylogenet. Evol. 62, 329–345.

Parrish, F.A., Baco, A.R., 2007. State of deep coral ecosystems in the U. S. PacificIslands region: Hawaii and the U. S. Pacific Territories. In: Lumsden, S.E.,Horigan, T.F., Bruckner, A.W., Dorr, G. (Eds.), The State of Deep Coral Ecosystemsof the United States. NOAA Tech., Memo, p. 2007.

Probert, P.K., McKnight, D.G., Grove, S.L., 1997. Benthic invertebrate bycatch from adeep-water trawl fishery, Chatham Rise, New Zealand. Aquat. Conserv.: Mar.Freshwater Ecosystem 7, 27–40.

Roark, E.B., Thomas, P.G., Robert, B.D., Ingram, B.L., 2006. Radiocarbon-based agesand growth rates of Hawaiian deep-sea corals. Mar. Ecol. Prog. Ser. 327, 1–14.

Roark, E.B., GuiIderson, T.P., Dunbar, R.B., Fallon, S.J., Mucciarone, D.A., 2009.Extreme longevity in proteinaceous deep-sea corals. Proc. Natl. Acad. Sci. USA106, 5204–5208.

Roberts, J.M., Wheeler, A., Friewald, A., Cairns, S., 2010. Cold-Water Corals: TheBiology and Geology of Deep-sea Coral Habitats. Cambrige University Press, NY,USA.

Rogers, A.D., Baco, A.R., Griffiths, A., Hart, H., Hall-Spencer, T., 2007. Corals onSeamounts. In: Pitcher, T.J., Morato, T., Hart, P.J.B., Clark, M.R., Haggan, N.,Santos, R.S. (Eds.), Seamounts: Ecology, Conservation and Management. Fishand Aquatic Resources Series. Blackwell, Oxford, pp. 141–169.

Rogers, A.D., 1994. The biology of seamounts. Adv. Mar. Biol. 30, 305–354.Sanchez, J.A., 2005. Systematics of the bubblegum corals (Cnidaria: Octocorallia:

Paragorgiidae) with description of new species from New Zealand and theEastern Pacific. Zootaxa 1014, 1–72.

Sanchez, J.A., McFadden, C.S., France, S.C., Lasker, H.R., 2003. Molecular phyloge-netic analyses of shallow-water Caribbean octocorals. Mar. Biol. 142, 975–987.

Stocks, K., 2004. Seamount invertebrates: composition and vulnerability. In:Morato, T., Pauly, D. (Eds.), Seamounts: Biodiversity and Figsheries. Universityof British Columbia, Vancouver.

Sun, Z., Hamel, J., Edinger, E., Mercier, A., 2010. Reproductive biology of the deep-sea octocoral Drifa glomerata in the Northwest Atlantic. Mar. Biol. 157, 863–873.

Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5:molecular evolutionary genetics analysis using maximum likelihood, evolu-tionary distance, and maximum parsimony methods. Mol. Biol. Evol.

Uda, K., Komeda, Y., Koyama, H., Koga, K., Fujita, T., Iwasaki, N., Suzuki, T., 2011.Complete mitochondrial genomes of two Japanese precious corals, Paracor-allium japonicum and Corallium konojoi (Cnidaria, Octocorallia, Coralliidae):Notable differences in gene arrangement. Gene 476, 27–37.

Watling, L., Norse, E.A., 1998. Disturbance of the seabed by mobile fishing gear: acomparison to forest clearcutting. Conserv. Biol. 12, 1180–1197.

Williams, A., Schlacher, T.A., Rowden, A.A., Althaus, F., Clark, M.R., Bowden, D.A.,Stewart, R., Bax, N.J., Consalvey, M., Kloser, R.J., 2010. Seamount megabenthicassemblages fail to recover from trawling impacts. Mar. Ecol. 31, 183–199.