Vol. 175, No. 3

Construction and Biochemical Characterization of RecombinantCytoplasmic Forms of the IucD Protein (Lysine:N6-Hydroxylase)

Encoded by the pColV-K30 Aerobactin Gene ClustertABRAHAM TIARIATH,' DOUGLAS SOCHA,' MIGUEL A. VALVANO,2*

AND THAMMAIAH VISWANATHA'Guelph-Waterloo Centre for Graduate Work in Chemistry, University of Waterloo, Waterloo,

Ontario N2L 3G1,1 and Department ofMicrobiology and Immunology, Universityof Western Ontario, London, Ontanio N6A SC1, 2 Canada

Received 14 July 1992/Accepted 19 November 1992

The aerobactin gene cluster in pColV-K30 consists of five genes (iucABCD iutA); four of these (iucABCD) areinvolved in aerobactin biosynthesis, whereas the fifth one (iutA) encodes the ferriaerobactin outer membranereceptor. iucD encodes lysine:NM-hydroxylase, which catalyzes the first step in aerobactin biosynthesis.Regardless of the method used for cell rupture, we have consistently found that IucD remains membranebound, and repeated efforts to achieve a purified and active soluble form of the enzyme have been unsuccessful.To circumvent this problem, we have constructed recombinant IucD proteins with modified amino termini bycreating three in-frame gene fusions of IucD to the amino-terminal amino acids of the cytoplasmic enzyme

13-galactosidase. Two of these constructs resulted in the addition to the iucD coding region of a hydrophilicleader sequence of 13 and 30 amino acids. The other construct involved the deletion of the first 47 amino acidsof the IucD amino terminus and the addition of 19 amino acids of the amino terminus of 1-galactosidase. Cellsexpressing any of the three recombinant IucD forms were found to produce soluble N6-hydroxylysine. One ofthese proteins, lucD439, was purified to homogeneity from the soluble fraction of the cell lysates, and it wascapable of participating in the biosynthesis of aerobactin, as determined in vitro by a cell-free system and invivo by a cross-feeding bioassay. A medium ionic strength of 0.25 (250 mM NaCl) or higher was required tomaintain the protein in a catalytically functional, tetrameric state. The enzyme was stringently specific withregard to its substrate and cofactor, L-lysine and flavin adenine dinucleotide, respectively. NADPH appearedto be the preferred electron donor used by IucD439 in the N hydroxylation process.

Aerobactin is a dihydroxamate siderophore derived by thecondensation of a molecule of N6-acetyl N6-hydroxylysine toeach of the two primary carboxyls of citric acid (10). Thissiderophore was originally discovered in Enterobacter aero-

genes 62-I (formerly Aerobacter aerogenes) but is found inseveral members of the family Enterobacteriaceae (10, 13,36). Aerobactin is produced under conditions of iron depriva-tion, such as those found in body fluids and tissues ofvertebrates (13). It is an important component in the virulenceof strains of Eschenchia coli and Klebsiella pneumoniae andcauses extraintestinal infections in humans and domesticanimals (13) by virtue of its ability to scavenge ferric iron fromtransferrin (18). The genes encoding the aerobactin ironuptake system can be found on plasmids or in the bacterialchromosome (31, 32, 35, 36). A detailed genetic analysis ofthe aerobactin system encoded by pColV-K30 and other ColVplasmids has been accomplished (7, 8, 14, 15, 35). Thesestudies have shown that the aerobactin operon comprises fivegenes (iucABCD and iutA, based on the nomenclature pro-posed by deLorenzo et al. [7]); four of these (iucABCD) areinvolved in siderophore biosynthesis, whereas the fifth one(iutA) encodes the ferriaerobactin outer membrane receptor.iucD encodes lysine:N6-hydroxylase, the enzyme that

catalyzes the initial step in aerobactin biosynthesis. Bio-

* Corresponding author. Electronic mail address: mvalvano@uwovax.uwo.ca.

t Dedicated to Professor J. B. Neilands, on the occasion of hisretirement, as recognition for his outstanding contributions to thefield of iron uptake.

589

chemical studies with cell-free systems of E. aerogenes 62-I(25) and E. coli (11) have provided insight into both thesequence of events and the intracellular localization of theenzymes involved in the aerobactin biosynthetic pathway.Thus, lysine:N6-hydroxylase, IucD, was found to be associ-ated with the membrane component of the cell-free systemregardless of the method used for cell rupture (11). Ourattempts to obtain a purified preparation of the enzyme haveproved futile, even when the studies were extended toinclude E. coli EN222(pRG111), a strain that was reported toyield a soluble form of lysine:N6-hydroxylase (26). The lackof a pure form of the enzyme has hampered the detailedanalysis of its biochemical features.The inability to obtain a soluble form of IucD should not

be unexpected in view of the presence of domains capable ofassociation with the inner membrane (17). The present studyconcerns a genetic strategy to construct soluble forms ofrecombinant IucD proteins with altered amino termini bycreating a series of in-frame gene fusions of IucD to aminoacids from the amino-terminal region of the cytosolic en-zyme P-galactosidase. We provide in vitro and in vivoevidence that recombinant IucD derivatives are not onlysoluble but also enzymatically active. Furthermore, wereport the purification and physicochemical characterizationof one of the recombinant IucD proteins.

MATERUILS AND METHODS

Chemicals. Flavin adenine dinucleotide (FAD), flavinmononucleotide, NADPH, NADH, glucose 6-phosphate (G-

JOURNAL OF BACTERIOLOGY, Feb. 1993, p. 589-5960021-9193/93/030589-08$02.00/0Copyright © 1993, American Society for Microbiology

on February 1, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

590 THARIATH ET AL.

A.

pABN6 lucD lutAL- in --

B.

pATI lucD

E A Sdas K

1. EcoR I

2. LigatonpATI

pUCI9 186

a. Sph 1, Eco)b. Kpn 1, EcoR I

a. Sphl, EcoR I

b. Kpn 1, EcoR I

pACYCi84 Sph I, Cla I

Sph I, S aUgation

pAT4 l-ucD

PUC19 i.f1Bsphl1pUCIB ~~~2.KlenowHinc11, X 3.XbaI

Ug

a. pAT2 r.

b. pAT3

lueD pATS

d--

k dFIG. 1. Construction of iucD gene fusions to the lacZ gene present in pUCl9. (A) Steps indicating the construction of pAT1, pAT2, and

pAT3. (B) Steps indicating the construction of pAT4 and pATS. Abbreviations for restriction enzymes: E, EcoRI; B, BamHI; C, ClaI; K,KpnI; Bs, BspHI; S, SphI; X, XbaI. The diagrams are not drawn to scale.

6-P), glucose-6-phosphate dehydrogenase (G-6-P deH2) cin-namylidene [E-4-(4-chlorophenyl)-2-oxo-3-butenoic acid],N-ethylmaleimide, sodium pyruvate, sodium arsenite, gram-icidin S, iodoacetamide, 2-nitro-5-thiocyanobenzoic acid,and dithiothreitol were purchased from Sigma Chemical Co.Dyematrex orange A gel was obtained from Amicon Corp.,Lexington, Mass., and used in accordance with the suppli-er's instructions.

Strains, plasmids, and recombinant methods. E. coli DH5a[F- 480dlacZAM15 A(argF-lacZYA)U169 deoR recAl endAlhsdRl7 (rK- MK+) supE44 X- thi-1 gyrA96 reL41] wasobtained from GIBCO-Bethesda Research Laboratories,Gaithersburg, Md. E. coli RT2006 (leu-48 purE41 pyrF30his-53xyl-14 cycAl cicB2 rpsL97 tsx-63 supE42 supK87 T3r?)was supplied by B. Bachmann, E. coli Genetic Stock Center,Yale University, New Haven, Conn. E. coli LG1522 (pColV-K30 iuc ara azi fepA lacY leu mtl proC rpsL tonA tsx thisupE) was used for the aerobactin bioassays (4). E. colistrains GR143 and EN222 were obtained from V. Braun,Universitat Tubingen, Tubingen, Germany. EN222 is a lysmutant of E. coli K-12 transformed with pRG111 (9). GR143is a derivative of strain H1443 (aroB rpsL lac araD) thatcontains plasmid pRG133 (15). Both pRG111 and pRG133are subclones of pColV-K30 with internal deletions in theaerobactin gene cluster that result in functional iucD andiucA genes and nonfunctional iucB and iucC genes (15).pABN5 carries a 6.7-kb HindIII-EcoRI fragment derivedfrom pColV-K30 and contains the aerobactin biosynthesisgenes iucABCD (7). pABN6 harbors a 6.7-kb EcoRI frag-ment carrying a deletion of the iucC gene and intact iucD andiutA genes (2). The construction and characteristics ofplasmid vector pUC19 and pACYC184 have been describedelsewhere (5, 37). Restriction enzymes, the Klenow frag-ment of DNA polymerase I, and T4 DNA ligase werepurchased from Boehringer Mannheim, Dorval, Quebec,

Canada, and Pharmacia Canada Inc., Baie d'Urfe, Quebec,Canada, and used under the conditions recommended by thesuppliers. Recombinant plasmids and vectors were extractedfrom bacterial cells by an alkaline lysis procedure (3),followed in some cases by ultracentrifugation in cesiumchloride-ethidium bromide density gradients (31). PlasmidDNA was examined by restriction endonuclease analysis in0.7% agarose gels (31, 32). When needed, DNA fragmentswere purified from agarose gels by electroelution into DE-81paper (Whatman International Ltd., Maidstone, England) asdescribed elsewhere (23). Transformations were carried outby the calcium chloride method of Cohen et al. (6).

Plasmid constructions. Plasmids constructed in this studyare indicated in Fig. 1. pAT1 was constructed by deleting a3.3-kb EcoRI fragment of pABN6 to remove part of the iut4gene. A 2.3-kb SphI-EcoRI fragment of pAT1 was purifiedand inserted into pUC19 that had been cleaved with the sameenzymes to produce pAT2. A 2.1-kb KpnI-EcoRI fragmentof pAT1 was also purified and inserted into pUC19 that hadbeen cleaved with the same enzymes to produce pAT3, inwhich the ,B-galactosidase ot-peptide is fused in frame with aportion of IucD lacking the first 47 amino acids from itsamino terminus. pAT4 was constructed by inserting a 2.0-kbSphI-ClaI fragment of pAT1 into pACYC184 that had beencleaved with the same enzyme. pAT4 was cleaved withBspHI, and the ends were filled in with the Klenow fragmentof DNA polymerase I; this step was followed by completedigestion with XbaI. The 2.0-kb blunt-ended XbaI fragmentof pAT4 was inserted into pUC19 that had been cleaved withHincII-XbaI to produce pAT5. This plasmid resulted in anin-frame fusion of the ,B-galactosidase a-peptide and the firstcodon of iucD. pM.AV7 was constructed by inserting the4.6-kb HindIII-SphI fragment of pABN5 into pACYC184that had been cleaved with the same enzymes. This plasmidcarries the aerobactin biosynthesis genes iucABC and is

_ _

S/EB lDK d

p,iw lucD|_ *--~ -

J. BACT1ERIOL.

ma lueD-n n

c

on February 1, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

RECOMBINANT CYTOPLASMIC FORMS OF IucD 591

compatible with pUC19-derived plasmids. Hydropathy pro-files of the wild-type lucD protein and its recombinantderivatives were calculated by the method of Kyte andDoolittle (20) and displayed with the program PROFILE-GRAPH, version 1.2, written by K. 0. Hofmann, Institut furBiochemie, Universitat Koln, Cologne, Germany.

Cell growth. The various E. coli strains used in this studywere grown on Luria-Bertani or minimal (M9) mediumcontaining appropriate antibiotics. Seed cultures were pre-pared by transferring the organisms from Luria-Bertani agarslants to 100 ml of sterile medium and incubating them for 10to 12 h (18 to 20 h for RT2006 containing pAT2) at 37°C withcontinuous shaking; the entire culture was used to inoculate1.5 liters of medium in a 2.5-liter flask equipped with forcedaeration.

Cell-free system. Cells were harvested (usually 8.5 h afterinoculation with the seed culture) by centrifugation of theculture at 6,500 x g for 10 min. The cell pellet was washedby resuspension in 200 ml of NaCl (0.85%) and centrifuga-tion at 6,500 x g for 10 min. The cell pellet was resuspendedin 50 ml of buffer I (10 mM potassium phosphate [pH 7.2], 1mM dithiothreitol, 1 mM L-glutamine). The cells were rup-tured by a single passage of the suspension through a Frenchpress (precooled to 4°C) at a pressure of 10,000 lb/in2. Celldebris and unbroken cells were removed from the cellextract by centrifugation (550 x g) at 4°C for 10 min. Theresulting slurry was incubated at 37°C for 30 min in thepresence of DNase (1 mg) and RNase (1 mg) and centrifuged(140,000 x g) at 4°C for 60 min. Pellets (membrane compo-nent) and supernatants were examined for lysine:N6-hydrox-ylase activity. The former component was resuspended in 50ml of buffer I prior to its use in the experiments.

Purification of lucD439. All the purification steps wereperformed at 4°C. Upon the addition of solid ammoniumsulfate (40% saturation) to the crude supernatant (140,000 xg), the precipitate formed was collected by centrifugation(38,000 x g), dissolved in 50 ml of buffer I, and dialyzed for12 h against 1 liter of the same buffer containing 250 mMNaCl. This step causes the removal of the flavin cofactorassociated with the enzyme and is essential for binding of theprotein to the chromatography gel. Upon further dialysis for2 h against buffer I, purification of the enzyme was carriedout by chromatography on Dyematrex orange A. The pro-teins bound to the gel were recovered by stepwise elutionwith buffer I containing increasing amounts (100, 250, 500,700, and 1,000 mM) of NaCl. Fractions (25 ml) obtained ateach of these elution steps were dialyzed against buffer I andtested for lysineWN6-hydroxylase activity.Assay for lysine-N6-hydroxylase activity. A typical assay

mixture in a final volume of 5.0 ml consisted of 100 mMpotassium phosphate (pH 7.2), L-lysine (1 mM), FAD (40,M), NADPH (80 ,uM; regenerated with G-6-P [1 mM] andG-6-P deH2 [1 U]), and enzyme (100 p,g). The assay mixturewas incubated for 15 min at 37°C. The reaction was termi-nated by the addition of a slurry (5 ml) of Dowex 5OW-X8resin (H+ form; 200/400 mesh). N6-Hydroxylysine producedwas determined by the iodine oxidation procedure (25).Under these conditions, the rate of hydroxylation was linearduring the initial 30-min incubation. When other amino acidswere included in the assay, they were used at a finalconcentration of 1 mM. For the assessment of the Kmvalues, the concentrations of two of the reactants in theassay were maintained as indicated above, but the concen-tration of the one that was being assessed was varied overthe following ranges: L-lysine, 0 to 2 mM; FAD, 0 to 160 ,uM;NADPH, 0 to 600 ,uM (in the absence of G-6-P and G-6-P

deH2). The assessment of Km values was performed bylinear regression of double-reciprocal plots of the data by themethod of Lineweaver and Burk (22) with a Cricket graphand a Macintosh computer.

In vitro synthesis of aerobactin. Cell lysates of E. coliDH5ax carrying various recombinant plasmids and preparedas described above served as the sources of enzymes in thecell-free system assay for aerobactin biosynthesis. A typicalincubation mixture in a final volume of 20 ml consisted ofpotassium phosphate (50 mM; pH 7.2), L-lysine (4 mM),pyruvate (4 mM), ATP (10 mM), MgCl2 (1 mM), citrate (4mM), and enzyme preparation (2 ml). Following incubationat 37°C for 20 h, the reaction mixture was passed over acolumn (1 by 10 cm) of Dowex50W-X8 resin (H+ form). Theeffluent (containing only desferriaerobactin) was collectedand dried under reduced pressure at 45°C. The residue wasdissolved in 8 ml of water, and aliquots were used todetermine aerobactin production by reaction with bis(mer-captoacetate)Fe(III) complex reagent (1).

Aerobactin cross-feeding bioassay. The production of aero-bactin was determined by a cross-feeding bioassay. Filterdisks were embedded with 10 ,ul of bacterial supematantsfrom cells grown on Luria-Bertani medium containing 200,M iron chelator oc,a'-dipyridyl and deposited onto minimalM9 agar plates that had been covered with soft agar contain-ing indicator strain LG1522 (4). This bacterium cannotproduce any siderophore, but it can be cross fed by aero-bactin, since it carries a mutated pColV-K30 plasmid ex-pressing only the aerobactin receptor IutA. A positive bio-assay was determined visually by the observation of a haloof growth of the indicator strain surrounding filter diskscontaining aerobactin.

Protein techniques. Protein concentration was determinedby a modified Bradford method (27). Sodium dodecyl sul-fate-polyacrylamide gel electrophoresis (SDS-PAGE) analy-sis of protein samples was done by the procedure of Laem-mli (21), and gels were stained with Coomassie blue. Themolecular weight of native IucD was determined by theprocedure of Hedrick and Smith (16).

RESULTS AND DISCUSSION

Expression of recombinant IucD derivatives with alteredamino-terminal peptide sequences. In a previous study, Her-rero et al. (17) suggested that IucD is an integral membraneprotein associated with the inner membrane by at least twoattachment sites. One of the membrane attachment sitesappears to consist of a hydrophobic amino acid sequenceresembling a leader peptide located on the amino terminus ofIucD (17). The features in primary sequences of proteinsdetermining membrane insertion are not completely eluci-dated (34). We assumed that either a deletion of the hydro-phobic leader peptide or its displacement to a more interiorlocation in the protein sequence should compromise theassociation of IucD with the inner membrane. Consequently,we constructed three different plasmids carrying sequencesencoding modified forms of IucD with altered amino termini,under the control of the lac promoter (Fig. 1). These forms ofIucD contained amino-terminal segments provided by thecytosolic enzyme ,-galactosidase encoded by pUC19.

In pAT5 (Fig. 1), the sequence encoding the IucD proteinwas fused in frame to the amino-terminal sequence of,B-galactosidase. The resulting gene encodes a polypeptide,IucD439, beginning with MTMITPSLHACRSMKK. . ., inwhich the first 13 amino acid residues are derived from thevector and the remaining residues are those of wild-type

VOL. 175, 1993

on February 1, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

592 THARIATH ET AL.

pAT2 (iucD456)

Hindl I I SPhI I

210 ACAGCTATGACCATGATTACGCC2GCTTG0TGCTGCCGATTACCTTGAGGATCTGCAAATCCGCTGTGGCTGGTMCTCAGGAATATGAATCATGAAGTGTC 320A A E L P * G S A K S A V A G N S G I * I N K K S V

(W) (W)

pAT3 (iucD398)

HindIll SPhI HinclI XbaI BalI SmaI IKI-r II,7

210 ACAGCTAT3ACCATGATTACGCCAGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCGGGTACCGGATTGTCATATGCAGACCGTCTTTCTGAAGA310II....e....!......!f.::. V P D C H N 0 T V F L K

pATS (iucD439)

H In SPhI PstI210 ACAGCTATGACCATGATTACGCCAAGCTTGCATGCCTGCAGGTCCATGAAAAAAAGTGTC 269

**I! w*:1'tPKg> N K K S V

iucD

Sphl Bs2HI

1 CCGGTAAAACTGACCTGGCCTGATCTGGATGGCGGCAGCCGCATGCTGCCGAATTACCTTGAGGATCTGCAAAATCCGCTGTGGCTGGTAACTCf4 .ATGAATCATGAAAAAAAGTG 120M K K S V

121 TCGATTTTA2TGGTGTAGGGACAGGGCCATTTATCTCAGCATTGCTGCGTTGTCAA TCGAA CTGGACTGTCTCTTCTTTATATCCTCATTTTTCCTGGATCCGG 240D F I G V G T G P F N L S I A A L S H Q I E E L D C L F F D E H P H F S W H P G

K2nl

241 GTATGCTGGTACCGGATTGTCATATGCAGACCGTCTTTCTGAAAGATCTGGTCAGTGCTG 300M L V P D C H M Q T V F L K D L V S A

FIG. 2. Details of the gene and protein fusion end points. The DNA sequences of the fusion end points in pAT2, pAT3, and pATS werededuced from the published sequences of pUC19 and iucD (17, 37). Shaded amino acids indicate the portion of the recombinant polypeptidecontributed by the 0-galactosidase a-peptide encoded by pUC19. Doubly underlined amino acids denote IucD sequences. The underlinedregion of the DNA sequence in pAT2 and iucD denotes the leader sequence that contains the ribosome binding site of the wild-type iucD geneand two UGA stop codons (asterisks). These codons can be read as tryptophan (W) in a supK strain (28). Shaded bases in the iucD sequenceindicate the Shine-Dalgarno sequence as reported by Herrero et al. (17).

IucD (Fig. 2). This polypeptide contains 439 amino acids andhas a predicted molecular mass of 50,390 daltons. Thehydropathy profile shows that the sequence extending fromMet-1 to Met-14 imparts a hydrophilic character to the aminoterminus of IucD439, in contrast to the characteristic hydro-phobic amino terminus of wild-type IucD (data not shown).

In pAT2, the sequences encoding the IucD protein and theuntranslated upstream segment of 62 bp were also fused inframe to ,B-galactosidase sequences (Fig. 1 and 2). The 62-bpsequence upstream of iucD contains the putative ribosomebinding site and also carries two UGA stop codons atpositions 258 and 300 (Fig. 2), which preclude the translationof this sequence into a polypeptide. Translation ofUGA stopcodons can occur in supK strains and results in the incorpo-ration of the amino acid tryptophan into the protein se-quence (28). Thus, if the chimeric gene is translated, pAT2should encode IucD456, a polypeptide beginning with MTMITPSLHAAELPWGSAKSAVAGNSGIWIMKK..., inwhich the first 8 residues are derived from the vector and theresidues from His-9 to Ile-30 arise from the translation of the62-bp leader sequence (Fig. 2). The tryptophan residues at

positions 15 and 29 arise from the translation of the UGAcodons in E. coli RT2006 (supK), and Met-31 corresponds tothe first amino acid of wild-type IucD. lucD456, made of 456amino acids, has a predicted molecular mass of 52,040daltons and a hydrophilic amino terminus.

Despite the changes introduced in the IucD polypeptidesencoded by pAT2 and pAT5, the hydrophobic region presentin the normal IucD protein was not modified per se. Thus,we constructed deletion-fusion derivative pAT3. In thisplasmid, the sequence encoding amino acid residues Val-48to Thr-426 (the carboxyl terminus of IucD) was fused inframe to the amino-terminal sequence of ,B-galactosidase;this procedure resulted in the removal of hydrophobic resi-dues Met-1 to Leu-47 of wild-type IucD. The recombinantgene encodes a polypeptide of 398 amino acids, IucD398,with a predicted molecular mass of 45,819 daltons and apredominantly hydrophilic amino terminus.

Lysine:M6-hydroxylase activity was detected in cell ex-tracts of DH5a carrying pAT3 and pAT5 and extracts ofRT2006 containing pAT2 (Table 1). Therefore, the proteinfusions were enzymatically active, a result demonstrating

J. BACTERIOL.

on February 1, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

RECOMBINANT CYTOPLASMIC FORMS OF IucD 593

TABLE 1. Localization of IucD in cell-free systems of E. coliK-12 strains expressing iucD genes

Lysine:N"-hydroxylase activity",in U (%), in:

Strain PlasmidaCell Soluble Membrane

extract fraction fraction

GR143 pRG133 (iucA+ iucD+) 554 26 (5) 528 (95)EN222 pRG111 (iucA+ iucD+) 1,103 20 (2) 1,083 (98)DH5a pAT2 (iucD456) 808 141 (17) 667 (83)RT2006 pAT2 (iucD456) 932 866 (93) 66 (7)DH5a pAT3 (iucD398) 1,933 1,833 (95) 100 (5)DHSa pAT5 (iucD439) 1,216 1,133 (92) 83 (8)DHSa None 0 0 (0) 0 (0)

a Genotypes carried by each plasmid are indicated in parentheses.I LysineWV-hydroxylase activity was measured, as indicated in Materials

and Methods, in cell extracts (total activity) and in membrane and supernatant(soluble) fractions. One unit is the amount of enzyme required to produce 1nmol of N6-hydroxylysine per min.

that either the addition or the removal of amino acids fromthe amino terminus of IucD did not significantly compromiseenzyme activity.

Localization of IucD. Previous studies with cell-free sys-tems of E. aerogenes 62-I and E. coli GR143 showed thatIucD is associated with the membrane regardless of themethod used for cell rupture (11). Membrane and superna-tant components from cell extracts containing the recombi-nant forms of IucD were examined for lysine:N6-hydroxy-lase activity. Cell-free systems from E. coli GR143 and E.coli EN222 were included for comparison, since the iucDgene in these strains was not subjected to any type ofmanipulation and is also present in high-copy-number plas-mids. The use of E. coli EN222 was of special interest, sincethe isolation and characterization of a soluble iucD productfrom this strain have been reported (26).For both E. coli GR143 and E. coli EN222, most of the

cellular lysine:N6-hydroxylase activity (>95%) remainedassociated with the membrane component (Table 1). Con-versely, for E. coli strains harboring any one of the threerecombinant IucD forms, lysine:N6-hydroxylase activitywas almost exclusively found in the supernatant component(Table 1). The enzyme activity of the recombinant IucDproteins that was associated with membranes was negligiblerelative to that found in membranes containing wild-typeIucD. For DH5a containing pAT2, most of the enzymeactivity (83%) was localized in the membrane fraction (Table1). The fusion protein is not translated in this strain becauseof the fact that the two UGA stop codons (Fig. 2) cannot besuppressed, but since transcription originating in the pUC19lac promoter is not likely to be affected, wild-type IucD isformed. Taken together, our results indicate that the restric-tion of putative membrane insertion sites due to a high levelof protein expression is not the basis for the localization ofrecombinant IucD proteins in the cytosol. We cannot explainthe results reported by Plattner et al. (26) with EN222, butour finding that IucD is membrane bound in this strain (Table1) is in accord with previous observations made with E.aerogenes 62-I and other E. coli strains (11).SDS-PAGE analysis of supernatant and membrane frac-

tions of E. coli cell-free systems producing recombinantIucD proteins provided additional evidence for the localiza-tion of the proteins in the supernatant fractions (Fig. 3).Compared with membrane fractions, supernatant fractionscontained relatively large amounts of a polypeptide of ca. 50

FIG. 3. Analysis of protein components of membrane (lanes A,C, and E) and supernatant (lanes B, D, and F) fractions obtainedfrom cells expressing recombinant IucD proteins. Cells were frac-tionated as described in the text, and samples were examined bySDS-PAGE and then stained with Coomassie blue. Lanes: A and B,RT2006(pAT2); C and D, DHSa(pAT3); E and F, DHSa(pAT5); G,purified IucD439; m, molecular mass standards, expressed inkilodaltons (phosphorylase b, 94; albumin, 67; ovalbumin, 43;carbonic anydrase, 30; trypsin inhibitor, 20; and a-lactalbumin, 14).Arrows point to polypeptide bands in the region of 48 to 50 kDa(corresponding to recombinant IucD proteins) and predominantlyfound in the supernatant (soluble) fractions.

kDa (Fig. 3). This prominent polypeptide was not present incontrol experiments containing extracts prepared from strainDH5a (data not shown).We conclude that either deletion (lucD398) or a shift to an

interior location (IucD439 and lucD456) of the amino-termi-nal hydrophobic domain of IucD appears to be adequate forminimizing the interactions of IucD with the membrane. Toour knowledge, the amino-terminal portion of P-galactosi-dase has not been used to perturb protein insertion intomembranes in the same manner as that reported in this work.Further studies are being conducted by us to investigate inmore detail the nature of the effect of the amino-terminalregion of 3-galactosidase on the cellular localization ofrecombinant IucD proteins and other inner membrane pro-teins.

Participation of IucD439 in aerobactin production. Thelocation of wild-type IucD in the inner membrane may beimportant to ensure its ready access to the reducing equiv-alents required for the activation of 02, an obligatory eventin the lysine:N6 hydroxylation process (24). The experi-ments described above indicated that membrane attachmentappears not to be necessary for lysine:N6 hydroxylation.However, they did not address the question of whethercytoplasmic IucD can engage itself with the other enzymesinvolved in the subsequent steps of aerobactin biosynthesis.Thus, we sought to investigate the ability of recombinantIucD proteins to participate in aerobactin production both invivo and in vitro. IucD439, encoded by pAT5, was chosenfor these studies, since this protein is the least modified ofthe three recombinant IucD proteins. For these experiments,pMAV7 carrying the three other genes needed for aerobactinbiosynthesis (iucABC) was transformed into cells containingpATS. DH5a cells containing pABN5, pAT5, pMAV7, or

VOL. 175, 1993

on February 1, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

594 THARIATH ET AL.

TABLE 2. In vivo and in vitro synthesis of aerobactin

Result of Aerobactin synthesisSource cross-feeding in a cell-free system

bioassay' (pmol)b

pABN5 (iucABCD) ++ (336) 87pAT5 (iucD439) - (0) 0pMAV7 (iucABC) - (0) 0pAT5 and pMAV7 (iucD439 + (85) 41and iucABC)I Bacterial supernatants of DH5Sa carrying the indicated plasmids were

assayed for their ability to cross feed indicator strain LG1522. The diameterand density of growth of the indicator strain surrounding filter disks embeddedwith supematants were estimated visually: + +, large, dense growth halo; +,faint growth halo; -, no growth halo. Values in parentheses indicate theaerobactin concentration in bacterial supernatants, expressed in micromoles.

b Cell-free systems were prepared as described in Materials and Methods.The material obtained after the removal of cell debris and intact cells bycentrifugation at 550 x g served as the source for aerobactin production.

both pMAV7 and pAT5 were grown under conditions of ironlimitation, and culture supernatants were assayed for theirability to cross feed indicator strain LG1522. Only superna-tants from DH5a(pABN5) and DH5a(pAT5, pMAV7) crossfed LG1522, albeit the halo of growth induced by thesupernatant from DH5a(pABN5) was larger and denser(Table 2). These results were consistent with the chemicaldetermination of the concentration of aerobactin, only de-tectable in supematants from these strains (Table 2). Cellextracts from DH5a(pABN5) and DHSa(pAT5, pMAV7)also mediated the in vitro biosynthesis of aerobactin (Table2). Despite the fact that the overall siderophore productionby IucD439 was somewhat lower than that by wild-typeIucD, these experiments demonstrated unequivocally thatrecombinant IucD439 can function to synthesize aerobactinin vivo and in vitro.Enzyme purification and stability. IucD439 was easily

purified by a combination of ammonium sulfate precipitationand chromatography on Dyematrex orange A (Table 3).Treatment of the crude supernatant from cell lysates withammonium sulfate resulted in the precipitation of the major-ity (>80%) of the lysine:N6-hydroxylase activity. The finalstep of the purification procedure, involving chromatogra-phy on Dyematrex orange A and elution with buffer mediumcontaining 1 M NaCl, resulted in a 20-fold increase in thespecific activity of the enzyme relative to that of the startingmaterial (Table 3). SDS-PAGE analysis revealed that theprotein preparation was homogeneous and had an apparentmolecular mass of approximately 50 kDa (Fig. 3, lane G).The recovered enzyme preparation rapidly lost catalytic

activity upon removal of the salt by dialysis against buffer

TABLE 3. Purification of IucD439

Total Total S c UmMaterial' protein activity Sp act (U/mg

(mg) (U)b of protein)

Crude cell lysate 290 3,300 11.3Ammonium sulfate precipitate 114 2,387 21.0Eluent from Dyematrix orange AC 10 2,380 (379) 238 (37.9)

a Cells (5 g) were lysed and processed as described in Materials andMethods.

b One unit is the amount of enzyme required to produce 1 nmol ofN"-hydroxylysine per min.

c Values in parentheses are those obtained after dialysis against a mediumof low ionic strength (10 mM phosphate buffer; ionic strength, 0.04).

Ionic strength

FIG. 4. Influence of ionic strength on the catalytic activity oflysineUV"-hydroxylase. The enzyme preparation recovered fromDyematrex orange A was dialyzed against media of different ionicstrengths for 12 h at 4°C prior to the determination of enzymeactivity.

medium of low ionic strength (Table 3). PAGE (16) of theenzyme preparation under nondenaturing conditions re-

vealed a protein with an apparent molecular mass of approx-imately 200 kDa (data not shown). Removal of the salt bydialysis resulted in the disappearance of this protein speciesand the concomitant appearance of a component of 50 kDa,similar to that observed by SDS-PAGE (Fig. 3, lane G).These observations suggest that under conditions of highionic strength, the enzyme exists in an oligomeric form(presumably a tetramer) that dissociates to the monomericstate in a medium of low ionic strength. The transition fromtetramer to monomer may explain the pronounced decline ofIucD439 enzyme activity in a medium of low ionic strength(Table 3). To determine the optimal ionic-strength conditionsneeded for the maintenance of the quaternary structuralfeatures essential for catalytic function, we measured theenzyme activity of purified IucD439 following dialysisagainst media of different ionic strengths. A medium with an

ionic strength of approximately 0.25 (250 mM NaCl) was

required for maximum enzyme activity (Fig. 4). Analysis byPAGE under nondenaturing conditions revealed that in a

medium with an ionic strength of 20.25 the protein exists as

a tetramer, but it reverts to the monomeric state in a mediumwith a lower ionic strength (data not shown).The activity of the purified enzyme was maintained for at

least 1 month at 4°C during storage in a medium with an ionicstrength of 0.25. In contrast, less than 40% of the activityremained after 12 h at 4°C when the enzyme preparation wasstored in a medium of low ionic strength. Exposure totemperatures below 0°C also resulted in the extensive loss ofenzyme activity, as previously noted with the membrane-bound form of the enzyme (Table 4). These properties of thepurified enzyme suggest very strongly that catalytic functionis dependent on oligomeric state.

Substrate specificity and cofactor requirements of recombi-nant lucD439. The biochemical characterization of the ly-sine:N" hydroxylation process in E. aerogenes 62-I and in E.coli was previously done with unpurified membrane-associ-ated preparations of IucD (25, 29, 30, 33). The availability ofpurified IucD439 allowed us to reexamine substrate specific-

RAo0E

Co.25co0co

x

z

J. BACTE1RIOL.

on February 1, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

RECOMBINANT CYTOPLASMIC FORMS OF IucD 595

TABLE 4. Effects of various reagents on the enzyme activities ofIucD439 and the membrane-bound form of the enzyme

Relative N-hydroxylaseactivity' of:

TreatmentIucD43g Membrane-bound

form of enzyme

None 100 100Boiling (100'C) 0 0Freezing (-70'C) 0 0Pyruvate (1 mM) 100 100 (22)bCinnamylidene (400 ,uM) 8 25Arsenite, sodium salt (1 mM) 98 14CGramicidin S (100 ,uM) 100 l9dIodoacetamide (1 mM) 13 NDN-Ethylmaleimide (1 mM) 59 5d2-Nitro-5-thiocyanobenzoic acid (1 mM) 29 ND

a For lucD439, the assay mixture (final volume, 5 ml) consisted of enzyme(100 pg), L-lysine (1 mM), FAD (40 p,M), NADPH (80 ,uM; regenerated with1 mM G-6-P and 1 U of G-6-P deH2), and potassium phosphate (50 mM; pH7.2), and incubation was done for 15 min at 37°C. For the membrane-boundform of the enzyme, the assay mixture (final volume, 10 ml) consisted ofmembrane vesicles (1 ml), L-lysine (1 mM), pyruvate (1 mM), and potassiumphosphate (50 mM; pH 7.2), and incubation was done for 1 h at 37°C. Forassessment of the indicated treatments, the activity of each of the controlswas set at 100. ND, not determined.bThe activity in the absence of pyruvate is indicated in parentheses.c Data are from reference 24.d Data are from references 11 and 12.

ity, cofactor requirements, and effects of various inhibitorson enzyme activity.IucD439 is stringently specific for L-lysine as its substrate.

Preliminary analysis suggested at least two distinct bindingsites for L-lysine, with Km values of 33 and 160 ,uM,analogous to that found for the membrane-bound enzyme(25). Neither D-lysine nor the other amino acids, which alsoincluded L-lysine analogs such as L-ornithine and L-2,4-diaminobutyric acid, served as substrates. In contrast, themembrane-bound lysine:N"-hydroxylase has been shown tohydroxylate the above-mentioned L-lysine analogs, althoughat a relatively slower rate (25). It is not clear whether thisapparent relaxation in the substrate specificity of the mem-brane-bound enzyme is a consequence of conformationalchanges induced by the environment or is due to the pres-ence of another membrane protein(s) with N hydroxylationactivity for L-ornithine and L-2,4-diaminobutyric acid. Glu-tamic acid and glutamine served neither as substrates nor asactivators of IucD439 enzyme activity. Likewise, peptide-bound lysine (e.g., Gly-Lys, Lys-Gly, and Gly-Gly-Lys-Ala-Ala) was not hydroxylated by IucD439.

In the presence of FAD and NADPH, purified IucD439catalyzes the conversion of L-lysine to its N6-hydroxy deriv-ative. No hydroxylation was observed in the absence ofeither of these cofactors. The enzyme exhibited a stringentspecificity for FAD, since flavin mononucleotide was noteffective. Increasing concentrations of FAD resulted in anenhancement of lysine:N6-hydroxylase activity, with maxi-mum production being achieved at a 40 ,uM concentration ofthe cofactor. Further increases in the FAD concentration ledto a pronounced diminution in the rate of N hydroxylation.An apparent Km value of 5.3 ,M for FAD was determinedfrom these studies.NADPH was the preferred electron donor for flavine

reduction, and NADH was half as effective as NADPH. Asystematic study of the dependence of N hydroxylation onthe concentration of NADPH revealed maximum enzyme

activity in the presence of 300 ,uM NADPH. Concentrationsof NADPH above 300 ,uM led to a slight inhibition of the Nhydroxylation of lysine. An apparentKm value of 123 ,uM forNADPH was estimated.

Previous work with the membrane-bound form of theenzyme had demonstrated that lysine:N' hydroxylation wasstrongly stimulated by pyruvate oxidation (11, 12, 29, 30,33). Interestingly, a variety of reagents inhibiting pyruvateoxidase-catalyzed reactions also inhibited N hydroxylation(11, 12). Furthermore, pyruvate has been shown not only tostimulate the formation of N"-hydroxylysine but also toserve as the source of the acetyl moiety needed for theconversion of the N-hydroxy amino acid to its hydroxamatederivative (29). The inhibition of both pyruvate oxidationand lysine:N hydroxylation reactions by cinnamylideneprovided the basis for the suggested interrelationship be-tween the two processes (30), since this compound is knownto inactivate thiamine PPi-dependent enzymes (19). In con-trast, for purified IucD439, pyruvate did not serve as thesource of electrons for FAD reduction, since it failed topromote lysine:N' hydroxylation (Table 4), and the processwas dependent on NADPH, which inhibited the lysine:N'hydroxylation of the membrane-bound form of the enzyme(24). However, cinnamylidene inhibited the production ofN"-hydroxylysine (Table 4), possibly indicating that thiscompound can function as a direct inhibitor of the enzyme.Arsenite and gramicidin S, previously found to inhibit themembrane-bound form of the enzyme (12, 24), had no effecton the reaction catalyzed by IucD439 (Table 4). The lack ofan interrelationship between pyruvate oxidation and ly-sine:N' hydroxylation for purified IucD439 suggests that thesources of electrons for N hydroxylation can be diverse andthat the topography of the enzyme may play a role in theselection of the electron donor. IucD439 was inhibited bythiol-modifying agents, such as iodoacetamide, N-ethylma-leimide, and 2-nitro-5-thiocyanobenzoic acid (Table 4), in amanner similar to that of the membrane-bound form of theenzyme. This result suggests that a sulfhydryl group(s) mayplay an important role in the catalytic mechanism of theenzyme.

In conclusion, the availability of a soluble form of lysine:N6-hydroxylase allowed us to study the structural organiza-tion of the enzyme and its catalytic mechanism. We haveprovided concrete evidence for the participation of FAD inthe lysine:N6 hydroxylation process and have establishedthat the purified enzyme is extremely stringent in its sub-strate specificity for L-lysine. Further investigations arebeing pursued by us to achieve a detailed molecular map ofthe functional domains of this enzyme and to explore themechanism involved in the hydroxylation process. A preciseunderstanding of the enzyme mechanism will permit us todevelop enzyme inhibitors capable of blocking the biosyn-thesis of aerobactin.

ACKNOWLEDGMENTS

This work was supported in part by grants from the MedicalResearch Council (to M.A.V.) and the Natural Sciences and Engi-neering Research Council (to T.V.).We thank the colleagues who provided the strains and plasmids

used in this study.

REFERENCES1. Arnold, L. D., and T. Viswanatha. 1983. The use of bis(mercap-

toacetato-S,O)hydroxoiron(III) complex for determination ofhydroxamates. J. Biochem. Biophys. Methods 8:307-320.

2. Bindereif, A., and J. B. Neilands. 1983. Cloning of the aerobac-

VOL. 175, 1993

on February 1, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

596 THARIATH ET AL.

tin-mediated iron assimilation system of plasmid Co1V-K30. J.Bacteriol. 153:1111-1113.

3. Birnboim, H. C., and J. Doly. 1979. A rapid alkaline extractionprocedure for screening recombinant plasmid DNA. NucleicAcids Res. 7:1513-1523.

4. Carbonetti, N. H., and P. H. Williams. 1984. A cluster of fivegenes specifying the aerobactin iron uptake system of plasmidColV-K30. Infect. Immun. 46:7-12.

5. Chang, A. C. Y., and S. N. Cohen. 1978. Construction andcharacterization of amplifiable multicopy DNA cloning vehiclesderived from the P1SA cryptic miniplasmid. J. Bacteriol. 134:1141-1156.

6. Cohen, S. N., A. C. Y. Chang, and L. Hsu. 1972. Non-chromosomal antibiotic resistance in bacteria: genetic transfor-mation of Escherichia coli by R-factor DNA. Proc. Natl. Acad.Sci. USA 69:2110-2114.

7. deLorenzo, V., A. Bindereif, B. H. Paw, and J. B. Neilands.1986. Aerobactin biosynthesis and transport genes of plasmidColV-K30 in Escherichia coli K-12. J. Bacteriol. 165:570-578.

8. deLorenzo, V., and J. B. Neilands. 1986. Characterization ofiucA and iucC genes of the aerobactin system of plasmidColV-K30 in Escherichia coli. J. Bacteriol. 167:350-355.

9. Engelbrecht, F., and V. Braun. 1986. Inhibition of microbialgrowth by interference with siderophore biosynthesis. Oxida-tion of primary amino groups in aerobactin synthesis by Es-cherichia coli. FEMS Microbiol. Lett. 33:223-227.

10. Gibson, F., and D. I. Magrath. 1969. The isolation and charac-terisation of a hydroxamic acid (aerobactin) formed by Aer-obacter aerogenes 62-I. Biochim. Biophys. Acta 192:175-184.

11. Goh, C. J., E. W. Szczepan, N. Menhart, and T. Viswanatha.1989. Studies on lysine:N6-hydroxylation by cell-free systems ofAerobacter aerogenes 62-I. Biochim. Biophys. Acta 990:240-245.

12. Goh, C. J., E. W. Szczepan, G. Wright, N. Menhart, J. F.Honek, and T. Viswanatha. 1989. Investigation of lysine:N6-hydroxylation in the biosynthesis of the siderophore aerobactin.Bioorg. Chem. 17:13-27.

13. Griffiths, E. 1991. Iron and bacterial virulence. A brief over-view. Biol. Metals 4:7-13.

14. Gross, R., F. Engelbrecht, and V. Braun. 1984. Genetic andbiochemical characterization of the aerobactin synthesis operonon pColV. Mol. Gen. Genet. 196:74-80.

15. Gross, R., F. Engelbrecht, and V. Braun. 1985. Identification ofthe genes and their polypeptide products responsible for aero-bactin synthesis by pColV plasmids. Mol. Gen. Genet. 201:204-212.

16. Hedrick, J. L., and A. J. Smith. 1968. Size and charge isomerseparation and estimation of molecular weights of proteins bydisc gel electrophoresis. Arch. Biochem. Biophys. 126:155-164.

17. Herrero, M., V. deLorenzo, and J. B. Neilands. 1988. Nucleotidesequence of the iucD gene of the pColV-K30 aerobactin operonand topology of its product: studies with phoA and lacZ genefusions. J. Bacteriol. 170:56-64.

18. Konopka, K., A. Bindereif, and J. B. Neilands. 1982. Aerobac-tin-mediated utilization of transferrin iron. Biochemistry 21:6503-6508.

19. Kuo, D. J., and F. Jordan. 1983. Active site directed irreversibleinactivation of brewers' yeast pyruvate decarboxylase by theconjugated substrate analogue (E)-4-(4-chlorophenyl)-2-oxo-3-butenoic acid: development of a suicide substrate. Biochemistry22:3735-3740.

20. Kyte, J., and R. F. Doolittle. 1982. A simple method for

displaying the hydropathic character of a protein. J. Mol. Biol.157:105-132.

21. Laemmli, U. K. 1970. Cleavage of structural proteins during theassembly of the head of bacteriophage T4. Nature (London)227:680-685.

22. Lineweaver, H., and D. BurL 1934. The determination ofenzyme dissociation constants. J. Am. Chem. Soc. 56:658-666.

23. Marolda, C. L., J. Welsh, L. Dafoe, and M. A. Valvano. 1990.Genetic analysis of the 07-polysaccharide biosynthesis regionfrom the Escherichia coli 07:K1 strain VW187. J. Bacteriol.172:3590-3599.

24. Murray, G. J., G. E. D. Clark, M. A. Parniak, and T.Viswanatha. 1977. Effect of metabolites on 6-N-hydroxylysineformation in cell-free extracts of Aerobacter aerogenes 62-1.Can. J. Biochem. 55:625-629.

25. Parniak, M. A., G. E. D. Jackson, G. J. Murray, and T.V'iswanatha. 1979. Studies on the formation of N6-hydroxylysinein cell-free extracts of Aerobacter aerogenes 62-1. Biochim.Biophys. Acta 569:99-108.

26. Plattner, H. J., P. Pfefferle, A. Romanguera, S. Waschutza, andH. Diekmann. 1989. Isolation and some properties of lysineN6-hydroxylase from Escherichia coli strain EN222. Biol. Met-als 2:1-5.

27. Read, S. M., and D. H. Northcote. 1981. Minimisation ofvariation in response to different proteins of the Coomassie blueG dye-binding assay for protein. Anal. Biochem. 116:53-64.

28. Reeves, R. H., and J. Roth. 1971. A recessive UGA suppressor.J. Mol. Biol. 56:523-533.

29. Szczepan, E. W., G. E. D. Jackson, B. J. Gnndy, and T.Viswanatha. 1986. Interrelationship between pyruvate metabo-lism and aerobactin production in a cell-free system of Aer-obacter aerogenes 62-1. FEMS Microbiol. Lett. 34:27-30.

30. Szczepan, E. W., D. Kaller, J. F. Honek, and T. Viswanatha.1987. Direct evidence for the participation of pyruvate inN-hydroxylation of lysine. FEBS Lett. 211:239-242.

31. Valvano, M. A., and J. H. Crosa. 1984. Aerobactin iron trans-port genes commonly encoded by certain ColV plasmids occurin the chromosome of a human invasive strain of Escherichiacoli Kl. Infect. Immun. 46:159-167.

32. Valvano, M. A., R. P. Silver, and J. H. Crosa. 1986. Occurrenceof chromosome- or plasmid-mediated aerobactin iron transportsystems and hemolysin production among clonal groups ofhuman invasive strains of Escherichia coli Kl. Infect. Immun.52:192-199.

33. Viswanatha, T., E. W. Szczepan, and G. J. Murray. 1987.Biosynthesis of aerobactin: enzymological and mechanisticstudies, p. 117-132. In J. B. Neilands, D. Vander Helm, and J.Winkelmann (ed.), Iron transport in microbes, plants and ani-mals. Springer-Verlag, New York.

34. Von HeUne, G. 1988. Transcending the impenetrable: howproteins come to terms with membranes. Biochim. Biophys.Acta 947:307-333.

35. Waters, V. L., and J. H. Crosa. 1986. DNA environment of theaerobactin iron uptake system genes in prototypic ColV plas-mids. J. Bacteriol. 167:647-654.

36. Williams, P. H. 1979. Novel iron uptake system specified byColV plasmids: an important component in the virulence ofinvasive strains of Eschenichia coli. Infect. Immun. 26:925-932.

37. Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. ImprovedM13 phage cloning vectors and host strains: nucleotide se-quences of the M13mpl8 and pUC19 vectors. Gene 33:103-119.

J. BACTERIOL.

on February 1, 2020 by guest

http://jb.asm.org/

Dow

nloaded from