Journal of NeurochemistryRaven Press, Ltd., New YorkC 1994 International Society for Neurochemistry

Cyclic AMP Decreases the Expression of a Neuronal Marker(GAD6 ) and Increases the Expression of an

Astroglial Marker (GFAP) in C6 Cells

*José Segovia, *George M . Lawless, *Niranjala J . K. Tillakaratne,tMichael Brenner, and *$§Allan J . Tobin

*Department of Biology, $Molecular Biology Institute, and §Brain Research Institute, University of California,Los Angeles, Los Angeles, California and tStroke Branch, National Institute ofNeurological

Disorders and Stroke, NIH, Bethesda, Maryland, U.S.A .

Abstract: C6 cells express proteins and mRNAs that arecharacteristic of both glia and neurons . Agents that in-crease intracellular levels of cyclic AMP (cAMP) decreasethe enzymatic activity of glutamate decarboxylase (GAD),a neuronal marker, and the mRNA levels for one of thetwo GAD isoenzymes, GAD6 , . This reduction is accompa-nied by increased levels of glial fibrillary acidic protein(GFAP) mRNA, an astrocyte marker. Transient transfec-tion assays, in which a 2-kb upstream regulatory regionof the human GFAP gene was linked to a reporter gene,indicate that at least some of the cAMP-mediated in-crease of GFAP mRNA levels is due to increased tran-scription . Increases in intracellular cAMP appear to in-duce differentiation of C6 cells toward a more matureastrocyte phenotype . Key Words: cAMP-Glutamatedecarboxylase-Glial fibrillary acidic protein-C6 cells-Differentiation-Transcription -mRNA.J . Neurochem. 63,1218-1225 (1994) .

The limiting enzyme of GABA synthesis is gluta-mate decarboxylase (GAD, EC 4.1 .1 .15) . Two genes,GAD6, and GAD65 , encode GAD isoenzymes that dif-fer in sequence, size, intracellular localization, and reg-ulation . Both GAD6, and GAD65 proteins are presentin rodent and human brain (Erlander et al ., 1991 ; Erlan-der and Tobin, 1991 ; Bu et al ., 1992) . GAD gene ex-pression varies during development, and in the matureCNS is responsive to manipulations of synaptic inputs(Feldblum et al ., 1990 ; Segovia et al ., 1990, 1991a ;Greif et al., 1991, 1992; Soghomonian et al ., 1992) .Several of these responses suggest that GAD6, tran-scription is stimulated by cyclic AMP (cAMP) . Forexample, cAMP increases GAD activity in the preopticarea and hippocampus of adult rats (Munaro and Ta-leisnik, 1992) . In addition, striatal GAD6, mRNA ischanged by pharmacological treatments with drugs thataffect intracellular cAMP levels . For example, the Dtreceptor increases cAMP levels, and antagonists to this

1218

receptor decrease striatal GAD6, mRNA levels . Con-versely, agonists of the DZ receptor, which inhibitsadenylate cyclase, reduce GAD67 mRNA levels,whereas DZ antagonists increase its levels (Caboche etal ., 1991, 1992; Chen and Weiss, 1993) . Moreover,destruction of the dopaminergic input induces an in-crease of GAD67 mRNA in the striatum (Vernier et al .,1988 ; Segovia et al ., 1990) .To study the regulation of GAD transcription by

cAMP in greater detail, we used the C6 rat neurogli-oma cell line . This cell line was selected for threereasons : (a) it expresses GAD67 mRNA, has GAD ac-tivity, and synthesizes GABA (Wilson et al ., 1972 ;Schrier and Thompson, 1974 ; Tillakaratne and Tobin,1986 ; Bond et al ., 1990), (b) it has been employedextensively to study changes in gene expression inresponse to different stimuli (Kumar et al ., 1984, 1986 ;Mochetti et al ., 1989), and (c) it is known to exhibitstrong morphological changes in response to increasesin intracellular levels of cAMP (Sharma and Raj,1987) . Alterations in chromatin structure after dibu-tyryl cAMP (dbcAMP) treatments suggest that changesin gene expression contribute to these processes (Mareset al ., 1991) .

Our results show a marked decrease of GAD activityand mRNA levels for GAD6,, and increased transcrip-tion of the glial fibrillary acidic protein (GFAP) genein C6 cells in response to increased intracellular levelsof cAMP. Taken together, these results suggest that

Received October 6, 1993 ; revised manuscript received December9, 1993 ; accepted February 2, 1994 .

Address correspondence and reprint requests to Dr . A . J . Tobinat Department of Biology, University of California, Los Angeles,405 Hilgard Avenue, Los Angeles, CA 90024-1606, U.S.A .

Abbreviations used : 6-AR, 6-adrenergic receptor ; cAMP, cyclicAMP ; dbcAMP, dibutyryl cAMP; CAT, chloramphenicol acetyl-transferase ; GAD, glutamate decarboxylase ; GFAP, glial fibrillaryacidic protein ; PCR, polymerase chain reaction ; RT, reverse tran-scriptase .

cAMP induces the differentiation of C6 cells towarda more astrocytic phenotype.

Parts of this work have been presented previouslyin abstract form (Segovia et al ., 1991b; Lawless et al .,1992) .

MATERIALS AND METHODS

Cell cultureC6 cells (C62BD) were obtained from Dr . Jean de Vellis

(University of California, Los Angeles, CA, U.S.A .) . Pas-sages 17-22 were used for these experiments . Cells weregrown in 45% Dulbecco's modified Eagle's medium, 45%Ham's F-12, 10% fetal bovine serum, and I % (vol/vol) peni-cillin-streptomycin (GIBCO). Cells were maintained at37°C in 5% COz at nearly 100% humidity . A second line ofC6 cells (CCL 107) was obtained from ATCC and grownin 82.5% Ham's F-10, 15% horse serum, and 2.5% fetalbovine serum, under the conditions described above. Unlessstated otherwise, all experiments used the C62BD line .

TreatmentsWhen cells nearly reached confluency (^-80-85%), fresh

medium was added and drugs were applied 30 min later .dbcAMP and butyric acid were dissolved in double-distilledwater and added to a final concentration of 1 mM. Forskolinand 1,9-dideoxyforskolin (a forskolin analogue without ade-nylate cyclase stimulatory properties) were dissolved in etha-nol and added to a final concentration of 50 pM. Two addi-tional controls were used : one was the addition of the samevolume of vehicle (ethanol or water) and the other was noaddition at all. Maximal ethanol concentration in the culturemedium was 0.1% (voUvol) . Isoproterenol and propranolol(HCI) were dissolved in water and added to a final concentra-tion of 10 MM. All compounds were obtained from SigmaChemical Co .

Cell harvestingAt different times after the addition of drugs, medium was

removed by aspiration and cells were detached from the flaskby incubation with a diluted trypsin-EDTA solution for 3min at 37°C . Cells were centrifuged and washed three timeswith phosphate-buffered saline . The final pellet was kept at-70°C until biochemical or northern analysis was per-formed .

GAD assayCells were homogenized in a phosphate buffer (pH 6.5)

that contained saturating concentrations of pyridoxal phos-phate and glutamate with 1-'°C-labeled glutamic acid (NENResearch). Cells were incubated for 30 min at 37°C andthe evolved ' °COZ was collected and counted, as describedpreviously (Segovia et al ., 1989). Proteins were measuredaccording to the method of Bradford (1976) .

cAMP assaycAMP concentrations were measured using a commercial

kit, according to the manufacturer's instructions (Amersham,Trk 430) .

RNA preparationTotal cellular RNA was isolated from frozen powdered

rat brain tissue and cell pellets by the CsCl gradient methodof Chirgwin et al . (1979), or from dishes of C6 cells usingthe acid guanidium thiocyanate/phenol/chloroform method

NEURONAL AND GLIAL MARKERS IN C6 CELLS 1219

of Chomczynski and Sacchi (1987) with the variations de-scribed by Xie and Rothblum (1992) .

Northern blot analysisRNA was denatured in 50% formamide and 5.9% formal-

dehyde, separated by electrophoresis (10 pg per lane) in a1 % agarose gel containing 5.9% formaldehyde, and trans-ferred to Bio Trans (ICN) membranes. Filters were bakedat 80°C for 2 h. For GAD6,, 12p-labeled GAD6 , antisensetranscripts were made from in vitro transcription of Sal Ilinearized template of rat GAD cDNA clone #l4 (3.2-kbinsert) using T3 RNA polymerase . Mouse GFAP cDNA wasobtained from N. Cowan and rat ribosomal DNA from D.Chikaraishi . GFAP and ribosomalDNA probes were labeledwith 32p using the random-primed oligonucleotide procedureof Feinberg and Vogelstein (1984) . After hybridization withGAD67 cRNA, filters were washed and exposed to film at-70°C. After exposure to film, blots were stripped and rehy-bridized with ribosomal DNA probe. For some experiments,the blots were reprobed with GFAP cDNA. After autoradiog-raphy, the x-ray films were analyzed using a Bio-Rad densi-tometer. The values obtained for the GAD67 and GFAPprobes were adjusted to account for differences in RNAconcentrations in each lane using the values obtained fromthe ribosomal probe.

cDNA synthesisTotal RNA (10 pg) plus 3.125 U of random hexamer

(Pharmacia) were annealed by addition of 10 mMCH3HgOH, then added to 1 X reverse transcriptase (RT)buffer (provided by the manufacturer, BRL), 2 mM dNTP,0.01 M dithiothreitol, and 400 U of Moloney murine leuke-mia virus RT (BRL) in a total volume of 500 pl . For quanti-fication, 4.5 MI of the reaction solution was removed andmixed with 0.5 pl of ["P]dCTP . The reaction mixtures wereincubated in parallel at 37°C for 2 h. cDNA was quantitatedby passing the labeled reaction mixture through a NICKcolumn (Pharmacia) to remove the free from the incorpo-rated ["P]dCTP, followed by scintillation counting.

Polymerase chain reaction (PCR)cDNA (10-50 ng) was added directly to 50-100 pmol

of the primers in a final volume of 100 MI of 1 X PCR bufferthat contained 250 nM of each dNTP . The reaction mixturewas boiled for 5 min, then allowed to cool to 80°C . Taqpolymerase (0 .5 U ; Perkin Elmer Cetus) was added, a min-eral oil overlay was applied, and samples were placed in aCoy Thermal Cycler . Samples were allowed to anneal at55°C for 1 min, extended at 72°C for 1 min, and denaturedat 94°C for 1 min. Between 24 and 40 cycles were run.After PCR, theDNAproducts were electrophoresed on 1 .2%agarose gels and stained with ethidium bromide. Oligonucle-otide sequence and location of the primers with respect tothe initiation of translation were as follows: forGAD6,, 5' oligonucleotide TCCAACCTGTTTGCTCAA-GATCTGCTTCCA, corresponding to bases 282-311 and3' oligonucleotide TTTTTGCCTCTAAATCAGCTGGAA-TTATCT, corresponding to bases 978-949 (Kobayashi etal ., 1987); for GFAP, 5' oligonucleotide GCAGAGATG-ATGGAGCTCAATGACCGCTTT, corresponding to bases121-150 and 3' oligonucleotide GGGACTCGTTTCGTG-CCGCGGAGGGACTCCA, corresponding to bases 826-797 (Lewis et al ., 1984); for 0-actin, 5' oligonucleotideCACCACAGCTGAGAGGGAAATCGTGCGTGA, corres-ponding to bases 603-632 and 3' oligonucleotide ATTTGC-

J. Neurochen., Vol . 63, No . 4, 1994

1220

GGTGCACGATGGAGGGGCCGGACT, corresponding tobases 1,120-1,091 (Nudel et al ., 1983) .

Southern blottingAfter gel electrophoresis, GAD6, PCR products from some

experiments were denatured and transferred to Zeta-probemembranes (Bio-Rad) . The blots were hybridized using a'ZPrat GAD67 cDNA probe labeled and processed as describedbefore .

Chloramphenicol acetyltransferase (CAT)constructspGfaCAT-4 contains sequences from -2,163 to +88, with

respect to the transcription start site (+1), of the humanGFAP gene, linked to a CAT reporter gene . The details ofthe construction of this vector are described in Besnard etal. (1991) . pCAT-basic and pCAT-control were obtainedfrom Promega .

TransfectionsTransfections were performed using the calcium phos-

phate coprecipitation method. Dishes (60 mm) containing1 .5 X 10 6 cells were plated 24 h before transfection with 20yg of pGfaCAT-4 plasmid, pCAT-control, or pCAT-basic .Cells were grown 72 h after transfection, and then treatmentswere performed .

CAT assayCells were lysed in 150 MI of 0.25 M Tris-HCl, pH 8.0,

by three cycles of freeze-thaw . The endogenous CAT en-zyme was inactivated by incubation at 60°C for 10 min . Theassays were initiated by adding 0.125 PCi of [' 4C]-chloramphenicol (NEN Research), 25 pg of n-butyryl coen-zyme A, and 50 ul of cell extract in a final volume of 125p1 . The assays were incubated for 5 h . Xylene was added tostop the reactions and to extract the n-butyryl chlorampheni-col that was mixed with scintillant for direct counting, asdescribed by Seed and Sheen (1988) .

J. Neurochem ., Vol . 63, No . 4, 1994

RESULTS

Effects of cAMP on GAD enzyme activity andGAD,,, mRNA

Treatments with dbcAMP, forskolin, and isoprotere-nol lead to elevated cAMP levels in C6 cells . dbcAMPis a cAMP analogue known to elevate the intracellular

J. SEGOVIA ET AL.

FIG. 1 . GAD activity in C6 cells treatedwith 1 mM dbcAMP or 1 mM butyric acidas control (A) or treated with 50 pM for-skolin or ethanol as control (B). Time oftreatment is indicated. Bars represent themeans -_ SEM of two to four independentexperiments. .p < 0.05, compared withcontrol (t test).

CAMP levels in C6 cells . Forskolin directly stimulatesadenylate cyclase, inducing a large but transient in-crease in intracellular cAMP (Seamon et al ., 1981) .lsoproterenol stimulates the adenylate cyclase via 0-adrenergic receptors (,8-AR), which are known to befunctional on C6 cells (Valeins et al ., 1988) .

There was no effect on GAD activity when C6 cellswere grown in the presence of dbcAMP for 24 h, butafter 72 h of treatment GAD activity was reduced to60% of control levels . Forskolin treatment provedmore potent, reducing GAD activity to 22% of that ofcells treated with vehicle (ethanol) alone after only 24h of treatment (Fig . 1) .

Northern blot analysis revealed the presence ofGAD6, mRNA in control C6 cells (Fig . 2), but GAD65was not detected (data not shown) . A marked reductionin GAD6, mRNA was observed 24 and 72 h after for-skolin and dbcAMP treatments, respectively (Fig . 2) .Similar results were obtained when C6 cells fromATCC were used (data not shown) . Consistent with

FIG. 2. GAD67 mRNA detection by northern blotting . A: Effectof forskolin . C6 cells were treated for 24 h with either 50 pMforskolin (lanes 1 and 2) or ethanol (lanes 3 and 4) . B: Effect ofdbcAMP . C6 cells were treated for 72 h with either 1 mMdbcAMP (lane 1) or 1 mM butyric acid (lane 2) . Densitometricanalysis of the autoradiograms showed, in the forskolin experi-ment, a reading of 0.385 ± 0.085 arbitrary units for the controlcells and 0.008 ± 0.002 arbitrary units for the forskolin-treatedcells. In the dbcAMP experiment, the results were 0.560 arbitraryunits for the control cells and 0.100 arbitrary units for thedbcAMP-treated cells.

FIG . 3 . Effect of forskolin on GAD67 and GFAP mRNA levels inC6 cells. Northern analyses were performed on mRNA isolatedfrom C6 cells treated with either 50 yM forskolin (lanes 1 and 2)or 50 MM 1,9-dideoxyforskolin (lanes 3 and 4) . A: Probe was forGAD67 mRNA . B: Probe was for GFAP mRNA. Densitometricanalysis of the autoradiograms gave values of 0.625 ± 0.165arbitrary units for GAD67 mRNA in the 1,9-dideoxyforskolin-treated cells and 0.07 arbitrary units in the forskolin-treated cells .For GFAP, the 1,9-dideoxyforskolin-treated values were belowdetection limits and the cells treated with forskolin gave a valueof 0.070 ± 0.01 arbitrary units .

the GAD activity results, the decrease of GAD67mRNA was greater in forskolin-treated cells than indbcAMP-treated cells .

Because the effects of forskolin on GAD67 mRNAlevels and GAD activity in C6 cells were greater thanthose elicited by dbcAMP, forskolin was used for theremainder of the experiments . We confirmed that for-skolin induced a 30-fold increase in intracellular cAMPwithin 15 min of application in C6 cells (data notshown) .

Effect of cAMP on GFAP expressionThe observation that increased cAMP levels in C6

cells resulted in a decrease in GAD67 mRNA levelssuggested that these cells may be differentiating to amore glial-like phenotype . To test this hypothesis, weanalyzed the effect of forskolin on the mRNA forGFAP, an astroglial marker . Using northern blot analy-sis, we detected no GFAP mRNA in control cellstreated with 1,9-dideoxyforskolin ; however, a signalwas easily detected after forskolin stimulation (Fig . 3) .

Changes in rnRNA levels detected with RT-PCRBecause GAD67 and GFAP mRNAs are rare in C6

cells, we used RT-PCR for the remainder of our experi-ments . Several steps were taken in these experimentsto maximize reproducibility . The cDNA produced inthe RT reactions was quantitated so that an equalamount would be present in each reaction, and its tem-plate activity was confirmed in every experiment byperforming a parallel PCR reaction to detect a 0-actinfragment . This control also served as a check on PCRreagents and conditions in each experiment . In addi-tion, each experiment included a positive control ofadult rat brain cDNA, which served also to mark theappropriate size of the PCR product, and a negativecontrol, which contained no added cDNA template .False positives due to possible contamination of the

NEURONAL AND GLIAL MARKERS IN C6 CELLS

FIG . 4. Southern blot analysis ofGAD67 RT-PCR products . Wholerat brain (lane 1) ; C6 cells treatedfor 24 h with either 50 pM for-skolin (lanes 2 and 3) or 50 pM1,9-dideoxyforskolin (lanes 4 and5) ; C6 cells with no treatment(lane 6) .

1221

RNA preparations with genomic DNA were avoidedby using primer pairs that flanked one or more introns .When RT-PCR was performed in C6 cells treated withforskolin and 1,9-dideoxyforskolin, forskolin wasfound to produce a dramatic decrease of GAD67mRNA. We performed a Southern blot of the GAD67products and hybridized them with a GAD67 cDNAprobe to ensure further the specificity of the RT-PCRassays (Fig . 4) . These results are consistent with ourprevious findings using northern analysis and validatethe usefulness and accuracy of RT-PCR studies in thissystem .

Kinetics of cAMP-mediated effectsBecause GFAP and GAD67 mRNAs were difficult

to detect in control and forskolin-treated cells, respec-tively, we used the more sensitive RT-PCR techniqueto follow the time course of their changes followingtreatment with forskolin . In contrast to northern blotanalysis, basal levels of GFAP mRNA were clearlyvisible using RT-PCR. No increase in GFAP mRNAwas evident by 6 h, but after 24 h offorskolin treatmenta clear increase had occurred (Fig . 5) . GAD67 mRNAlevels remained relatively constant up to 3 h after for-skolin addition, but began to decrease by 6 h . Thesignal had almost disappeared after 24 h of forskolin .

FIG . 5. GAD67 , GFAP, and 0-actin mRNA detection by RT-PCRanalysis . A: GAD67 mRNA levels in C6 cells treated with 50 pMforskolin for 15 min (lane 1), 30 min (lane 2), 1 h (lane 3), 3 h(lane 4), 6 h (lane 5), or 24 h (lane 6) ; C6 cells treated with ethanolfor 0 min (lane 7), 1 h (lane 8), 6 h (lane 9), or 24 h (lane 10) ;whole rat brain (lane 11) . B : GFAP mRNA levels, same conditionsas in A . C: Q-Actin mRNA levels, same conditions as in A. Onerepresentative experiment of two independent experiments isshown .

J. Neurochem., Vol . 63, No . 4, 1994

1222

FIG . 6 . GAD67 and GFAP mRNA detection by RT-PCR analysis .A: GAD67 mRNA levels in C6 cells treated for 24 h with ethanol(lane 1), 10 yM isoproterenol (lane 2), 10 pM propranolol (lane3), 50 pM forskolin (lane 4), 10 yM isoproterenol plus 50 pMforskolin (lane 5), 10 yM isoproterenol plus 10 pM propranolol(lane 6) ; whole rat brain (lane 7) . B : GFAP mRNA levels, sameconditions as in A . One representative experiment of two inde-pendent experiments is shown .

The RT-PCR analysis revealed two close but distinctbands of GAD67 products when RNA from C6 cellswas used, whereas only the predicted 696-bp productwas obtained from adult rat tissue that was used ascontrol (Figs . 5 and 6) .We also used RT-PCR to detect GAD65 mRNA,

which could not be seen in northern blot analysis . Afaint signal was observed by RT-PCR, which did notchange after 24 h of forskolin treatment (data notshown) .

Effect of /3-receptor agents on GAD67 and GFAPmRNAsWe evaluated the effect of agents that act on the ß-

AR to modify the levels of GAD67 and GFAP mRNAsin C6 cells . Isoproterenol, a ß-AR agonist, at 10 uM,reduced GAD67 mRNA levels, whereas propranolol, a,ß-AR antagonist, at the same concentration, had noeffect on GAD67 or GFAP mRNAs . When isoprotere-nol and forskolin were applied together, the same trendof GAD67 mRNA decrease was observed in two inde-pendent experiments . Isoproterenol was also effectivein increasing GFAP mRNA levels in C6 cells (Fig. 6) .It appears that propranolol at the low concentrations weused in these experiments is not capable of completelyblocking the isoproterenol-induced effects ; others havereported that propranolol blocked isoproterenol-in-duced effects in C6 cells when a much higher (10-fold) concentration was used (Mochetti et al ., 1989) .

Effect of increased levels of cAMP on GFAPtranscription

Transient transfection with a GFAP-CAT reporterplasmid was used to determine whether the effect ofcAMP on GFAP mRNA levels was due to stimulationof transcription . The test plasmid was pGfaCAT-4(Besnard et al ., 1991), which contains 2,251 by fromthe 5' region of the human GFAP gene linked to aCAT reporter gene . This GFAP segment confers cell-specific expression in both cultured cells (Besnard et

J. Neurochem ., Vol. 63, No. 4, 1994

J. SEGOVIA ET AL.

al., 1991) and transgenic mice (Brenner et al ., 1994) .Transfected cells were treated for 24 h with forskolinor vehicle (ethanol) and CAT activity was measured .The forskolin treatment increased CAT activity aboutthreefold (Fig . 7) . As positive and negative controls,C6 cells were also transfected with pCAT-control,which contains the CAT gene directed by the highlyactive SV40 promoter and enhancer, and pCAT-basic,which contains no promoter or enhancer . pCAT-con-trol yielded very high CAT activities and pCAT-basicvery low ones, and these levels were not significantlyaffected by treatment with forskolin (Fig . 7) . Addi-tional controls showed that the stimulation by forskolinof CAT activity was not dependent on the transfectionprocedure ; a similar two- to threefold induction ofCAT activity was observed when lipofection or elec-troporation was used instead of calcium phosphate pre-cipitation .

DISCUSSION

Because C6 cells show low but significant levelsof GAD67 mRNA and GAD activity, they provide anopportunity to study the regulation of the GAD67 genein a cell culture system (Wilson et al ., 1972 ;Tillakaratne and Tobin, 1986 ; Bond et al ., 1990) . C6cells respond to increases in intracellular cAMP withbiochemical and morphological changes, which in-clude alterations of chromatin structure suggestive ofa differentiation process (Sharma and Raj, 1987 ; Mareset al ., 1991) .

Regulation of GAD expressionWe report here that intracellular increases in cAMP

induce a dramatic decrease of GAD67 mRNA levels

FIG . 7 . CAT activity in C6 cells . C6 cells were transientlytransfected with 20 Ilg of pGfaCAT-4 or pCAT-control andtreated with ethanol or 50 N,M forskolin for 24 h . Bars representmeans ± SEM of four independent experiments . 'p < 0.05, com-pared with ethanol (t test) . CAT activity was measured in non-transfected C6 cells treated with either ethanol or 50 N,M forskolinand in C6 cells transfected with pCAT-basic and treated witheither ethanol or forskolin . No differences were found among thefour groups for CAT activity ; therefore, that value was used aszero .

and of GAD activity in C6 cells . These decreases wereobserved after increases in cAMP were produced bydbcAMP, a cAMP analogue, by forskolin, a compoundthat directly stimulates adenylate cyclase, and by iso-proterenol, a ß-AR agonist. These results indicate thatthe effect on GAD67 mRNA is a consequence of in-creasing intracellular cAMP levels in C6 cells .A minor, alternatively spliced form of GAD6,

mRNA has been observed in C6 cells and in embryonicrat brain, but not in adult rat brain (Bond et al ., 1990) .This minor mRNA is slightly larger than the primary(3.7 kb) form due to failure to splice out an 86-bpsegment . As this fragment contains an in-frame stopcodon, the protein encoded by the larger mRNA istruncated and inactive (Bond et al ., 1990) . Northernblot analysis is unable to resolve the two species ofGAD6, mRNA, but the RT-PCR analysis identified aminor second band whose greater size is that predictedfor the larger mRNA. As expected, this band was notseen in RT-PCR of adult rat brain mRNA. The pres-ence of alternative splicing, the low levels of GAD65mRNA, and the expression of GFAP suggest that C6cells may represent a neuroglial precursor at an earlydevelopmental stage at which both neuronal and glialcharacteristics are expressed .

Decreases in GAD6, mRNA levels and GAD activityoccurred in parallel in C6 cells . Parallel increases inGAD6, mRNA, GAD activity, and GAD protein con-tent have been observed in adult rats in response tolesions (Litwak et al ., 1990 ; Segovia et al ., 1990,1991c; Soghomonian et al ., 1992) . These results sug-gest there is a close relation between the levels ofGAD6, mRNA and the synthesis and/or functional ca-pacity of the enzyme . GABA itself, however, has beenreported to regulate GAD6, protein at a posttranscrip-tional level, through either translation or protein stabil-ity (Rimvall and Martin, 1992 ; Rimvall et al ., 1993) .The presence of GAD65 mRNA or GAD65 protein

has only been reported, to our knowledge, in two celllines, the P-19 embryonal carcinoma line (Bain et al .,1993) and 8TC-3, a pancreatic cell line (Reetz et al .,1991) . GAD65 mRNA levels in P-19 cells were re-ported to be low in basal conditions ; however, a con-siderable increase was observed when the cells weredifferentiated by the addition of retinoic acid (Bain etal., 1993) . In addition, we have analyzed a wide varietyof immortalized neural cells and have not been ableto detect GAD65 mRNA (Chugani et al ., 1992) . GAD65mRNA also appears later in development than GAD6,mRNA, and it follows a temporal course that coincideswith synapse formation, suggesting that the expressionofGAD65 occurs at a later stage ofneuronal differentia-tion (Greif et al ., 1991, 1992) . Moreover, GAD6, andGAD65 mRNA changes follow different patterns in re-sponse to lesions in the adult rat (Soghomonian andChesselet, 1992 ; Soghomonian et al ., 1992) . These re-sults, together with the low levels of GAD65 mRNAin C6 cells and the apparent lack of effect of increasedlevels of CAMP on GAD65 mRNA, suggest that GAD6,

NEURONAL AND GLIAL MARKERS IN C6 CELLS 1223

and GAD65 gene expression are controlled by differentmechanisms .

cAMP regulates GAD differently in C6 cells thanin adult brainAs discussed in the introductory section, several ob-

servations have implicated cAMP in the stimulation ofGAD67 gene activity in the brain of adult rats . There-fore, our finding that in C6 cells increased intracellularcAMP reduced the levels of GAD6, mRNA suggeststhat GAD regulation in C6 cells differs from that inthe adult brain . We suggest that the major effect ofCAMP in C6 cells is to switch the cell phenotype froma bipotential neuroglial precursor to a more astrocyticform . Cell type-specific silencer elements have beendescribed recently (Mori et al ., 1992 ; Li et al ., 1993),and it is conceivable that a similar mechanism couldrepress the transcription of the GAD6, gene as the C6cells shift toward a more glial phenotype .

cAMP stimulates the transcription of the GFAPgene in C6 cellsThe proposal that the decrease in GAD6, gene activ-

ity is due to cAMP stimulating a more astrocytic differ-entiation of C6 cells is supported by our observationthat the level of GFAP mRNA is increased . A cAMP-induced increase in GFAP mRNA levels has been re-ported previously for C6 cells (Lawless et al ., 1992 ;Messens and Slegers, 1992), astrocytic cell lines, andcultures of primary astrocytes (Shafit-Zagardo et al .,1988 ; Le Prince et al., 1991 ; Murphy et al ., 1993) .Only one previous study has examined the mechanismunderlying the increased level of GFAPmRNA. Usingnuclear "run-on" assays, Shafit-Zagardo et al . (1988)concluded that the elevation in GFAP mRNA was dueentirely to posttranscriptional control . However, theresults we present here, using a CAT reporter genedriven by 2.2 kb of GFAP 5' upstream genomic DNAthat contains the sequences necessary to direct celltype-specific transcription of the GFAP gene (Besnardet al ., 1991 ; Masood et al ., 1993 ; Brenner et al ., 1994),show that increased transcription clearly occurs . Al-though the mechanisms by which cAMP elevates genetranscription remain to be determined, it is noteworthythat the 5' upstream region contains a potential cAMPresponse element (Brenner et al ., 1990) as well as afunctional AP-1 site (Masood et al., 1993) .

In conclusion, the results presented here suggest thatincreases in intracellular cAMP induce the differentia-tion of C6 cells toward a more astrocytic phenotype,a process reflected in the disappearance of GAD6,mRNA and the increased expression of GFAP mRNA.This is, to our knowledge, the first demonstration thatGAD mRNA levels change in response to direct ma-nipulation of a second messenger, and that cAMP ele-vates GFAP mRNA by increasing the rate of GFAPtranscription . These findings suggest that C6 cells maybe valuable for studies of interaction of transactingregulatory factors with the GAD6, and GFAP genes .

J. Neurochem., Vol. 63, No. 4, 1994

1224

Acknowledgment: This work was supported by grantsfrom The Scottish Rite Schizophrenia Research Program(J.S . and A.J.T.) and NINDS grant NS22256 (A.J.T.) .

REFERENCES

Bain G ., Ramkumar T . P., Cheng J. M ., and Gottlieb D . 1 . (1993)Expression of the genes coding for glutamic acid decarboxylasein pluripotent cells. Mol. Brain Res . 17, 23-30 .

Besnard F ., Brenner M., Nakatani Y., Chao R ., Purohit H . J ., andFreese E . (1991) Multiple interacting sites regulate astrocyte-specific transcription of the human genefor glial fibrillary acidicprotein. J. Biol. Chem. 266, 18877-18883 .

Bond R . W., Wyborski R . J., and Gottlieb D . I . (1990) Developmen-tally regulated expression of an exon containing a stop codonin the gene for glutamic acid decarboxylase . Proc . Nall . Acad.Sci. USA 87, 8771-8775 .

Bradford M. M . (1976) A rapid and sensitive method for the quanti-tation of microgram quantities of protein utilizing the principleof protein-dye binding . Anal. Biochem. 72, 248-254.

Brenner M., Lampel K ., Nakatani Y ., Mill J ., Banner C ., MearowK ., Dohadwala M., Lipsky R., and Freese E . (1990) Character-ization of human cDNA and genomic clones for glial fibrillaryacidic protein . Mol. Brain Res. 7, 277-286 .

Brenner M., Kisseberth W. C ., Su Y ., Besnard F ., and Messing A .(1994) GFAP promoter directs astrocyte-specific expression intransgenic mice . J. Neurosci . 14, 1030-1037 .

Bu D.-F ., Erlander M . G ., Hitz B . C ., Tillakaratne N . J . K ., KaufmanD . L., Wagner-McPherson C . B ., Evans G . A ., and Tobin A . J .(1992) Two human glutamate decarboxylases, 65-kDa and 67kDa GAD, are each encoded by a single gene . Proc. Natl. Acad.Sci . USA 89, 2115-2119 .

Caboche J ., Vernier P ., Julien J .-F ., Rogard M., Mallet J ., and BessonM.-J . (1991) Parallel decrease of glutamic acid decarboxylaseand preproenkephalin mRNA in the rat striatum followingchronic treatment with a dopaminergic D, antagonist and DZagonist. J. Neurochem. 56, 428-435 .

Caboche J ., Vernier P ., Rogard M., Julien J .-F., Mallet J ., and BessonM.-J . (1992) Role of dopaminergic D, receptors in the regula-tion of glutamic acid decarboxylase messenger RNA in thestriatum of the rat. Eur. J. Neurosci . 4, 438-447 .

Chen J . F. and Weiss B . (1993) Irreversible blockade ofDZ dopaminereceptor by fluphenazine-N-mustard increases glutamate decar-boxylase mRNA in rat striatum . Neurosci . Lett. 150, 215-218 .

Chirgwin J . M., Przybyla A . E ., and Rutter W . J. (1979) Isolationof biologically active ribonucleic acid from sources enriched inribonuclease . Biochemistry 18, 5294-5299 .

Chomczynski P . and Sacchi N. (1987) Single-step method of RNAisolation by acid-guanidinium thiocyanate-phenol-chloroformextraction . Anal. Biochem. 162, 156-159 .

Chugani D . C., Segovia J., Tobin A . J ., Mahmoudi M., and RoseboroH . (1992) Immortalized striatal and mesencephalic cells expressD-2 dopamine receptors and GAD6, . Soc . Neurosci . Abstr. 18,768 .

Erlander M . G . and Tobin A . J . (1991) The structural and functionalheterogeneity of glutamic acid decarboxylase: a review . Neuro-chem. Res. 16, 215-216 .

Erlander M. G ., Tillakaratne N . J. K ., Feldblum S ., Patel N ., andTobin A . J . (1991) Two genes encode distinct glutamate decar-boxylases . Neuron 7, 91-100 .

Feinberg A . P . and Vogelstein B . (1984) A technique for radiola-belling DNA restriction endonuclease fragments to higher spe-cific activity . Anal. Biochem. 137, 266-267 .

Feldblum S ., Ackerman R . F ., and Tobin A . J . (1990) Long-termincrease of glutamate decarboxylase mRNA in a rat model oftemporal rat epilepsy. Neuron 5, 361-371 .

Greif K . F., Erlander M . G ., Tillakaratne N . J . K ., and Tobin A . J .(1991) Postnatal expression of glutamate decarboxylases in de-veloping rat cerebellum. Neurochem. Res . 16, 235-242 .

Greif K . F ., Tillakaratne N. J . K ., Erlander M. G ., Feldblum S ., andTobin A. J. (1992) Transient increase in expression ofglutamate

J. Neurochem ., Vol . 63, No. 4, 1994

J. SEGOVIA ET AL.

decarboxylase (GAD) mRNA during the postnatal developmentof the rat striatum. Dev. Biol. 153, 158-164 .

Kobayashi Y ., Kaufman D. L ., and Tobin A . J . (1987) Glutamicacid decarboxylase cDNA : nucleotide sequence encoding anenzymatically active fusion protein . J. Neurosci. 7, 2768-2772.

Kumar S ., Weingarten D . P., Callahan J. W ., Sachar K., and deVellis J . (1984) Regulation of mRNAs for three enzymes in theglial cell model C6 cell lines . J. Neurochem. 43, 1455-1463 .

Kumar S ., Holmes E ., Scully S ., Birren B . W., Wilson R. H., andde Vellis J. (1986) The hormonal regulation of gene expressionof glial markers : glutamine synthetase and glycerol phosphatedehydrogenase in primary cultures of rat brain and in C6 cells.J. Neurosci. Res. 16, 251-264 .

Lawless G . M ., Segovia J ., Brenner M., and Tobin A . J . (1992)cAMP-mediated transcriptional regulation of gene expressionin C6 cells . Soc. Neurosci. Abstr. 18, 242 .

Le Prince G ., Fages C ., Roland B ., Nunez J ., and Tardy M . (1991)dbcAMP effect on the expression of GFAP and of its encodingmRNA in astroglial primary cultures . Glia 4, 322-326 .

Lewis S. A., Balcarek J. M ., Krek V ., Shelanski M . L ., and CowanN . J . (1984) Sequence of a cDNA clone encoding mouse glialfibrillary acidic protein : structural conservation of intermediatefilaments. Proc. Natl. Acad. Sci. USA 81, 2743-2746 .

Li L ., Suzuki T ., Mori N ., and Greengard P . (1993) Identificationof a functional silencer element involved in neuron-specificexpression of the synapsin I gene. Proc. Natl. Acad Sci. USA90, 1460-1464.

Litwak J ., Mereugliano M., Chesselet M.-F., and Oltmans G . A.(1990) Increased glutamic acid decarboxylase (GAD) mRNAand GAD activity in cerebellar Purkinje cells following lesion-induced increases in cell firing. Neurosci . Lett. 116, 179-183.

Mares V ., Giordano P . A ., Pellicciari C., Scherini E ., Lisâ V., Bot-tone M . G., and Bottiroli G . (1991) Changes in cell cycle andchromatin distribution in C6 glioma cells treated with dibutyrylcyclic AMP . Cell Prolif. 24, 569-577 .

Masood K ., Besnard F ., Su Y., and Brenner M . (1993) Analysis ofa segment of the human fibrillary acidic protein gene that directsastrocyte-specific transcription . J. Neurochem. 61, 160-166 .

Messens J. and Slegers H . (1992) Synthesis of glial fibrillary acidicprotein in rat C6 glioma in chemically defined medium : cyclicAMP-dependent transcriptional and translational regulation . J.Neurochem. 58, 2071-2080.

Mochetti I ., De Bernardi M . A., Szekely A . M ., Alho H ., BrookerG ., and Costa E . (1989) Regulation of nerve growth factorbiosynthesis by /3-adrenergic receptor activation in astrocytomacells : a potential role of c-Fos protein. Proc. Natl. Acad. Sci.USA 86, 3891-3895 .

Mori N ., Schoenherr C ., Vandenbergh D . J ., and Anderson D . J .(1992) A common silencer element in the SCG10 and type IINa' channel binds a factor present in nonneuronal cells but notin neuronal cells . Neuron 9, 45-54.

Munaro N . 1 . and Taleisnik S . (1992) A cyclic AMP mechanismmediates the serotonin-induced increase in glutamic acid decar-boxylase activity in the preoptic area and hypothalamus. J. Neu-rochem . 59, 206-209 .

Murphy G . M ., Jia X.-C ., Yu A . C . H ., Lee Y . L ., Tinklenberg J . R .,and Eng L . F. (1993) Reverse transcription and polymerasechain reaction technique for quantification of mRNA in primaryastrocyte cultures. J. Neurosci. Res. 35, 643-651 .

Nudel U ., Zakut R ., Shani M., Neuman S ., Levy Z., and Yaffe D .(1983) The nucleotide sequence of the rat cytoplasmic )3-actingene. Nucleic Acids Res. 11, 1759-1771 .

Reetz A ., Solimena M., Matteoli M., Folli F., Takei K ., and DeCamilli P. (1991) GABA and pancreatic 6-cells : colocalizationof glutamic acid decarboxylase (GAD) and GABA with synaptic-like microvesicles suggests their role in GABA storage andsecretion. EMBO J. 10, 1275-1284 .

Rimvall K . and Martin D . L . (1992) Increased intracellular y-amino-butyric acid selectively lowers the level of the larger of twodecarboxylase proteins in cultured GABAergic neurons fromrat cerebral cortex . J. Neurochem. 58, 158-166.

Rimvall K ., Sheikh S . N., and Martin D . L. (1993) Effects of in-

creased y-aminobutyric acid levels on GAD67 protein and inmRNA levels in rat cerebral cortex . J. Neurochem . 60, 714-720 .

Schrier B . K . and Thompson E . J . (1974) On the role of glial cellsin the mammalian nervous system . J. Biol. Chem. 249, 1769-1780.

Seamon K . B ., Padgett W., and Daly J . W . (1981) Forskolin : uniquediterpene activator of adenylate cyclase in membranes and inintact cells . Proc . Natl. Acad. Sci. USA 78, 3363-3367 .

Seed B . and Sheen J. Y. (1988) A simple phase reaction assay forchloramphenicol acetyltransferase activity . Gene 67, 271-277.

Segovia J ., Meloni R ., and Gale K . (1989) Effect of dopaminergicdenervation and transplant-derived reinnervation on a markerof striatal GABAergic function. Brain Res . 493, 185-189 .

Segovia J., Tillakaratne N . J . K ., Whelan K ., Tobin A . J ., and Gale K .(1990) Parallel increases in striatal glutamic acid decarboxylaseactivity and mRNA levels in rats with lesions ofthe nigrostriatalpathway. Brain Res . 529, 345-348 .

Segovia J., Castro R ., Notario V ., and Gale K . (1991 a) Transplantsof fetal substantia nigra regulate glutamic acid decarboxylasegene expression in host striatal neurons . Mol. Brain Res . 10,359-362 .

Segovia J., Tillakaratne N . J . K ., and Tobin A . J . (1991b) c-AMPregulates GAD67 gene expression in C6 cells . Soc . Neurosci.Abstr. 17, 381 .

Segovia J ., Armstrong D . M ., Benzing W. C ., and Hornby P . J .(1991c) Striatal glutamic acid decarboxylase immunoreactivityis increased after dopaminergic deafferentation : densitometricanalysis . Neurosci. Lett. 122, 252-256 .

Shafit-Zagardo B ., Kumi-lwaki A ., and Goldman J . E . (1988)

NEURONAL AND GLIAL MARKERS IN C6 CELLS 1225

Astrocytes regulate GFAP mRNA levels by cyclic AMP andprotein kinase C-dependent mechanisms . Glia 1, 346-354 .

Sharma S . K . and Raj A . B . (1987) Transient increase in intracellularconcentration of adenosine 3' :5'-cyclic monophosphate resultsin morphological and biochemical differentiation of C6 gliomacells in culture . J. Neurosci. Res. 17, 135-141 .

Soghomonian J.-J . and Chesselet M.-F. (1992) Effects of nigrostria-tal lesions on the levels of messenger RNAs encoding twoisoforms of glutamate decarboxylase in the globus pallidus andentopeduncular nucleus of rat . Synapse 11, 124-133 .

Soghomonian J .-J., Gonzales C ., and Chesselet M.-F . (1992) Mes-senger RNAs encoding glutamate decarboxylase are differen-tially affected by nigrostriatal lesions in subpopulations of stria-tal neurons . Brain Res. 576, 68-79 .

Tillakaratne N . J . K . and Tobin A . J . (1986) Glutamic acid decarbox-ylase (GAD) messenger RNA in brain and peripheral tissues ofrats . Soc. Neurosci. Abstr. 12, 1458 .

Valeins H ., Volker T., Viratelle O ., and Labouesse J . (1988) Aquenched-flow study of a receptor-triggered second messengerresponse : cyclic AMP burst elicited by isoproterenol in C6glioma cell membranes . FEES Lett. 226, 331-336 .

Vernier P., Julien J .-F ., Rataboul P ., Fourrier O., Feuerstein C ., andMallet J . (1988) Similar time course changes in striatal levelsof glutamic acid decarboxylase and proenkephalin mRNA following dopaminergic deafferentation in the rat . J. Neurochem.51, 1375-1380 .

Wilson S . H ., Schrier B . K., Farber J . L ., Thompson E . J ., BlumeA . J ., and Nirenberg N . (1972) Markers for gene expression incultured cells from the nervous system . J. Biol. Chem . 247,3159-3169 .

Xie W . Q . and Rothblum L. 1 . (1992) Rapid, small-scale RNA iso-lation from tissue and culture cells . Biotechniques 11, 324-327 .

J. Neurochem., Vol. 63, No. 4, 1994