d-serine dehydratase from escherichia coli

THE JOURNAL OF BIOLOGICAL CHEMISTRY 0 1988 by The American Society for Biochemistry and Molecular Biology, Inc

Vol. 263, No. 32, Issue of November 15, pp. 16926-16933.1988 Printed in U.S.A.

D-Serine Dehydratase from Escherichia coli DNA SEQUENCE AND IDENTIFICATION OF CATALYTICALLY INACTIVE GLYCINE TO ASPARTIC ACID VARIANTS*

(Received for publication, May 16, 1988)

Michelle Marceau$, Elizabeth McFallg, Sidney D. Lewis$, and Jules A. Shafer$ll From the $Department of Biological Chemistry, University of Michigan, Ann Arbor, Michigan 48109 and the $Department of Microbiology, New York University, New York, New York 10016

We have identified two glycyl residues whose integrity is essential for the catalytic competence of a model pyridoxal 5”phosphate requiring enzyme, D-serine dehydratase from Escherichia coli. This was accom- plished by isolating and sequencing the structural gene from wild type E. coli and from two mutant strains that produce inactive D-serine dehydratase. DNA sequencing indicated the presence of a single glycine to aspartic acid replacement in each variant. The amino acid replacements lie in a glycine-rich region of D- serine dehydratase well removed from pyridoxal 5‘- phosphate-binding lysine 118 in the primary structure of the enzyme. The striking effect of these two glycine to aspartic acid replacements on catalytic activity, the conservation of the glycine-rich region in several pyridoxal 5‘-phosphate-dependent enzymes that catalyze a//3-eliminations, and the placement of similar glycine- rich sequences in well-characterized active site structures suggest that the glycine-rich region interacts with the cofactor at the active site of the enzyme.

D-Serine dehydratase (DSD)‘ from Escherichia coli is one of the few monomeric pyridoxal 5”phosphate-requiring enzymes ( l ) , and as such provides an attractive target for studies of the mechanism of action of PLP-requiring enzymes. The enzyme interacts strongly with its cofactor via both covalent and noncovalent interactions (1-16) and catalyzes the conversion of D-serine, D-threonine, and D-allo-threonine to the corresponding a-keto acid and ammonia. The nearly complete amino acid sequence and 44% of the DNA sequence for D- serine dehydratase have been reported (17,18), and the single PLP-binding lysine (K-118) has been identified (17). Little is known regarding the identity of other aminoacyl residues important for catalytic competence, however. The present

* This work was supported by Grants HL32006 (to J. A. S.) and GM11899 (to E. M.) from the National Institutes of Health. Part of this work is taken from a Ph.D. thesis to he submitted by Michelle Marceau to the Graduate School of The University of Michigan. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

ll To whom correspondence should be addressed Dept. of Biological Chemistry, Box 0606, The University of Michigan, 1301 Catherine St., Ann Arbor, MI 48109-0606.

The abbreviations used are: DSD, D-serine dehydratase; DTT, dithiothreitol; LB.,,, LB medium supplemented with 50 pg/ml ampicillin; MES, 2-(N-morpholino)ethanesulfonic acid; mini-PAGE, polyacrylamide gel electrophoresis performed on 8 X 10 cm gels; PLP, pyridoxal 5”phosphate; SDS, sodium dodecyl sulfate. Single letter abbreviations for amino acids appear in bold-faced type.

study (i) establishes the complete DNA and deduced protein sequence of the wild-type enzyme and (ii) identifies two G + D replacements that virtually inactivate DSD but do not prevent the binding of cofactor. The replacements are shown to lie in an unusually glycine-rich region that resembles the glycine-rich sequence found in other enzymes that bind phos- phorylated ligands.

MATERIALS AND METHODS

Chemicals, Antisera, and Enzymes-Tryptone and yeast extract for LB media (19) were obtained from Difco. DTT was ordered from Behring Diagnostics or Boehringer Mannheim. Reagents for polyacrylamide gel electrophoresis were purchased from IBI, and Tween 20 and 4-Chloro-1-napthol for Western blotting from Bio-Rad. Polymin P and goat anti-rabbit horseradish peroxidase conjugate (61-202-3) were ordered from Miles. [y-32P]ATP (>lo00 mCi/mmol) and [~x-~~S]thio-dATP (>lo00 mCi/mmol) were supplied by Amer- sham Corp. Other chemicals were analytical grade. Restriction enzymes and enzymes used for labeling of DNA were purchased from Bethesda Research Laboratories or New England BioLabs and were used according to directions. Previously prepared rabbit antiserum to wild-type DSD (20) was purified by sodium sulfate precipitation and DEAE-cellulose chromatography as described by Mage (21) prior to use in immunoblots.

Genetic Nomenclature, Bacterial Strains, and Plasmids-The inability to convert D-serine to pyruvate (DSD- phenotype) may result from alteration of one or more of three genetic loci known to be specific for DSD expression in E. coli K-12: (i) the structural gene of the enzyme, designated dsdA, (ii), the structural gene of a dsdA activator protein, dsdC, or (iii) the control region that lies between the two structural genes and contains the dsdA and dsdC promoters (dsdAp and dsdCp,) and transcription start sites (22-24). The symbol dsdA or dsdA+ denotes the wild-type structural gene encoding DSD. Mutations in this gene that result in an inability to grow in the presence of D-serine are designated either dsdA- or dsdA(EM1201), dsdA(AC6082), etc., to denote a specific dsdA mutation. Mutations in the regulatory loci are designated dsdC-, dsdAp-, or dsdCp-.

Phenotypically DSD- strains were obtained from wild-type parent strains using methyl-N-nitro-N-nitrosoguanidine mutagenesis, pen- icillin selection, and selection in D-serine-containing media (25, 26). The locus of mutation was tentatively assigned as dsdC, dsdCp, dsdAp, or dsdA by complementation analysis and phage transduction using the tester strains and procedures described by Bloom and McFall (27). Six strains that appeared to be dsdA- were chosen for further screening by protein and Western blot analyses. The E. coli K-12 strains and plasmids used in these studies are described in Table I. All cultures were grown at 37 ‘C in LB media (19). Where appropriate, ampicillin or tetracycline was added at a concentration of 50 pg/ml or 25 pg/ml, respectively. Bacteriophage M13mp19 was purchased from Bethesda Research Laboratories.

Preparation of Cell Extracts for Western Blotting-DSD- strains and strain C600 were grown overnight in 5 ml of LB broth f D-serine (0.5 mg/ml). One ml of each overnight culture was centrifuged (14,000 X g for 5 min) and the cell pellet resuspended in 25 pl of SPE lysis buffer (20% sucrose, 20 mM EDTA, 30 mM potassium phosphate, 0.5 mg/ml lysozyme, pH 7.8) and incubated at room temperature for 15 min. Cells were lysed by gently mixing the suspension with 275 pl of water (containing lpg/ml each of the protease inhibitors leupeptin,

16926

Inactive Variants of D-Serine Dehydratase 16927

pepstatin, and aprotinin) and incubating the mixture on ice for 15 min. An aliquot (40 pl) of Buffer A (1 M potassium phosphate, 40 p M PLP, 50 mM EDTA, 10 mM DTT, adjusted to pH 7.5 with concen- trated HCl) was then added and the mixture centrifuged to remove cell debris (14,000 X g for 10 min at 4 "C). Aliquots of the supernatant were removed for assay of DSD activity and for gel electrophoresis in preparation for Western blotting.

Assays of DSD Activity-Enzyme activity assays monitored the increase in absorbance at 220 nm ( A E = 1090 M" cm") associated with the conversion of D-serine to pyruvate. The standard assay solution contained 990 p1 of 0.1 M potassium phosphate, pH 7.8, and 10 pl of crude protein extract (or 10 pl of a dilute solution of purified enzyme). Fifty pl of 0.5 M D-serine was added to start the reaction. Assays were performed at 25 "C in a EU700 GCA McPherson spec- trophotometer.

Screening of Cell Extracts by Western Blotting-Aliquots (2 pl) of each crude extract were electrophoresed on 9% SDS-miniPAGE and transferred to nitrocellulose (Millipore GSWP 304FO) by electro- blotting using a Bio-Rad TransBlot apparatus. The subsequent steps represent a modified version of the Bio-Rad Immun-Blot protocol. The nitrocellulose was rinsed with H20, then shaken for 4 h in 0.5% Tween 20, 20 mM Tris, 0.5 M NaC1, pH 7.5 (Tw/TBS) to block nonspecific protein-binding sites. The filter was then incubated overnight with antiserum to wild-type DSD (75 p1 of rabbit antiserum in 75 ml of Tw/TBS). After four washes in Tw/TBS to remove excess antibody, the filter was incubated for 2 h in 75 ml of Tw/TBS containing 10 p1 of goat anti-rabbit horseradish peroxidase conjugate. The nitrocellulose was then washed four times with Tw/TBS and once with 0.1 M MES, pH 6.0. Following equilibration in MES, the nitrocellulose was developed to detect the presence of DSD cross- reactive material with a solution prepared by combining (a) 60 mg of 4-C1-1-napthol dissolved in 30 ml of methanol (ice-cold) and (b) 60 pl of 30% H20, dissolved in 100 ml of 0.1 M MES, pH 6.0. Following development for 5-10 min, the blot was rinsed several times with water, dried at room temperature, and photographed. All steps were carried out at room temperature in glass dishes.

Construction and Screening of Genomic Libraries-Unless specified, the techniques outlined by Maniatis et al. (19) were employed for plasmid DNA isolation, electroelution of DNA fragments, and transformations. Chromosomal DNA was prepared (30) from strains EM1201 and AC6082 and digested with HindIII. Following electrophoresis on 0.8% agarose (FMC Biochemicals), the 4-5 kb region was excised, the DNA recovered by electroelution, and ligated to HindIII- cleaved, dephosphorylated pUC13. The ligation mixture was used to transform JM101. AmpR colonies were replicaplated (FMC Repli- plate, FMC Biochemicals) onto Whatman No. 1 filter circles and screened for the presence of dsdA (31) with a 32P-labeled nick- translated RsaIIAuaI dsdA fragment (0.586 kb) isolated from pAC13, a plasmid that carries the entire wild-type dsd operon (Table I and

Ref. 23). Plasmid DNA prepared from clones that gave a positive hybridization signal was characterized by restriction analysis and in situ gel hybridization (32) using the RsaIIAvaI probe described earlier. In situ gel hybridization, a simplified form of Southern blotting, was carried out as described by Kidd (32) with the following modifications. After wetting the dried agarose gels in water and removing the backing paper, the gels were rinsed for several minutes in 6 X SSC, pH 7.0 (1 X SSC is 0.15 M sodium chloride, 0.015 M sodium citrate buffer as defined in Ref. 19) then prehybridized for 1-2 h at 68 "C in 6 X SSC, pH 7.0, 5 X Denhardt's solution (19), 0.1% SDS, 0.5 mg/ml sodium pyrophosphate, 0.1 mg/ml sheared, denatured salmon sperm DNA. Gels were hybridized with the 32P-labeled probe for 2-4h at 68 "C in 6 X SSC, 1 X Denhardt's solution, 0.1% SDS, 0.1 mg/ml salmon sperm DNA before washing and exposure to x-ray film (32). These modifications markedly reduced 32P background due to nonspecific binding of probe to rehydrated agarose gels. HindIII library plasmids pEM1201.1 and pAC6082.35 were chosen for further characterization of the insert DNA by dideoxy sequencing and expression of the structural gene.

Subcloning of DNA for Dideoxy Sequencing-The sequencing strategy is outlined in Fig. 1. Briefly, a 1.5-kb RsaIIHincII fragment containing all of dsdA was isolated from pEM1201.1, pAC6082.35, and pAC13. Following digestion with SmaI or HaeIII and AluI, the DNA fragments were ligated into HincII-digested, dephosphorylated M13mp19 DNA and transfected into JMlOl (33). Single-stranded DNA was prepared from 70 colorless plaques, and dideoxy sequencing

L" - -_1 I ~. . . . . . . .

~ . ~ ~ ~ . ~ ..~.~.

, -----~~--~, . . . . . . . . . .

FIG. 1. Restriction map of the dsdA region and strategy for sequencing. The procedures used for subcloning and sequencing are described under "Materials and Methods." Arrows indicate the length and direction of selected fragments used for sequencing. Dashed arrows represent fragments derived from deletion subclones; solid arrows represent fragments derived from H/AI or S digestion. X indicates the site of the G -+ A transition in dsdA(EM1201) or dsdA(AC6082). Abbreviations used for restriction enzyme sites are: A, AuaI; Al, AluI; B, BstEII; H , HaeIII; Hc, HincII; Hd, HindIII; R, RsaI; S, SmaI. -, 4.42-kb HindIII insert present in pEM1201.1 and pAC6082.35; m, dsdA-coding region.

TABLE I Bacterial strains and plasmids

Strain Genotype Source"

EM1201 AC6082

supE strR lacZ- dsd- thr leu thi rmL+ dsd-

EM1200 (28) C600 (29, 23)

Transformations JMIOlb supE thi lac- proAB F'

traD36 lacZaZ M15 BRL

Plasmids ~~ ~~

Size Vector/Markers Insert'

kb endslsize

dsd DNA present

puc13 2.7 ampR BRL ptac 12 2.6 tac ampR

PTC-21 4.3 ptacl2 ampR R-Hc/l.5 dsdA This study PTC-1 4.3 ptacl2 ampR R-Hc/l.5 dsdA (EM1201) This study PTC-35 4.3 ptacl2 ampR R-Hc/l.5 dsdA (AC6082)

PAC 13 13.8 pMB9 tetR B/7.4 dsdCA D. Oxender W3828 (23)

pEM1201.1 7.1 pUC13 ampR Hd/4.4 dsdApA (EM1201) This study

pAC6082.35 7.1 pUC13 ampR Hd/4.4 dsdApA (AC6082) This study This study

"Parental E. coli K-12 strain C600 is dsdC+A+. Parental strain EM1200 (dsdC+ApZA+) is constitutive for synthesis of wild-type DSD and is derived from dsdC+A+ strain W3828 (28). BRL, Bethesda Research Laboratories.

* Used as the host strain for plasmids and for recombinant M13 phages. e Letters represent restriction endonuclease(s) used to produce each insert: B, BstEII; Hc, HincII; Hd, HindIII;

R. RsaI. Insert sizes are in kb.

16928 Inactive Variants of D-Serine Dehydratase

was performed with the universal sequencing primer, modified T7 polymerase (Sequenase, U. S. Biochemical Corp.) and the sequencing protocol supplied with the enzyme. A portion of each gene was also sequenced after cloning the intact 1.5-kb dsdA fragment into HincII- digested, dephosphorylated M13mp19. Following transformation of JM101, clones containing the insert in opposite orientations were isolated and used to prepare a series of overlapping deletion clones as described by Dale et al. (34). Single-stranded DNA from these clones was isolated and sequenced as described earlier. Sequence data obtained by both cloning strategies was used to assemble the complete sequence of each gene in both directions.

Subcloning of DNA into Expression Vector ptacl2-The 1.5-kb RsaI/HincII fragment containing either the wild-type or mutant structural gene was ligated into PuuII-digested, dephosphorylated ptacl2. Following transformation of E. coli JM101, plasmid DNA was prepared from ampR colonies and screened for the presence and orientation of the insert by restriction analysis. To verify that the recombinant plasmids could express DSD under the direction of the tac promoter, JMlOl containing either PTC-1, PTC-35, or wild-type expression plasmid PTC-21 was grown in 5 ml of LB,, to an absorbance at 660 nm (Am) of 0.4. Isopropyl @-D-thiogalactoside was added to a 1 mM final concentration, and cultures were allowed to grow for an additional 8 h before harvesting. Crude extracts were prepared as described earlier, and DSD activity assays and Western blotting were used to verify the expression of wild-type or mutant DSD.

Expression and Purification of DSD Proteins-DSD expression strains were grown for 5-6 h in 10 ml of LB.,, and used to inoculate flasks containing 1 liter of LB.,,. When the Asso reached 0.4, 20 ml of 0.5 M lactose was added to each flask to induce expression of DSD. Cells were harvested after an additional 7-8 h of growth, and the cell paste was stored at -20 "C. A typical yield of cell paste from 15 liters of medium was 40 g which in turn yielded 300-400 mg of purified wild-type or mutant protein.

Purification steps were performed at 4 "C unless otherwise specified. Protein concentration was determined from the absorbance of holoenzyme at 280 nm in 0.1 M potassium phosphate buffer, pH 7.8, using E 2 = 10.5 (1). All buffers except the SPE lysis buffer (described earlier) contained 1 pg/ml each of the protease inhibitors pepstatin, leupeptin, and aprotinin. Cell paste (30-40 g) was resuspended in 40 ml of SPE lysis buffer. After incubation with occasional stirring at room temperature for 20 min, cells were lysed by addition of 400 ml of water containing the protease inhibitors and 80 p~ PLP. After stirring the suspension for 5-10 min, the mixture was incubated on ice for 20 min and 50 ml of Buffer A' (Buffer A containing 800 p~ PLP) added. Cell debris was removed by centrifugation for 30 min at 18,000 X g. The pH of the supernatant was adjusted to pH 7.3 with 2.5 M KOH and nucleic acids precipitated with 1% Polymin P as previously described (35). The resulting supernatant was adjusted to pH 7.3 and dry ammonium sulfate added slowly, with stirring, to 70% saturation (the pH was maintained constant at pH 7.3 with 2.5 M KOH). The solution was stirred for an additional 40 min, centrifuged at 18,000 X g for 2 h, and the resulting pellet was dissolved in a minimum volume (50-70 ml) of Buffer B (10 mM potassium phosphate, 1 mM EDTA, 1 mM DTT, 80 pM PLP, pH 7.2) and dialyzed overnight against three changes (1 liter each) of Buffer B in preparation for DEAE-cellulose chromatography.

After a brief centrifugation (18,000 X g for 5 min at 4 "C) to clarify the sample, it was loaded onto a 2.5 X 20-cm column of DEAE- cellulose (Whatman DE52) previously equilibrated in Buffer B. Pro- teins were eluted from the column with a 400-ml gradient of 0 + 200 mM KC1 in Buffer B. Fractions (5 ml) were collected at a flow rate of approximately 70 ml/h, and 0.55 ml of Buffer A' was added to each. Fractions were screened for the presence of DSD by the activity assay in the case of wild-type DSD or by dot blotting in the case of the inactive DSD variants. For dot blotting, 5 pl of each column fraction was spotted onto a sheet of nitrocellulose and allowed to dry. The nitrocellulose was then incubated with DSD antiserum and developed to reveal the presence of cross-reactive material as described for Western blotting of crude extracts. Peak fractions were pooled, and the protein was precipitated with 70% ammonium sulfate. The pellet was dissolved in a minimum volume (10-15 ml) of Buffer B, dialyzed overnight against Buffer B to remove ammonium sulfate, then dialyzed an additional 3-4 h against Buffer C (1 mM potassium phosphate, 1 mM DTT, 80 ~ L M PLP, pH 7.0) in preparation for chromatography on hydroxyapatite. No PLP was added to these dialysis buffers for the purification of wild-type DSD.

After a brief centrifugation to remove precipitated material, the sample was applied to a 2.5 X 19-cm column of hydroxyapatite (Bio-

Rad HTP) previously equilibrated 1 mM potassium phosphate, 1 mM DTT, pH 7.0. The column was washed with 3 column volumes of Buffer C (mutant DSD proteins) or Buffer C minus PLP (wild-type DSD). DSD was eluted with 3 column volumes of 10 mM potassium phosphate, 1 mM DTT, 80 p~ PLP, pH 7.8 (mutant and wild-type DSD). One-tenth volume of Buffer A' was added to each fraction, and those containing DSD were identified, pooled, and precipitated with 70% ammonium sulfate as described for DEAE-cellulose chromatography. The pellet was resuspended in a minimum volume of Buffer D (100 mM potassium phosphate, 1 mM DTT, 1 mM EDTA, 80 pM PLP, pH 7.8), dialyzed to remove ammonium sulfate, and stored at -70 "C.

COOH-terminal Analysis of DSD Using Carboxypeptidase B-Car- boxypeptidase B digestion mixtures contained 10 nmol of DSD, or DSD(G279D) or DSD(G281D), 0.37 enzyme concentration units of carboxypeptidase B-DFP (Sigma), and 10 nmol of a-amino butyric acid (as an internal standard) in 0.1 ml of 0.2 M N-ethylmorpholine acetate, pH 8.5. Following a 2-3 h incubation at room temperature, the reaction was quenched by adding 0.9 ml of 0.1 M formic acid and passed through a small column (0.2 ml) of Dowex 50W-X8 (100-200 mesh, Bio-Rad) pre-equilibrated in 0.1 M formic acid. The column was rinsed with 1 ml of 0.1 M formic acid, 1 ml of water, and finally with 1 ml of 5 M ammonium hydroxide to release bound amino acids. The ammonium hydroxide fraction was taken to dryness, washed twice with 0.1 ml of water, twice with 20 p1 of 95% ethanol/triethylamine/water (4:4:2), and taken to dryness. The residue was taken up in 20 p1 of 95% ethanol/triethylamine/water (62:2), derivatized with 10% phenyl isothiocyanate in 95% ethanol, and analyzed by high performance liquid chromatography as previously described (36).

Determination of the PLP Content of DSD-DSD (225 PM) was dialyzed for 18 h against three changes of Buffer D containing 250 pM PLP (stoichiometric with enzyme concentration plus 10%). Free and protein-bound PLP were then separated by the centrifuge column procedure of Penefsky (37). Sephadex G-50 resin used for column matrices were pre-equilibrated in Buffer D without PLP. DSD samples were loaded onto the 1-ml syringe columns in a total volume of <lo0 pl and allowed to filter into the resin for 2-3 s prior to centrifugation at 5,000 X g for 4 min at room temperature. Following two successive column centrifugations to remove unbound PLP, the sample was transferred to a 1.5-ml Eppendorf tube and centrifuged briefly (3 min, 14,000 X g) to remove any traces of Sephadex. The ratio of apo/holoDSD in the supernatant was determined spectropho- tometrically.

Absorbance spectra were recorded at 25 "C on a Cary 219 spectro- photometer. Enzyme solution from the previous step (50-100 r l ) was added to 900 p1 of quenching buffer (6 M guanidine hydrochloride, 0.5 M 2-hydroxyethylamine, 0.1 M KPi, adjusted to pH 7.8 with HC1) and the spectrum recorded against a reference solution of 50-100 pl of buffer D (without PLP) in 900 p1 of quenching buffer. The high concentration of guanidine hydrochloride ensured that enzyme-bound PLP was released to form a Schiff base with 2-hydroxyethylamine. Concentrations of PLP ([PLP]) and protein ([DSD]) in the assay curvette were determined from the absorbance at 418 nm (A418) and 280 nm (AzM) using Equations 1 and 2:

where the molar absorptivities of the PLP:2-hydroxyethylamine Schiff base (E% = 5225 M" cm", = 4426 M" cm") at the subscripted wavelengths were determined from the spectra of solu-

The molar absorptivity of denatured apoDSD, EZD (39,900 M" cm") tions containing a known concentration of PLP in quenching buffer.

was determined by diluting 0.1 ml of a stock solution of wild-type DSD (containing a known concentration of native enzyme in phosphate buffer) into 0.9 ml of quenching buffer and substituting the following in Equation 2: the concentration of the diluted DSD ([DSD]), the A , of the quenching buffer, the value of E& and the value of [PLP] obtained from Equation 1. The concentration of DSD in the original stock solution was determined by the method of Dowhan and Snell (1) using a value of E;% = 10.5 for native wild- type DSD. The molar absorptivity for the denatured apoDSD variants (at 280 nm in quenching buffer) was assumed to be equivalent to that of denatured wild-type apoenzyme.


RESULTS

Several strains of E. coli that could not grow in the presence of minimal medium containing D-serine were produced by NMNG mutagenesis (25-27). Presumably these strains produced insufficient active DSD to destroy D-serine, a growth inhibitor of E. coli. (38). SDS-PAGE and Western blotting allowed identification of strains likely to be expressing full length copies of inactive or partially active DSD. The structural gene for wild-type DSD and the dsdA genes from the two mutant strains were isolated and further analyzed.

Previously prepared PAC 13 containing a 7.4-kb BstEII fragment of E. coli DNA was used as source of wild-type dsdA (Table I and Ref. 23). The dsdA gene from strains EM1201 and AC6082 was isolated from genomic libraries prepared from Hind111 digests of chromosomal DNA. The DNA frag-

ments coding for the wild-type and mutant proteins were subcloned and sequenced as indicated in Fig. 1 and under “Materials and Methods.” The complete nucleotide and amino acid sequence of wild-type DSD are presented in Fig. 2. The 442-residue wild-type enzyme as deduced from the DNA sequence has an M, of 47,920 and the composition: A,7CsDzzEz7F,,G4~H1zI18K20L48M13N10PlaQz4R~~Sz7Tz~ VzaW4Y15.

The sequence of dsdA from EM1201 and AC6082 disclosed the presence of a single glycine to aspartic acid replacement in DSD at position 279 and position 281, respectively (boxed area of Fig. 2). Interestingly, G-279 and G-281 reside in a glycine-rich region of DSD wherein glycine comprises 6 of 8 residues (279-286). The predicted secondary structure of DSD (Fig. 3) suggests that the G + D replacements reside in an

190 200 210 220 230 240 250 210 210 280 CTG GCA AAA G C A TTT CCT G A A ACT QCT QCC ACT m ATT ATT GAA TCA QAA CTG GTT GCC ATT CCA GCT ATG CAA AAA C M CTQ GAA GAA T A T Lau A l a L y s A l a Pha Pro G l u T h r A l a A l a T h r G l y G l y 11. 11. G l u S a r G l u LaU V a l A l a 11. Pro A l a Hat G l n L y a A r g L e u t31u L~~ T~~

?O eo 90

290 300 310 320 330 340 350 3ao 370 380 CAG CAA CCG ATC AGC OM CAA CTG TTA CTG AAA AAA QAT A Q C CAT TTG CCC ATT TCC WC TCC ATA AAA GCA CQC GGC QQG ATT TAT GAA GTC CTG GCA G l n G l n Pro x la S a r G l y G l n Lau Lau Lau L y a L y a A m 0 S a r nia Lau Pro I l a S m r G l y S a r 11. L y a A l a A r g G l y G l y 11. T y r G l u v a l La” la

100 110 - 120

390 400 410 420 430 440 450 4ao 470 480 CAC OCA GAA AAA CTG GCT CTG QAA GCG OM TTG CTG ACG CTT GAT GAT GAC TAC AQC AAA CTG CTT TCT CCG QAG TTT A A A CAG TTC TTT AGC CAA TAC H i s A l a G l u L y a LOU A l a Lau G l u A l a G l y Lau Lau T h r Lau A ~ D Amp Amp T y r S a r L y a Lau L a u S a r P r o G l u Pha L y 8 G l n P h a P h a sar G l n T y r

130 140 150 1 eo

590 aoo a10 a20 a30 a40 a50 aao a70 680 COO GCA TOO AAA AAA GCG AAA CTG CGC ACG CAT GGC GTT ACG GTC GTG GAA TAT GAG CAA GAT TAT M T GTT GCC GTC GAG GAA GOA CGT A A A GCA GCG A r g A l a T r p LYS L y S A l a L y 8 Leu A r g T h r H i s G l y V a l T h r V a l V a l G l u T y r G l u G l n Asp T y r G l y V a l A l a V a l G l u G l u G l y A r g L y s A l a A l a

200 210 220

690 700 710 720 730 740 7 50 7ao 770 780 CAG TCT GAC CCG AAC TOT TTC TTT ATT GAT GAC GAA AAT TCC CGC ACG TTG TTC CTT GGG TAT TCC GTC GCT GGC CAG COT CTT AAA GCG CAA TTT GCC G l n S a r Asp Pro A s n C y s P h a Pha 11. Aap AID G l u A n n S a r A r g T h r Lau P h a LOU G l y T y r S a r va1 A l a G l y G l n A r g Lau L y s A l a G l n P h e A l a

230 240 260

790 800 810 820 CAG CAA GGC CGT ATC GTC GAT GCT GAT AAC CCT CTG T T T GTC TAT CTG G l n G l n G l y A r g I10 V a l Asp A l a Asp A s n P r o Lau Pha V a l T y r Lau

270 290

880 890 900 910 GCG TTT GAT CAT GTT CAC TGC T T T T T T GCC GAA CCA ACG CAC TCC CCT TOT ATG TTG TTA OOC GTC CAT ACA GOA TTA CAC GAT CAG A T 1 TCT GTT A l a Pha G l y ASP H i s V a l H i s Cy. P h a Pha A l a G l u P r o T h r H i 6 S a r Pro C y a Hat LOU Lau G l y V a l His T h r G l y Lau H i s Asp G l n I l a S e r Val

300 310 320

920 9 30 940 950 oao 970

980 990 1000 1010 1020 GAT *TT GGT ATC GAC AAC CTT ACC GCA GCG GAT GQC C T T GCA GTT M T CGC G C A TCA GGC T T T GTC GGG COG G C A ATG GAG COT CTG CTG GAT GGC

G l n *OD 11- G l Y I l a ASP A s n L a u T h r A l a A l a Asp G l y L a u la v a l G l y A r g la sar G l y Pha va1 G l y A r g * l a M a t G l u A r g Lau L a u ASD G l y

1030 1040 1050 1 oao 1070

330 340 350

1080 1090 1100 1110 1120 1130 1140 1150 11ao 1170

3ao 370

TTC TAT ACC CTT AGC GAT CAA ACC A T 0 T A T QAC ATG CTT GGC TGG CTG QCG CAG QAA G A A GGT ATT COT CTT GAA CCT TCG GCA CTG GCG GGT ATG GCC T y r T h r LmU S a r Amp G l n T h r Hat T y r Amp Mat Lau G l y T r g Lau AI. G l n o lu G l u G l y 11. A r g Lau G l u Pro S a r A l a L a u A l a G l y M e t A l a

380 390

1180 1190 1200 1210 1220 1230 1240 1250 1200 1270 oG* CCT CAG CGC GTG TOT GCA TCA GTA AGT TAC CAA CAG AT0 CAC QGT TTC AGC OCA GAA CAA CTG CGT AAT ACC ACT CAT CTG GTG TOG GCG ACG GGA O1y pro G l n A r 9 V a l CY. A l a S a r V a l S a r T y r G l n G l n Mot Him G l y Pha S.r A l a G l u G l n L e u A r g A n n T h r T h r H i s L e u V a l T r D A l a T h r G l y

400 410 420

1280 1290 1300 GGT M A ATG GTG CCG GAA ( U A GAG A T 0 AAT CAA TAT CTG OCA AAA GGC COT TAA TAA

430 440

1310 1320 1330

G l y G l y Hat V a l Pro G l u G l u G l u Mot A m G l n T y r Lau A l a L y a G l y A r g *** ***

FIG. 2. Nucleotide and amino acid sequence of dsdA. Numbering of amino acids and nucleotides begins with methionine 1. Nucleotide numbers are given over the sequence and correspond to the base aligned with the last digit. The ribosome-binding site in the (-10) region is overlined and the RsaI site used for isolation of &dA

enclosed, and the site of mutation in EM1201 andAC6082 is indicated. The sequence CGTTTCAACGCAGCATCGC- fragments is marked. PLP-binding K-118 is underlined. The glycine-rich sequence from position 279-286 is

ACCCCCTCCTTTT follows the second TAA end codon and may contain terminator signals of interest. AATCCTTTCCCTGGGTGAGCGATGCTGCCGATGGCGCAGACTTAAGATCCCCGGTCTTACCCGCTATA-


0 50 100 I50 200 3so 400

f . 2

Turns A A A MA nn I\ n u I\ nw, n nn n A Alpha Hel icesp u u

Beta Sheets J ~ ~ ~ I I I I I I J I I I ~ I I I I I ~ I I I I I I I I I ~ I I I I I I I I I ~ I I I I I I I I I ~ I I I I I I I ~ I I I I I I I I I ~ I I I I I I I l I ~ I I I I I l l l

0 50 100 150 m 250 300 350 400 LI FIG. 3. Predicted secondary structure and flexibility of DSD. Secondary structure was predicted by the

method of Chou and Fasman (39) with the modifications introduced by Nishikawa (40). Positive deviations from the base line are proportional to the probability of a particular secondary structure. Flexibility was determined by the method of Karplus and Schulz (41). Single residue flexibility coefficients are presented on a scale of 0.8

the PEPTIDESTRUCTURE and PLOTSTRUCTURE programs written by the Genetics Computer Group of the (minimum flexibility) to 1.2 (maximum flexibility). All predictions were performed on a VAX 750 computer using

University of Wisconsin. The glycine-rich sequence of DSD (positions 279-286) is enclosed.

extended turn between the carboxyl terminus of a &sheet and the amino terminus of an a-helix.

Wild-type and mutant proteins were produced in trans- formants of JMlOl that contain the DSD structural gene linked to the powerful tac promoter of plasmid ptacl2 (Table I). DSD accounts for 7-8% of the total bacterial protein in these expression strains, or about 10 times the amount of DSD produced by the single copy of genomic dsdA in strain EM1600 (dsdApd+), a commonly used source of DSD (1, 42). The E. coli JMlOl host strain expresses little or no DSD unless induced with D-serine. In control experiments, isopropyl 8-D-thiogalactoside-induced cultures of JMlOl produced <0.1% of the DSD expressed by induced transformant strains. Enzyme was purified from crude bacterial extracts using a modified version of previously described procedures (1, 35, 42). Because of the possibility that the DSD variants might bind pyridoxal 5’-phosphate less tightly than wild-type DSD, they were purified in the presence of excess cofactor. Wild- type DSD, DSD(G279D) and DSD(G281D) were isolated in greater than 95% purity as judged by 9% SDS-PAGE (Fig. 4). The purification protocol yielded wild-type enzyme with a specific activity of 140-150 units/mg, in good agreement with that previously reported for DSD (4). Purified DSD(G279D) and DSD(G281D) displayed specific activities less than 0.3% that of wild-type DSD. The lack of activity of the variant enzymes could not be attributed to a failure to bind PLP. Determination of the cofactor content yielded values of 1.18,0.97 and 0.99 mol bound cofactor/mol protein for DSD, DSD(G279D), and DSD(G281D), respectively. Furthermore, the activity of the variant proteins and wild-type DSD was unaffected by varying the concentration of PLP in the assay medium from 1.5- to 100-fold molar excess over enzyme.

Five cycles of Edman degradation indicated the sequence MENAK, and digestion with carboxypeptidase B liberated only MNQYLAKGR for all three proteins. These observa- tions support the conclusion that the wild-type and variant proteins were isolated with their polypeptide chains intact. Thus, the inactivity of the variant proteins could not be attributed to proteolysis.

DISCUSSION

The DNA sequence of dsdA (Fig. 2) agrees with that previously reported (18) for nucleotides 1-585 with the exception of a nucleotide in the codon for A-192. GCT was observed rather than GCC. The deduced amino acid sequence agrees with that determined by direct peptide sequence analysis (17)

A B C D E F G H

FIG. 4. SDS-PAGE of wild-type and variant DSD proteins. DSD was purified from JMlOl expression strains as described under “Materials and Methods.” Samples taken from various stages of the purification were analyzed (after reduction) by SDS-PAGE (9.0% gel) and Coomassie Blue staining. Samples in lanes (A-F) represent wild-type DSD crude extract ( A ) , Polymin P supernatant ( B ) , resuspended ammonium sulfate pellet prior to DEAE-cellulose chromatography (C), pooled fractions following DEAE-cellulose chromatography (D), pooled fractions following hydroxyapatite chromatography, 3 pg of protein ( E ) and 6 pg of protein (F). Lunes G and H correspond to lane E for 3.5 pg of DSD(G279D) and DSD(G281D), respectively.

as corrected by McFall and Runkel(18) except for the present assignment of T rather than S at position 204. This assignment was confirmed by Maxam and Gilbert sequencing (43) of a SmI/HAEIII fragment encoding residues 195-264. ACG (T-204) and GCT (A-192) were also observed in the dsdA sequence of EM1201, AC6082, and EM1502, a dsdC+Apd+ constitutive strain.

It came as a surprise that the loss of catalytic activity seen in DSD(G279D) and DSD(G281D) was not due in either case to loss of a functional side chain, since a minimum of six functional groups have been implicated in catalysis or alignment of cofactor or substrate (1, 2, 10, 11, 14, 42, 44, 45). Introduction of an aspartyl side chain at position 279 or 281 may have perturbed the orientation of one or more of these groups, although gross perturbations of protein conformation are unlikely. The G + D replacements reside in what is predicted (39,41) to be an extended @-turn in the most flexible region of the molecule (Fig. 3). Aspartic acid is frequently found in @-turns (46) and its presence at position 279 or 281 does not alter the predicted secondary structure (39) or flex-


ibility (41) of the glycine-rich region.' Also consistent with the maintenance of DSD structural integrity, G + D variants were able to bind PLP stoichiometrically.

Interestingly, the glycine-rich region is highly conserved in several PLP-requiring c~/p-eliminases,~ despite an overall sequence homology of less than 28% between DSD and each of the enzymes listed in Table I1 (the most homologous proteins were E. coli biodegradative threonine dehydratase (27%) and tryptophan synthetase P-subunit (22%)). Alignment of the glycine-rich regions of several PLP enzymes using the criteria indicated in the legend to Table I1 disclosed several interesting similarities. All of the threonine dehydratases (Tdc, ILV-1, and ILV-A in Table 11) contained glycine-rich sequences that were 36-41% homologous to a 22-amino acid segment encom- passing the glycine-rich region of DSD, with the homology increasing to 50% when the comparison is limited to the 8- residue segment comprising G-279 to G-281. Moreover, in the aligned sequences of DSD, the threonine dehydratases, and tryptophan synthetase p-subunit, glycine was invariant at positions corresponding to (3-279, G-281, and G-286 of DSD. It is thus tempting to suggest a functional role for this conserved glycine-rich region. In this regard, we should note

The single residue flexibility coefficients for G-279, D-279, G- 281, and D-281 are 0.973,0.975, 1.043, and 1.055, respectively. Aver- age flexibilities for the 8 residues of the glycine-rich region (279-286) are 1.046 (wild-type DSD), 1.047 (DSD(G279D)), and 1.052 (DSD(G281D).

Conserved regions (including the glycine-rich region) in PLP- requiring alp-eliminases have been noted previously (17, 49).

TABLE I11 Glycine-rich sequences in DSD and nucleotide-binding proteins

Enzyme (ligand)".b Gycine-rich sequence' Mutation Effect(s)

DSD (PLP) AK (AMP) Phospholipase A2 (ATP) LDH (NAD) GPD (NAD) ADH (NAD) GR (FAD) PHBH (FAD) Nitrogenase (ATP) F1-ATPase@ (ATP) PK-C (ATP) PK-CAMP (ATP) v-src (ATP) EGFR (ATP) Myosin (ATP) CheB methylesterase t-RNA nucleotidyl transferase (ATP, CTP)

p21 (c-Ha-ras-1) (GTP)

- G V G G G P G G G G P G S G K G G A G G Q G R P G V G A V G M A G F G R I G R L

G G G S G G L A G A G P S G L L G K G G I G K S - G G A G V G K T G K G S F G K V G T G S F G R V G Q G C F G E V G S G A F G T V E G G G G G K K G M G N D G A A

- G L G G I G L D

G S ~ Y T G F T

G A G G V G K S

- G279 + D - G281+ D

- G14 + D

- G149 + I GI54 + I -

- G284 -+ V G70 + D

GI2 + X'

- -

Inactivation Inactivation

Inactivation and NAD affinity J 100 X

ATPase activity J 24% ATPase activity -1 83%

Inactivation AMP incorporation J 79% CMP incorporation unaffected Activate oncogenic potential and 1

GTPase activity 8-10 X

The abbreviations used in this table are: AK, adenylate kinase; LDH, lactate dehydrogenase; GPD, glyceral- dehyde-3-phosphate dehydrogenase; ADH, alcohol dehydrogenase; GR, glutathione reductase; PHBH, p-hydrox- ybenzoate hydroxylase; PK-C, protein kinase C; PK-CAMP, CAMP-dependent protein kinase; EGFR, epidermal growth factor receptor; CheB, chemotaxis B.

bAK, phospholipase A*, p21, F,-ATPase B, myosin, PK-CAMP, v-src, nitrogenase alignment is from Ref. 62. PK-C, EGFR, PK-CAMP, v-src alignment is from Ref. 73. LDH, ADH, GPD, GR, PHBH alignment is from Ref. 71.

Underlined glycyl residues indicate residues where mutation(s) are known: ADH from Drosophila (74, 75), F1- ATPase @-subunit from E. coli (76, 77), human c-Ha-ras-1 (78, 71, 79), E. coli tRNA nucleotidyl transferase (80), E. coli CheB methylesterase (81).

It is not clear whether the failure to observe activity is due to unproductive binding of NAD or a consequence of low cofactor binding under the assay conditions employed (no added NAD).

e X = all amino acids but proline.


that glycine-rich sequences are found in many unrelated proteins including IgG light chain, keratin, collagen, ribosomal proteins, enolase, and heat shock proteins (62). Thus, the presence of glycine-rich sequences in distantly related PLP enzymes (63) does not in itself imply functional significance. The conservation of glycine at three or more homologous positions in PLP-requiring a/@-eliminases, however, together with the striking effect of glycine replacement in DSD at two of these conserved positions strongly suggests that the glycine-rich region plays a structural and/or functional role in this group of enzymes.

In many of the nucleotide-binding proteins, a highly conserved glycine-rich sequence is an important structural deter- minant of the nucleotide-binding site, as indicated by x-ray diffraction analyses (64-70) and the effect of G to X replacements on activity (Table 111). The flexible glycine-rich loop connects the carboxyl edge of a 0-sheet with the NHz-terminal end of an a-helix and is usually juxtaposed with a phosphoryl group of the bound nucleotide cofactor or substrate (65, 67- 72). Although insufficient information is available to gener- alize about the presence of glycine-rich regions at PLP-binding sites, a precedent for PLP attachment to a nucleotide-like binding fold clearly exists in the case of glycogen phosphorylase. The PLP-binding site of glycogen phosphorylase is well removed from any subunit interface (82) in contrast to that for aspartate aminotransferase (see below). Crystallographic studies of phosphorylase (82-84) show that residues 133-139 in the nucleotide-binding domain form a glycine-rich loop that separates the phosphates of enzyme-bound PLP and glucose-1-phosphate. PLP is intimately associated with this loop, G-134 being in van der Waals contact with C6 and N1 of PLP and G-135 interacting with C5’ (83). Additionally, G- 135(NH) is linked via two hydrogen-bonded water molecules to 0 2 2 of the highly solvated phosphate group of PLP (84). The glycogen phosphorylase sequence from positions 130 to 137 (GLGNGGLG) is similar to the DSD sequence between residues 279 and 286 (GVGGGPGG). If the glycine-rich region of DSD were similarly juxtaposed with the bound PLP, G to D replacement at position 279 or 281 might inactivate DSD by sterically or electrostatically altering the orientation of the enzyme-bound cofactor.

The x-ray crystal structures of cytoplasmic and mitochon- drial aspartate aminotransferases (85-89) indicate that these PLP enzymes lack glycine-rich sequences at their active cen- ters, illustrating that a glycine-rich loop is not prerequisite for formation of a PLP-binding site. In this regard, it is important to note that most PLP enzymes are multimeric. The two PLP-binding sites of the isologous aspartate aminotransferase dimer reside at the subunit interface, where residues from both subunits contribute to cofactor binding (85-89). Such a structural arrangement is necessarily different from the PLP-binding site of DSD, a monomer, and may also contrast with the PLP-binding sites of multimeric PLP enzymes in which the bound cofactor is well removed from any subunit interface.

In summary, we have identified two point mutants of dsdA from E. coli that encode virtually inactive enzymes. The mutations do not alter residues with functional side chains capable of participating in catalysis, but instead affect two conserved glycyl residues that lie in an unusually glycine-rich region of the protein. This glycine-rich sequence, like the conserved glycine-rich sequences in nucleotide-binding proteins and glycogen phosphorylase, may constitute part of the cofactor binding site of DSD.

Acknowledgments-We thank Dr. Dale Oxender for the gift of ptacl2, Martina Reinhold for help with enzyme purification, and Drs.

Beverly Davidson, David Giegel, and Christopher Kojiro for assist- ance with computer programs for protein structure analysis.

REFERENCES 1. Dowhan, W., Jr., and Snell, E. E. (1970) J. Biol. Chem. 2 4 5 ,

2. Dowhan, W., Jr., and Snell, E. E. (1970) J. Bwl. Chem. 2 4 5 ,

3. Groman, E., Huang, Y. Z., Watanabe, T., and Snell, E. E. (1972)

4. Schonbeck, N. D., Skalski, M., and Shafer, J. A. (1975) J. Bwl.

5. Schonbeck, N. D., Skalski, M., and Shafer, J. A. (1974) J. Bwl.

6. O’Leary, M. H., and Payne, J. R. (1976) J. Biol. Chem. 2 5 1 ,

7. Schnackerz, K. D., Feldmann, K., and Hull, W. E. (1979) Bio-

8. Reed, T. A., and Schnackerz, K. D. (1979) Eur. J. Biochem. 9 4 ,

9. Schnackerz, K. D., and Feldmann, K. (1980) Biochem. Biophys.

10. Kazarinoff, M. N., and Snell, E. E. (1976) J. Bwl. Chem. 2 5 1 ,

11. Federiuk, C. S., and Shafer, J. A. (1981) J. Biol. Chem. 256 , 7416-7423

12. Schnackerz, K. D., Ehrlich, J. H., and Reed, T. A. (1973) Abstracts of the 9th International Congress on Biochemistry, p. 50, Stock- holm

13. Ehrlich, J. H., and Schnackerz, K. D. (1973) Hoppe-Seyler’s 2. Physiol. Chem. 3 5 4 , 1183-1184

14. Schnackerz, K. D., Ehrlich, J. H., Griesemann, W., and Reed, T. A. (1979) Biochemistry 18 , 3557-3563

15. Yang, I. Y., Huang, Y. A., and Snell, E. E. (1975) Fed. Proc. 3 4 , 496

16. Walsh, C., and Cheung, Y. F. (1976) J. Am. Chem. SOC. 98,3397- 3398

17. Schiltz, E., and Schmitt, W. (1981) FEBS Lett. 134 , 57-62 18. McFall, E., and Runkel, L. (1983) J. Bacteriol. 154 , 1508-1512 19. Maniatis, T., Fritsch, E. F., and Sambrook, J. (eds) (1982) Mo-

lecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor NY

20. Federiuk, C. S. (1982) Ph.D. dissertation, The University of Michigan

21. Mage, M. G. (1980) Methods Enzymol. 7 0 , 142-150 22. Heincz, M. C., Bornstein, S. M., and McFall, E. (1984) J. Bacte-

23. Carothers, A. M., McFall, E., and Palchaudhuri, S. (1980) J.

24. Bornstein-Forst, S. M., McFall, E., and Palchaudhuri, S. (1987)

25. McFall, E. (1975) J. Bacteriol. 121 , 1074-1077 26. Adelberg, E. A., Mandel, M., and Chein Ching Chen, G. (1965)

27. Bloom, F. R., McFall, E., Young, M. C., and Carothers, A. M.

28. Bloom, F. R., and McFall, E. (1975) J. Bacteriol. 121,1078-1084 29. McFall, E. (1964) J. Mol. Biol. 9 , 754-762 30. Schleif, R. F., and Wensink, P. C. (1981) Practical Methods in

Molecular Biology, Springer-Verlag, New York 31. Inouye, S., and Inouye, M. (1987) Synthesis and Applications of

DNA and RNA (Narang, S., ed) pp. 181-206, Academic Press, New York

4618-4628

4629-4635

Proc. Natl. Acud. Sci. U. S. A. 6 9 , 3297-3300

Chem. 250,5352-5358

Chem. 2 5 0 , 5359-5363

2248-2254

chemistry 18,1536-1539

207-214

Res. Commun. 95,1832-1838

6179-6182

rial. 160, 42-49

Bacteriol. 142 , 174-184

J. Bacteriol. 169, 1056-1060

Biochem. Biophys. Res. Commun. 18,788-795

(1975) J. Bacteriol. 121 , 1092-1101

32. Kidd, V. J. (1984) BRL Focus 6:3, 3-4 33. Yanisch-Perron. C.. Vicira. J., and Messing J. (1985) Gene f A m t J . .

33,103-109 . .

34. Dale. R. M. K.. McClure. B. A.. and Houchins, J. P. (1985) .~ ~

Plasmid 13 , 31-40

109-116

J. Biol. Chem. 257,8472-8480

35. Schiltz, E., and Schnackerz, K. D. (1976) Eur. J . Biochem. 7 1 ,

36. Koop, D. R., Morgan, E. T., Tarr, G. E., and Coon, M. J. (1982)

37. Penefsky, H. S. (1979) Methods Enzymol. 5 6 , 527-530 38. Maas, W. K., and Davis, B. D. (1950) J. Bacteriol. 60, 733-745 39. Chou, P. Y., and Fasman, G. D. (1974) Biochemistry 13,222-245 40. Nishikawa, K. (1983) Biochim. Biophys. Acta 748,285-299 41. Karplus, P. A,, And Schulz, G. E. (1985) Naturwissenschaften


72,212-213 42. Schonbeck, N. D. (1973) Ph.D. dissertation, The University of

43. Maxam A. M., and Gilbert, W. (1980) Methods Enzymol. 6 5 ,

44. Federiuk, C. S., Bayer, R., and Shafer, J. A. (1983) J. Biol. Chem.

45. Morino, Y., and Snell, E. E. (1967) Proc. Natl. Acad. Sci. U. S.

46. Chou, P. Y., and Fasman, G. D. (1977) J. Mol. Biol. 115 , 135-

47. Lipman, D. J., and Pearson, W. R. (1985) Science 2 2 7 , 1435-

48. Wilbur, W. J., and Lipman, D. J. (1983) Proc. Natl. Acad. Sci. U.

49. Datta, P., Goss, T. J., Omnaas, J. R., and Patil, R. V. (1987) Proc. Natl. Acad. Sci. U. S. A. 84,393-397

50. Kielland-Brandt, M. C., Holmberg, S., Petersen, J. G. L., and Nilsson-Tillgren, T. (1984) Carlsbeg Res. Commun. 4 9 , 567- 575

51. Lawther, R. P., Wek, R. C., Lopes, J. M., Pereira, R., Taillon, B. E., and Hatfield, G. W. (1987) Nucleic Acids Res. 15, 2137- 2154

52. Crawford, I. P., Nichols, B. P., and Yanofsky, C. (1980) J. Mol. Biol. 142,489-502

53. Deeley, M. C., and Yanofsky, C. (1981) J. Bacterwl. 147 , 787- 796

54. Titani, K., Koide, A., Hermann, J., Ericsson, L. H., Kumar, S., Wade, R. D., Walsh, K. A., Neurath, H., and Fischer, E. H. (1977) Proc. Natl. Acad. Sci. U. S. A. 74,4762-4766

55. Eveleth, D. D., Gietz, R. D., Spencer, C. A., Nargang, F. E., Hodgetts, R. B., and Marsh, J. L. (1986) EMBO J. 5. 2663-

Michigan

499-560

258,5379-5385

A. 57,1692-1699

175

1441

S. A. 80,726-730

56. 57.

58.

59.

60.

61.

62.

63.

64.

65.

66.

67.

2672 Gupta, M., and Coffino, P. (1985) J. Bwl. Chem. 260,2941-2944 Fonzi, W. A., and Sypherd, P. S. (1987) J. Bwl. Chem. 2 6 2 ,

Galakatos, N. G., and Walsh, C. T. (1987) Biochemistry 2 6 ,

Galakatos, N. G., Daub, E., Botstein, D., and Walsh, C. T. (1986)

Plamann, M. D., Stauffer, L. T., Urbanowski, M. L., and Stauffer,

Martini, F., Angelaccio, S., Pascarella, S., Barra, D., Bossa, F.,

Fry, D. C., Kuby, S. A., and Mildvan, A. S. (1986) Proc. Natl.

Dunathan, H. C., and Voet, J. G. (1974) Proc. Natl. Acad. Sci. U.

Sachsenheimer, W., and Schulz, G. E. (1977) J. Mol. Biol. 114 ,

Pai, E. F., Sachsenheimer, W., Schirmer, R. H., and Schulz, G.

Dreusicke, D., and Schulz, G. E. (1986) FEBS Lett. 208, 301-

Wierenga, R. K., Drenth, J., and Schulz, G. E. (1983) J. Mol.

10127-10133

8475-8480

Biochemistry 25,3255-3260

G. V. (1983) Nucleic Acids Res. 11, 2065-2075

and Schirch, V. (1987) J. Biol. Chem. 2 6 2 , 5499-5509

Acad. Sci. U. S. A. 83,907-911

S. A. 71,3888-3891

23-36

E. (1977) J. Mol. Bwl. 1 1 4 , 37-45

304

Biol. 167,725-739 68. Schulz, G. E., Schirmer, R. H., and Pai, E. F. (1982) J. Mol. Bid.

69. Wierenga, R. K., de Jong, R. J., Kalk, K. H., Hol, W. G. J., and Drenth, J. (1979) J. Mol. Bwl. 131 , 55-73

70. Adams, M. J., Buehner, M., Chandrasekhar, K., Ford, G. C., Hackert, M. L., Liljas, A., Rossmann, M. G., Smiley, I. E., Allison, W. S., Everse, J., Kaplan, N. O., and Taylor, S. S. (1973) Proc. Natl. Acad. Sci. U. S. A. 70: 1968-1972

71. Wierenga, R. K., and Hol, W. G. J. (1983) Nature 302,842-844 72. Hol, W. G. J., van Duijnen, P. T., and Berendsen H. J. C. (1978)

Nature 273,443-446 73. Parker, P. J., Coussens, L., Totty, N., Rhee, L., Young, S., Chen,

E., Stabel, S., Waterfield, M. D., and Ullrich, A. (1986) Science

160,287-308

233,853-859 74. Thatcher, D. R. (1980) Biochem. J. 187,875-886 75. Thatcher, D. R., and Retzios, A. (1980) Protides Bid. Fluids 28,

76. Parsonage, D., Wilke-Mounts, S., and Senior, A. E. (1987) J. Bwl. Chem. 262,8022-8026

77. Parsonage, D., Duncan, T. M., Wilke-Mounts, S., Kironde, F. A. S., Hatch, L., and Senior, A. E. (1987) J. Bid. Chem. 262,

78. Seeburg, P. H., Colby, W. W., Capon, D. J., Goeddel, D. V., and Arthur, D. L. (1984) Nature 3 1 2 , 71-75

79. McCormick, F., Clark, B. F. C., la Cour, T. F. M., Kjeldgaard, M., Norskov-Lauritsen, L., and Nyborg, J. (1985) Science 230, 78-82

157-160

6301-6307

80. Zhu, L., Cudny, H., and Deutscher, M. P. (1986) J. Bwl. Chem. ~ ~~

261,14875-14877 81. Simms, S. A., Cornman, E. W., Mottonen, J., and Stock, J. (1987)

82. Weber, I. T., Johnson, L. N., Wilson, K. S., Yeates, D. G. R., Wild, D. L., and Jenkins, J. A. (1978) Nature 274,433-437

83. McLaughlin, P. J., Stuart, D. I., Klein, H. W., Oikonomakos, N. G., and Johnson, L. N. (1984) Biochemistry 23,5862-5873

84. Oikonomakos, N. G., Johnson, L. N., Acharya, K. R., Stuart, D. I., Barford, D., Hajdu, J., Varvill, K. M., Melpidou, A. E., Papageorgiou, T., Graves, D. J., and Palm, D. (1987) Bwchem-

85. Ford, G. C., Eichele, G., and Jansonius, J. N. (1980) Proc. Natl. Acad. Sci. U. S. A. 77,2559-2563

86. Kirsch, J. F., Eichele, G., Ford, G. C., Vincent, M. G., and Jansonius, J. N. (1984) J. Mol. Bwl. 174,497-525

87. Arnone, A., Rogers, P. H., Hyde, C. C., Briley, P. D., Metzler, C. M., and Metzler, D. E. (1985) in Transaminases (Christen, P., and Metzler, D. E. eds) pp. 138-155, John Wiley & Sons, New York

88. Borisov, V. V., Borisova, S. N., Kachalova, G. S., Sosfenov, N. I., and Vainstein, B. K. (1985) in Transaminases (Christen, P., and Metzler, D. E. eds) pp. 155-164, John Wiley & Sons, New York

89. Harutyunyan, E. G., Malashkevick, V. N., Kochkina, V. M., and Torchinsky, Y. M. (1985) in Transaminases (Christen, P., and Metzler, D. E. eds) pp. 164-173, John Wiley & Sons, New York

J. Biol. Chem. 262,29-31

istry 26,8381-8389

d-serine dehydratase from escherichia coli

Documents