DETECTION OF EXTENDED SPECTRUM BETA LACTAMASE (ESBL) IN

HEALTH CARE ASSOCIATED INFECTIONS WITH SPECIES EXPRESSING

SHV1 AND /OR TEM1 GENE

SOHEIR F.HELAL, MONA A. WASSEF, IMAN K. BEHIRY, NADA N. NAWAR, GHADA A. ZIAD

Department of Clinical and Chemical Pathology, Cairo University, Egypt

Abstract :

Back ground: organisms that harbor extended spectrum beta lactamases (ESBLs) is a major

challenge for a diagnostic clinical microbiology laboratory.

Objective: To evaluate phenotypic characteristics, initial screening tests and established

confirmatory phenotypic methods for detection of ESBLs Klebsiella isolates prevalent in Cairo

university hospital.

Patients and Methods: Standard disk diffusion, double disk synergy test (DDST), combined disk

method, E test ESBL strip for detection of ESBL expression, as well as PCR analysis for detection

of TEM1 and SHV1 genes were done.

Result: Screening of Klebsiella species using oxyimino-cephalosporin disk diffusion method

showed 100% resistance (ESBL suspected) to cefpodoxime, 98% to cefotaxime, ceftriaxone and

aztreonam, 96% to ceftazidime, and 92% to cefepime. However DDST method detected the

presence of ESBL activity in 76% of isolates, and 98% by the combined disk diffusion test. The

ESBL activity was detected by E-test method in 46 isolates (92 %).

TEM1 gene was determined by PCR in (96%), and SHV1 was determined in (90%) of cases.

Conclusion: The combined disk diffusion test is an easy reliable method which showed the highest

incidence of ESBL detection followed by E test. However the DDST method showed the lowest

ESBL detection rate in comparison to the aforementioned confirmatory tests. The presence of

TEM1 and SHV1 genes was confirmed in a high incidence of ESBL isolates.

Key Words: Extended spectrum beta lactamases (ESBLs), E Test, TEM1 and SHV1 genes.

Introduction:

The oxyimino-cephalosporins, became widely used for the treatment of serious infections

due to gram-negative bacteria (1)

. Not surprisingly, resistance to these expanded-spectrum B-lactam

antibiotics due to B-lactamases emerged quickly. Because of their increased spectrum of activity,

especially against the oxyimino-cephalosporins, these enzymes were called extended-spectrum B-

lactamases (ESBLs) (2, 3)

. Klebsiella pneumoniae has been found to be the most common species to

produce extended- spectrum β- lactamases, and in some countries the prevalence of ESBL

production approached 50 % (4, 5)

.

ESBL producers are associated with increased morbidity and mortality, especially amongst

patients in intensive care and high-dependency units. These plasmid mediated enzymes mostly

evolved via point mutations of the classical TEM-1 and SHV-1 β-lactamases (6, 7)

. Moreover,

another key problem in the detection of ESBL producers is the possibility of low level production

of enzyme and effect of the inoculums, resulting in variable diameter zone by disk diffusion

testing. Therefore, specific detection methods such as the double disk synergy test (DDST),

combination disk method and E-test have been described (8)

. Accurate laboratory detection is

important to avoid clinical failure due to inappropriate antimicrobial therapy (1)

. In that respect a

comparative study was done to detect Klebsiella species

Despite the fact that there are large numbers of gram-negative clinical isolates that harbor

extended spectrum beta lactamases (ESBLs),very few clinical laboratories routinely perform ESBL

detection, especially in developing countries, due to costs involved and work load (9)

.

Expressing ESBL activity using 3 different methods; DDST, combined disk diffusion

method and E test. PCR analysis using oligonucleotide primers was used to detect TEM1 and

SHV1 genes.

Patients and Methods:

The study was conducted in Kasr EL-Aini -Cairo University hospital from December 2006

till May 2007. The study started with 382 gram negative isolates out of 512 examined specimens

and 104 Klebsiella species were identified (10)

. Klebsiella isolates obtained from urine specimens

were cultured on CLED, while pus, blood and sputum specimens were cultured on blood and

MacConkey agar and then incubated aerobically at 37°C for 24 hours. During the study period, all

strains of Klebsiella isolated were inoculated in broth glycerol and stored at -70°C for subsequent

PCR analysis.

Then antimicrobial susceptibilities for the Klebsiella isolates were done by standard disk

diffusion (SDD) using commercially available disks (oxoid, Basingstoke,UK) for different

antimicrobial agents; cefpodoxime (CPD), ceftazidime (CAZ), cefotaxime (CTX), aztreonam

(ATM), ceftriaxone (CRO), cefepime (CFP), cefoxitin (FOX), amikacin (AK), gentamicin (GM),

amoxicillin clavulanate (AMC), piperacillin-tazobactam (TZP), cefoperazone –sulbactam (SCF)

and imipenem (IMP) and were determined as per CLSI guidelines 2005 then isolates suspected for

being ESBL will be subjected to further confirmatory tests (11)

.

Screening for ESBL producers was done using CLSI recommendations by using Kirby-

Bauer disk diffusion (KB) techniques using CPD, CAZ, ATM, CTX and CRO (oxoid, Basingstoke,

UK) to identify potential ESBL harboring isolates (11, 12)

.

Phenotypic confirmatory test for ESBL production was determined by:

a) Double disk synergy test (DDST) which was performed using disks of 30 µg each of

CPD, CAZ , CTX, CRO, ATM (oxoid, Basingstoke, UK),) that were placed at the distance 20-25

mm from AMC (amoxicillin 20µg and clavulanic acid 10µg) centre to centre and incubated at

35°C overnight (13)

. A clearly visible extension of the edge of the inhibition zone of any disk

towards the amoxicillin clavulanic disk was interpreted as positive for clavulanic acid synergy (14)

.

b) Combined disk method was used as recommended by CLSI 2005 (11). A disk of

ceftazidime clavulanate (CAZ/CA) (30/10µg) and cefotaxime clavulanate (CTX/CA) (30/10µg)

were applied to the surface of the inoculated plate. Disks of CAZ and CTX were also applied. A >

5 mm increase in zone diameter for either antimicrobial agents tested in combination with

clavulanate versus its zone when tested alone was taken as an indication of ESBL producing isolate

(15).

C) E test ESBL strips (AB Biodisk, solna, Sweden) was used. It is a drug impregnated strip,

one end contains a gradient of ceftazidime TZ (MIC test range 0.5 to 32 µg/mL) and the other a

gradient of ceftazidime plus a constant concentration of clavulanate TZL (4µg/mL). An ESBL

phenotype was defined as : >8 fold reductions in the MIC of ceftazidime in the presence of

clavulanate or the presence of phantom or deformity zones (15)

, or a break point to ceftazidime (

MIC of TZ > 1 µg/ml). MIC TZ: MIC TZL ratio >32 : > 4 is considered indeterminate according to

the manufacturer recommendations and require further genotypic analysis.

Genotypic test for expression of TEM 1 and SHV1 was carried out as follows:

DNA extraction was done from Klebsiella species (grown on MacConkey agar) using a

DNA mini M48 kit (QIAGEN) and 100 µl of extracted DNA was stored at -20°C and ready to use.

PCR analysis was done using the following oligonucleotide primers (Sigma-Genosys) that are

specific for TEM1 and SHV1 genes. Sequence of primers were

bla SHV1 F 5' GGCCGCGTAGGCATGATAGA 3',

bla SHV1 R 5' CCCGGCGATTTGCTGATTTC 3 ',

bla TEM1 F 5'CAGCGGTAAGATCCTTGAGA 3' and

bla TEM1 R 5' ACTCCCCGTCGTGTAGATAA 3' (16)

.

PCR was performed in 50 µl (total volume) of distilled water containing each

deoxyribonucleotide at a concentration of 0.25 mM, 1.5 mM MgCl, 0.2 U of Taq DNA

polymerase, and 50 pmol of each primer. The temperature profile included an initial template

denaturation step consisting of 95°C for 10 min, followed by 30 cycles of 95°C for 30 sec, 55°C

for 1 min, and 72°C for 1 min and a final step consisting of 72°C for 7 min (16, 17)

. PCR product was

analyzed by gel electrophoresis using 2 % agarose, staining gel with Ethidium Bromide. A 50 bp

ladder was used, SHV1 gene band was detected at 720 bp, while TEM1 gene band was detected at

650 bp.

Results:

Out of a total of 382 gram negative clinical isolates, 104 Klebsiella species were identified,

79 (76%) were positive for ESBL production by standard disk diffusion screening technique. Only

50 out of the 79 were subjected to full ESBL production detection (the other 29 cases were

excluded from our study due to incomplete data). A large number (30%) of our suspected

Klebsiella ESBL isolates (by screening detection method) were isolated from patients in 3 ICUs

(surgical, neurology, and chest ICU), while 70% were isolated from patients in the 17 different

departments.

All the 50 patients with Klebsiella ESBL infections in our study had risk factors such as

prolonged hospital stay or repeated hospitalization, and previous treatment with antimicrobial

therapy. Forty eight of the patients (96%) were on β-lactam antibiotics and 43(86%) were on third

generation cephalosporins only. The 50 isolates of Klebsiella (ESBL) were isolated from 27 pus

samples (54%) (24 surgical wounds, and 3 diabetic foot swabs), 9 pulmonary secretions (18%), 8

urinary samples (16%), 5 blood samples (10%), and one Cerebrospinal Fluid (CSF) shunt (2%).

All the 50 Klebsiella (ESBL) species isolates were retested with DDST, combined disk

diffusion method, E-test, and PCR (for SHV1 and TEM 1genes detection). Results of screening of

Klebsiella species using oxyimino-cephalosporin disk diffusion method (KB) showed different

resistance results to the disks used (Table 1, Fig 1). All isolates were sensitive to imipenem, but

showed cross resistance to Ciprofloxacin in 26 isolates (52%) and to amikacin in 14 isolates (28%).

However DDST method (between different substrates and inhibition by clavulanic acid)

detected the presence of ESBL activity in 76% of the Klebsiella isolates (Fig 1).

Total positive strains for ESBL detected by DDST were 38(76%), while 49 (98%) were

revealed by both cefotaxime and ceftazidime combined disks. However 11(22%) isolates were

positive by combination disks and negative by DDST.

The ESBL activity was detected by E-test method (Table 1, Fig 2) in 46 isolates (92%).

Phantom phenomena was demonstrated in 6(12%) of the isolates. Two isolates were negative for

ESBL production by E-test, also showed sensitivity to CAZ and showed no phantom phenomena,

they expressed TEM1 and SHV1 genes. One of these 2 negative isolates was also negative for

ESBL production by the combined test, and DDST methods. Two other isolates were

indeterminate by E- test .Those indeterminate 2 isolates were negative for ESBL production when

tested by DDST but positive by other test methods and expressed TEM1 and SHV1 genes.

Comparing the 48 isolates diagnosed by E test (46 as positive ESBL and 2 as non ESBL);

ESBL activity was detected in 36/48(75%) isolates by both DDST (with CAZ) and E-test,

9/48(19%) were not detected by the DDST( positive by E-test) (Table 2). Number of tested isolates

positive for ESBL by DDST, Combination methods and E-Test were 37/48(77%).

TEM1 gene was determined by PCR in 48 strains (96%), and SHV1 was determined in 45

isolates (90%)(Table 1 and 2) . Forty three isolates (86%) were positive for both SHV1 and TEM1

genes, while five isolates (10%) were positive for TEM1 gene and two isolates (4%) revealed

SHV1 gene only. No strain was negative for both TEM1 and SHV1 genes.

(Fig 1)Percent of Klebsiella ESBL by Kirby-Bauer disk diffusion (KB) and Double disk

synergy test (DDST) . ceftazidime (CAZ), Cefotaxime (CTX), ceftriaxone (CRO), aztreonam

(ATM), cefepime (CFP) cefpodoxime (CPD)

Detection of Klebsiella ESBL by different antibiotics

by KB and DDST methods (50 isolates)

0

20

40

60

80

100

KB DDST

Test method

Per

cen

t

CAZ

CTX

CRO

ATM

CFP

CPD

Table (1): Results of positive ESBL isolated by different test methods:

KB= Kirby-Bauer disk diffusion, Double disk synergy test (DDST), ceftazidime

clavulanate (CAZ/CA), cefotaxime clavulanate (CTX/CA).

Klebsiella

spp. KB DDST

Combination disk

method

E-Test PCR

CAZ/CA CTX/CA

SHV-1 TEM-1

No of

positive

isolates

50 38 49 49

46

45 48

% 100 76 98 98 92 90 96

Table (2): Results of phenotypic and molecular gene detection methods in relation to E-

test in 48 isolates.

-ve = negative, +ve = positive., Double disk synergy test (DDST), ceftazidime clavulanate

(CAZ/CA) , cefotaxime clavulanate (CTX/CA).

*48isolates only of the 50 examined as two other isolates were in determined by E-Test and

couldn’t be considered positive or negative as sequencing method wasn’t included in our study.

PCR Combination

DDST

*E

-Tes

t

CTX/CA CAZ/CA TEM-1

SHV-1

-ve +ve -ve +ve -ve +ve -ve +ve -ve +ve

2 43 5 40 0 45 0 45 9 36 Positive

n=46

0 3 0 3 1 2 1 2 1 2 Negative

n=2

Fig( 2 )Muller Hinton agar showing E Test and combined disc of ceftazidime clavulanate

(CAZ/CA) , cefotaxime clavulanate (CTX/CA), ceftazidime (CAZ) and cefotaxime (CTX).

Discussion:

Extended-spectrum β-lactamases (ESBL) have widely spread throughout the world and are

now found in a significant percentage of Escherichia coli and Klebsiella pneumoniae strains in

certain countries. However Klebsiella pneumoniae is one of the most common pathogens causing

nosocomial infections that affect mainly immunocompromised patients with severe underlying

diseases (18)

.

Specific risk factors include length of hospital stay, severity of illness, time in the ICU,

intubation and mechanical ventilation, urinary or arterial catheterization, and previous exposure to

antibiotics (1)

. All patients with Klebsiella ESBL infection in our study had risk factors of

prolonged hospital stay and/ or repeated hospitalization, and previous treatment with antimicrobial

therapy.

Detection of ESBL producing Klebsiella by disk diffusion method in this study varied with

the cephalosporin tested. Cefpodoxime detected ESBL expression in 100 % of tested Klebsiella

when used with disk diffusion method and < 10% when used with DDST. DDST method detected

the presence of ESBL activity in 70% of our Klebsiella isolates with CAZ, 62% with CTX, and

increased to 76% when results obtained using both agents were taken into consideration, such

results were in accordance with other studies (19)

.

Numerous methods have been proposed for the detection of ESBLs in clinical isolates;

however none of the methods that rely on phenotypic expression of β-lactamase can detect every

ESBL- producing isolate. The failure of either MIC or disk tests alone to accurately detect the

presence of an ESBL in all strains of E.coli and K. pneumoniae has been well documented (20, 21)

. In

our study 9(19%) of ESBL producing Klebsiella isolates were positive by E-test and not detected

by the DDST, which was in accordance with Dashti et al., who reported that 16% of the ESBL

producing isolates were false negative by DDST and positive by E-test (22)

.

Overall, the DDST method was able to detect ESBL activity in 76% of our Klebsiella ESBL

isolates and similarly DDST method detected (75%) of isolates in Kuwait, but higher results were

given from United Kingdom (UK) (92.1%) (22)

.A study done by Bell et al. showed that there was

significant variation between participating countries (nine countries in the Asia-Pacific region)

with regard to both prevalence of ESBL-positive strains and the prevalence of non confirmed

strains in ESBL confirmatory tests (23)

. The combined disk diffusion method in our study detected

98% of ESBL producing Klebsiella isolates which was in accordance with M’Zali et al., who

detected 93% of ESBL by the same method (19)

.

The commercially available ESBL E test strip is a quantitative technique, and is widely

ranged as the ( gold standard) for detection in clinical laboratories of ESBL production, it detected

99.2% of the UK test isolates and 98% of the Kuwait isolates when both Cefotaxime and

Ceftazidime strips were used in conjunction (1, 22)

. In our study 92% of the screened ESBL

producing Klebsiella isolated were positive by E test.

TEM 1 gene was detected in 96 % of the Klebsiella isolates, while another study showed a

lower incidence of 17.3% (24)

.However, TEM 1 gene was detected in association with SHV1 gene

in several isolates (68%), thus it was not possible to presume if they were responsible for the ESBL

expression, as they could be non-ESBL encoding genes associated with another gene expressing

the ESBL phenotype as reported by Livermore 2008 (25)

.While also, co-production of several

ESBLs in a strain is common (26)

.

In the present study 90% of Klebsiella isolates expressed SHV-1 gene, however several

groups have reported that the high- level expression of SHV 1 in K. pneumoniae can cause the

MIC of ceftazidime to rise to levels at which an ESBL would be suspected, and can cause false-

positive in ESBL detection tests (1)

. The identification of bla SHV1 genes in the major part of

ESBL –Klebsiella strains cannot affirm those are ESBL-encoding genes and further studies will be

necessary to identify them precisely (24).

It could be concluded that the combined disk diffusion test method revealed the highest

percent for ESBL detection and remains a reliable method for detection of ESBLs and only

requires two disks to be added to the sensitivity plate, thus enabling all Gram- negative bacteria to

be screened in the diagnostic laboratory. The commercially available E test showed high

percentage of ESBL detection following the combined disk diffusion test and has been proposed as

simple technique for the detection of ESBL production. Although E test requires an extra agar plate

to be inoculated which could be difficult to be incorporated in a routine disk testing system, it is

widely ranged as the (gold standard) for detection in clinical laboratories of ESBL production. The

standard DDST requires careful spacing of disks for accurate results and showed the least

percentage of ESBL detection. Although molecular methods appear sensitive, they are expensive,

time consuming, and require specialized equipment and expertise. In this study further sequencing

for determination of SHV1 and TEM1 derivatives is recommended.

References:

1. Bradford P A; Extended-Spectrum β -Lactamases in the 21st Century: Characterization,

Epidemiology, and Detection of This Important Resistance Threat. Clin Microbiol Rev, 2001; 14:

933-951.

2. Kliebe C, Nies B A, Meyer J F, Tolxdorff-Neutzling RM. , Wiedemann B; Evolution of

plasmid-coded resistance to broad-spectrum cephalosporins. Antimicrob. Agents Chemother, 1985;

28: 302–307.

3. Oteo J, Lazaro F, de Abajo FJ, Baquero F, Campos J , Spanish members of EARSS;

Antimicrobial-resistant invasive Escherichia coli, Spain. Emerg Infect Dis, 2005; 11: 546-553.

4. Jain A, Mondal R; TEM and SHV genes in extended spectrum β-lactamase producing

Klebsiella species and their antimicrobial resistance pattern. Indian J Med Res, 2008 ; 128 : 759-

764.

5. Leavitt A , Chmelnitsky I , Colodner R, Ofek I, Carmeli Y , Navon-Venezia S;

Ertapenem Resistance among Extended –spectrum-β-Lactamase- producing Klebsiella pneumonia

isolates. J clin Micobiol, 2009;47: 969- 974.

6. Branger C, Zamfir O, Geoffroy S, Laurans G, Arlet G, Thien H V, Gouriou S, Picard B,

Denamur E; Genetic Background of Escherichia coli and Extended-Spectrum Beta-Lactamase

Type .Emerging Infectious Diseases, 2005 ; 11:54-61.

7. Oteo J, Navarro C, Cercenado E, Delgado-Iribarren A, Wilhelmi I, Orden B, Garcia C,

Miguelanez S, Perez-Vazquez M, Garcia-Cobos S, Aracil B, Bautista V, Campos J;

Spread of E.coli strains with High-Level Cefotaxime and Ceftazidime Resistance between

the community, long care facilities and hospital institutions. J Clin Microbiol, 2006; 44: 2359-66.

8. National committee for clinical laboratory standards; Performance standards for

antimicrobial testing 10th Information supplement , Wayne , Pennsylvania : National Committee

for clinical laboratory standards document, 2000; M100-s10.

9. Dandekar PK, Barrett NL, Nightingale CH, Nicolau DP; Utilization of extended-spectrum

beta-lactamase (ESBL) detection systems in microbiology laboratories: survey of Connecticticut

hospitals from 1998-2002.Conn Med, 2002; 67: 149-152.

10. Abbott SL; Gram negative enteric bacilli: In Manual of clinical Microbiology 9th. Ed by

Murray P. 2007.American Society for Microbiology Press. Washington D.C. pp 698-715.

11. Clinical Laboratory Standard Institute (CLSI); Performance standards for antimicrobial

susceptibility testing. Wayne, PA: CLSI 2005.

12. Bauer AW, Kirby W M M, Sherris JC , Tuck M; Antibiotics susceptibility testing by

standardized single disk method. Am J Clin Pathol, 1966; 45 : 493-496.

13. Manchanda V, Singh NP, Goyal R, Kumar A, Thukral SS; Phenotypic characteristics of

clinical isolates of Klebsiella pneumoniae and evaluation of available phenotypic techniques for

detection of extended spectrum beta-lactamases. Indian J Med Res, 2005; 122: 330-337.

14. Freitas ALP, Machado DP, Soares FSC, Barth AL; Extended-Spectrum β-lactamases in

Klebsiella spp. and Escherichia coli obtained in a Brazilian teaching Hospital: detection,

prevalence and molecular typing. Braz. J. Microbiol, 2003; 34: 344-348.

15. Tofteland S, Haldorsen B, Dahl KH, Simonsen GS, Steinbakk M, Walsh TR, Sundsfjord

A, Norwegian ESBL Study Group; Effects of Phenotype and Genotype on Methods for Detection

of Extended-Spectrum-β-Lactamase-Producing Clinical Isolates of Escherichia coli and Klebsiella

pneumoniae in Norway. J. Clin. Microbiol, 2007; 45: 199-205.

16. Chen S, Zhao S, White D G, Shroeder CM , Lu R , Yang H., McDermott PF, Ayers S ,

Meng, J; Characterization of Multiple-Antimicrobial-Resistant Salmonella Servoras Isolated from

Retail Meats. American Society for Microbiology, 2004; 70: l-7.

17. Clewell D B, An FY, White BA, Gawron-Burke C; Sex pheromones and plasmid transfer

in Streptococcus faecalis: a pheromone, cAM373, which is also excreted by Staphylococcus

aureus. Basic Life Sci, 1985; 30: 489-503.

18. Sahly H, Navon- Venezia S, Roesler L Hay A, Carmeli Y, Podschun R, Hennequin C,

Forestier C, Ofek I.. Extended-Spectrum β -Lactamase (ESBL) production is associated with an

increase in cell invasion and expression of fimbrial adhesions in Klebsiella pneumonia.

Antimicrobial agents and chemotherapy, 2008; 52: 3029-34.

19. M’Zali FH, Chanawong A, Kerr KG , Birkenhead D , Hawkey PM; Detection of

Extended-Spectrum β -Lactamases in members of the family Enterobacteriacea:comparison of

MAST DD test ,the double disk and the E test ESBL. J Antimicrob chemother, 2000; 45: 881-5.

20. Emery CL, Weymouth LA; Detection and clinical significance of Extended-

spectrum β -Lactamases in a tertiary- care medical center. J Clin Microbiol, 1997; 35: 2061-7.

21. Jacoby GA, Han P; Detection of Extended-Spectrum β -Lactamases in clinical isolates

of Klebsiella pneumonia and Eschericia coli. J Clin Microbiol , 1996; 34: 908-11.

22. Dashti AA, West P , Paton R, Amyes SGB; Characterization of Extended-Spectrum-β

Lactamases—producing Kuwait and UK strains identified by Vitek system and subsequent

comparison of the Vitek system with other commercial ESBL- testing system using these strains. J

Med Microbiol, 2006; 55: 417-21.

23. Bell J, Chitsaz M, Turnidge J, Barton M, Walters L, Jones R; Prevalence and

significance of a negative Extended-Spectrum β -Lactamase (ESBL) confirmation test result after a

Positive ESBL Screening test result for isolates of Escherichia coli and Klebsiella pneumonia:

Results from the SENTRY Asia-Pacific surveillance program. J clinical Microbiol, 2007; 45:1478-

1482.

24.Dropa M, Balsalobre LC, Lincopan N, Mamizuka EM, Murakami T, Cassettari VC,

Franco F, Guida SM, Balabakis AJ, Passadore LF, Santos SR, Matté GR, Matté MH; Extended-

Spectrum Beta- Lactamases among Enterbacteriaceae isolated in a public hospital in Brazil. Rev

Inst Med Trop S. Paulo, 2009; 51: 203-209.

25. Livermore DM.; Defining an extended- spectrum B-lactamase. Clin. Microbiol Infect,

2008;14: 3-10.

26. Minarini LAR, Climaco EC, Guimaraes DB Ferreira JC, Palazzo IC, Martinez R ,

Darini AL; Clonal transmission of ESBL- producing Klebsiella spp. At a university hospital in

Brazil. Curr. Microbiol, 2008; 56: 587-91.

المعبرة الكليبسيال لجرام السالبة العصيات في الكتماز لبيتا الممتد للمجال الجزيئي الكشف TEMو SHV ال لجينى

غادة علي زياد -ندا نبيل نوار -بحيرى كمال ايمان- زيز واصفمني عبد الع-سهير فتحى هالل جامعة القاهرة -كلية الطب الباثولوجيا اإلكلينيكية

ىالملخص العربللمضادات يعتبر من أهم أسباب المقاومة البكتيرية إنتاج إنزيمات البيتا الكتاميز إن

تحلل حلقة البيتاالكتام وتجعل المضاد الحيوى اإلنزيمات تؤدى الى حيث أن هذه (البيتاالكتام )الحيويةوالتي تفرز من بكتريا سالبة المجالأيضا البيتا الكتاميز الممتدة وتضم هذه المجموعة .فعال غير

واألزتريونام ويتم تثبيط عملها بحمض الكالفيولونك المجالبتحليل الكفالوسبورن ممتد الجرام حيث تقوم

. SHV , TEMتحمل جينات التى االبكتيري ومن هذه

الناتجة عن هذه االنزيمات أنها تحمل جينات لمقاومة تكمن المشكلة في عالج العدوى الكتامز لذلك فان خيارات العالج محدودة جدا تقتصر تقريبا على مضادات حيوية أخرى غير البيتا

.الكاربابينم

على بكتيريا الكلبسيال وقد تم عينة مختلفة يحتوى كال منها 104هذه الدراسة تضمنت القاهرة وذلك فى الفترة من من معمل البكتيريا بمستشفيات جامعة تجميعها من عينات مختلفة

وهذه العينات تم التعرف عليها من خالل الخصائص الشكلية 2007 حتى مايو 2006ديسمبريجابية للبيتا الكتميز الممتد إ مسحى والعينات التى أعطت نتيجةالكشف بالفحصها والكيميائية ثم تم

ثم عمل ( ESBL E –testو القرص المركب و اختبار )إالختبار المزدوج ب تم تأكيدها المجال SHV-1 .و TEM-1 عن جينيى ئىالكشف الجز

%( بواسطة إالختبار 76عينة ) 38فى المجالوقد تم الكشف عن البيتا الكتاميز الممتدة .المجالانزيمات البيتا الكتاميز الممتدة تنتج (%98) ةعين 49المزدوج و وجد أن

ولذلك .E-test أعطوا نتيجة إيجابية و تم تاكيدهم بإختبار عينة (%92) 46 و هناك بالمقارنة المجال %( للكشف عن البيتا الكتاميز الممتدة100حساسية ) القرص المركب ىأعط

من العينات 11في المجالإنتاج البيتا الكتميز الممتد %( لعدم الكشف عن 80إالختبار المزدوج )ب .بهذة الطريقة

على %( من الحاالت 90%( و) 96في ) SHV-1 و ال TEM-1تم الكشف عن جيني ال نقطة في هذه الجينات التي التوالى و وجود هذه الجينات مع النمط الظاهرى يؤكد حدوث طفرات

.يميزالنشاط االنتؤدي إلى تغيير عميق في