development of taqman real-time pcr markers targeting

Tunisian Journal of Plant Protection 25 Vol. 11, No. 1, 2016

Development of TaqMan Real-Time PCR Markers Targeting

Erwinia amylovora Chromosomal DNA

Dorsaf Yahiaoui, Centre Technique des Agrumes, Km 6, Route Grombalia Beni-

Khalled, Nabeul, Tunisia, Mohamed Chérif, Laboratoire de Phytopathologie,

Institut National Agronomique de Tunis, Université de Carthage, 43- Rue Charles

Nicolle, 1082 Tunis-Mahrajene, Le Belvédère, Tunisia, and Jong Hyun Ham, LSU

Life Sciences Building, Department of Plant Pathology and Crop Physiology, 110

LSU Union Square, Baton Rouge, LA70803-0106, Louisiana State University, USA __________________________________________________________________________

ABSTRACT

Yahiaoui, D., Chérif, M., and Ham, J.H. 2016. Development of TaqMan real-time PCR

markers targeting Erwinia amylovora chromosomal DNA. Tunisian Journal of Plant

Protection 11: 25-35.

From the earliest, Erwinia amylovora, the causal agent of the fire blight disease was considered an

invasive pest that threatened several pome fruit varieties elsewhere and disrupted their

commercialization. In this work, highly specific sets of real-time PCR fluorogenic primers and probes

flanking the 16S-23S rRNA intergenic transcribed spacer regions have been designed based on

TaqMan chemistry. Throughout a serial of validation trials, crucial reaction parameters have been

optimized. Therefore, the primer set ITSEA2 highlighted the most reliable signals in terms of gene

expression. With respect to conventional PCR tools, the newly developed molecular markers provided

more accurate specificity, a higher sensitivity up to 105 cfu/ml and a quantitative amplification of the

targets.

Keywords: Erwinia amylovora, ITS, molecular diagnosis, TaqMan real-time PCR

__________________________________________________________________________

Erwinia amylovora pathogen is

native from North America. Then, it has

been slowly spread into the European

Union region and reached the Eastern

Mediterranean area since the early 1980’s

(6). Currently, fire blight disease’s causal

agent is one of the most important

quarantine organisms among the A2

EPPO list (5), whereby introduction is

Corresponding author: Dorsaf Yahiaoui

Email: [email protected]

Accepted for publication 9 March 2016

prohibited by almost all countries. It is

either considered as the most destructive

disease of many pome fruit crops

(Rosaceae: Maloideae) including apple

(Malus domestica), pear (Pyrus

communis), quince (Cydonia oblonga),

medlar (Eriobotrya japonica), Crataegus

spp., etc… (17), but natural infections can

occur also in other plants such as

Japanese plum (Prunus salicina) (11) and

Rubus spp. (6).

As indicated by its name, fire

blight infection induces dark

discoloration of twigs and leaves as

though burned by fire. Depending on the

affected explants, the disease produces

blossom blight, shepherd’s crook twig


deformation and exudation of sticky-

milky ooze (17).

Within the Euro-Mediterranean

region, outbreaks of E. amylovora have

been depicted from most of the pome fruit

producing countries. So far, in the North

African area, E. amylovora foci have

been reported from Algeria and also from

Egypt. In spring 2012, the fire blight

disease has been reported from Tunisian

orchards for the first time (16); whereby

heavy losses have been occurred on pear

yields (cvs. Alexandrine and Williams)

that reached 75% value in some instances.

In order to maintain vigilance in pome

fruit orchards and to limit the spread of E.

amylovora ravages into uninfected areas,

governmental regulations dealt with

strengthening the international quarantine

measures in the borders, prohibiting the

introduction of any plant propagating

material (suckers, plantlets, etc.) from

risky countries and the establishment of a

large scale surveillance program. Up to

date, it still quiets hard to cure the fire

blight infestation once established.

Hence, early pathogen detection, removal

and eradication of inoculum’s sources are

of a paramount importance in order to

limit the spread of disease into pathogen-

free areas. Routine diagnosis of E.

amylovora, however, makes problematic

the detection of latent or symptomless

infections, which is critical since infected

budwood are the main means of the

disease dispersal within and between

countries and continents (2). From this

context, serological tests such as

immunofluorescence and ELISA are time

consuming and cause problems with

sensitivity and specificity. Polyclonal

antibodies may cross-react with other

plant-associated bacteria, resulting in

false positive results. Monoclonal

antibodies are often too specific to detect

all E. amylovora strains. Then, classical

PCR assays are mostly based on pEA29

plasmid sequence making them not

reliable enough to detect bacteria lacking

this plasmid (7).

Real-time PCR based assays have

been designed for detection of various

plant pathogens and have benefits such as

rapidity, automation, reduction in post-

PCR handling, high sensitivity, the

possibility of quantification, etc... (4). To

date, several quantitative PCR (qPCR)

protocols have been designed on the basis

of pEA29 plasmid (1, 3), meanwhile,

methods based on detection of

chromosomal DNA give the best choice

as screening tests. So far, the ribosomal

16S-23S intergenic transcribed spacer

regions (ITS) showed their convenience

in detecting many bacterial species (18).

The main goal undertaken by this

work is the design of reliable TaqMan

real-time PCR primer sets for molecular

fire blight diagnosis flunking the 16S-23S

rDNA ITS of most E. amylovora isolates.

MATERIALS AND METHODS Bacterial isolation and plant material.

E. amylovora suspicious bacteria

used in this work were obtained from

several locations in Louisiana State (LA,

USA), including asymptomatic pear and

apple field samples growing in the LSU

AgCenter Plant Diagnosis Center, in

addition to some other cultures kindly

provided by the LSU Plant Pathology

Laboratories (Table 1). Samples were

originally recovered from young shoots,

leaves and some blossoms. From the

collected field samples, maceration of

endophytic bacteria has been processed in

sterile 10 mM phosphate buffered saline

(PBS, pH 7.2) solution. Further surface

sterilization with 70% ethanol and 10%

sodium hypochlorite, the plant tissues at

the leading edge of shoot and leaf lesions

have been carefully cut into small pieces

and supplied with 500 μl of PBS buffer.

Then, samples were crashed with a sterile


pestle. By decantation, serial of dilutions

(1:10 fold) were made from the

supernatant. Then, a volume of 100 μl

from each dilution was dispensed in

Nutrient Agar (NA) solid media supplied

with cycloheximide (50 mg/ml).

Table 1. Bacteria samples used for the detection of Erwinia amylovora and their isolation sources

Code Location Host species

FB-A Civic Center, Houma (LA) Pyrus communis cv. Bradford

FB-B Abbeville, LA Malus domestica

FB-C New Orleans Botanical Garden, LA P. communis

FB-D New Orleans Botanical Garden, LA Western Mayhaw trees (Crataegus opaca)

EA’01 LSU Campus, LA Bacterial culture form P. communis

EA’05 LSU Campus, LA Bacterial culture form P. communis

Ea Std Bagalusa, LA Bacterial culture form P. communis

*Ea Std: a standard/reference strain of E. amylovora provided by LSU Plant Pathology lab and

used as positive control for the detection trials.

Among the endophytic bacteria

obtained from the plant tissues,

representative colonies sharing similar

morphological characteristics with the

bacteria of interest have been streaked

individually in solid Luria Burtani (LB)

medium, and incubated for 48-72 h at

30°C. On LB medium, a number of 18 E.

amylovora-like colonies showed circular

growth and creamy white consistence,

while, they had whitish smooth and

mucoid form when plated onto Potato

Dextrose Agar (PDA) medium.

Furthermore, aiming to screen E.

amylovora accessions among the isolated

colonies, bacterial suspensions have been

prepared from an enriched LB broth

medium and overnight incubated at 30°C

with shaking at 250 rpm. For accurate

identification, a recipient supplied with a

reference strain of E. amylovora culture

(hereafter designated as Ea Std) has been

included for comparison, in addition to

two negative controls containing only

sterile LB broth and Pseudomonas sp.

isolate, respectively.

Genomic DNA isolation and

conventional PCR amplifications.

Due to the low titer of culturable

population of E. amylovora in the

asymptomatic collected samples

(unfavorable weather conditions for fire

blight), the v/v enrichment of the

macerate have been prepared and

incubated overnight at 30°C. A standard

concentration of 108

cfu/ml has been set

up from each colony using a

spectrophotometer at OD600 nm. Then,

genomic DNA has been recovered from a

volume of 1.5 ml of Gram negative

bacterial suspensions using a commercial

silica-column-based DNeasy Plant Mini

Kit (Qiagen) following the

manufacturer’s instructions. Resulting

pellets were re-suspended in 50-100 μl of

TE buffer and stored at -20°C until use.

Quality of DNA has been checked by 1%

electrophoresis gel in 1X TBE buffer (89

mM Tris-Borate, 2 mM EDTA, pH 8)

prior to be stained with ethidium bromide

(200 ng/ml) and visualized under UV

light. Extracted DNA was subjected to

conventional PCR amplifications using a

standard pair of oligonucleotide primers

described by Weisburg et al. (1991);

specific to a broad spectrum of eubacteria

taxa flunking the 16S ribosomal DNA

(rDNA) (Table 2).


Table 2. Primers used for the 16S rDNA amplification from bacteria (18)

Primer

name Sequence 5’ – 3’

Amplicon

length

fd1 CCGAATTCGTCGACAACAGAGTTTGATCCTGGCTCAG ca 1500 bp rd1 CCGAATTCGTCGACAACAGAGTTTGATCATGGCTCAG

*fd1: Forward primers; rd1: reverse primers.

PCR reactions were made at a

final volume of 25 μl vessel including: 2

μl of DNA template, 10X PCR buffer, 10

mM deoxy-nucleotidetriphosphate

(dNTPs), 10 μM from each primer and 5

U/ μl Paq5000 Taq polymerase (Agilent,

USA). Cycling program consisted of 1

min at 95°C, then 34 cycles of 2 min

denaturation at 95°C, 30 s annealing at

42°C and 4 min elongation at 72°C; with

a final extension step of 20 min at 72°C.

PCR products were analyzed with 0.7%

agarose gel electrophoresis in 1X TBE

buffer. Later on, PCR amplicons from

positive samples have been purified using

the Qiagen PCR purification kit following

the manufacturer’s instructions. A volume

of 15 μl has been sent for sequencing.

Real-time PCR primers assay: design

and setup.

During this study, the 16S-23S

rDNA ITS was selected as target genomic

fragment for the design of E. amylovora

specific primers probes from the TaqMan

chemistry. Consensus sequences of 662

length fragments have been retrieved

from the publicly available NCBI

Genbank and were subjected to sequence

alignment using the default options of

CLUSTALX 1.8 (13), a Windows

interface for the CLUSTALW multiple

sequence alignment program.

A number of three sets of qPCR

primers and probes labeled with a

reporter fluorophore at the 5’ end and a

quencher dye at the 3’ end (hereafter

referred to as the ITSEA1, ITSEA2 and

ITSEA3) designed for the sensitive

detection of E. amylovora using the

GenScript Real-time PCR (TaqMan)

Primer Design program

(https://www.genscript.com/ssl-

bin/app/primer) to select a highly specific

region for most E. amylovora accessions

(Table 3).

Real-time PCR reactions were

performed on an ABI PRISM_ 7900 real-

time apparatus (Applied Biosystems)

following the cycling conditions of 2 min

at 50°C, 10 min at 95°C, followed by 45

cycles of 15 s at 95°C and 1 min at

different annealing temperatures.

Reaction vessel of 20 μl volume

contained, in final concentrations: 1 μM

each of FAM and TAMRA primers

(Bioneer, Republic of Korea), 400 nM

probe, 1X TaqMan Universal PCR

Master MixR (Applied Biosystems, USA)

and 1 μl of DNA template/sample. SDS

2.2.2 software (Applied Biosystems) was

used for fluorescence acquisition and

calculation of threshold cycles (Ct). The

baseline was set automatically and the

fluorescence threshold was set manually

to intersect with the linear part of the

amplification curves of all real-time PCR

assays, resulting in the final Ct value for

each well. Then, the slope (K) of the

linear regression line between logarithmic

values of cell numbers and Ct values was

used to calculate the amplification

efficiency (E) where a value of one

corresponds to 100% amplification

efficiency.


Table 3. TaqMan primers and probes designed for real-time PCR detection of Erwinia amylovora

Name Sequence 5’-3’ Posi-

tion

Tm

(°C)

Expected

amplicon

length

GC

(%)

TaqMan primer set 1: ITSEA1

ITSEAF1 CCTGTGGGTTGTGAGGTTAAG 543 62

95 bp

52.4

ITSEAR1 CCGTCGCTTTACGCAGATTA 618 62 50

ITSEAP1 FAM-CAGTCAGAGGCGATGAAGGACGTG-TAMRA 593 68 58


ITSEAF2 CGAGTCTCTCAAATGCTTGC 502 58.75

124 bp

45

ITSEAR2 GCAGATTAGCACGTCCTTCA 606 59.03 50

ITSEAP2 FAM-TGACTGCCTGGGCATCCACC-TAMRA 579 69.05 65


ITSEAF3 GCTTGGTGACAGGTGAAAGA 347 58.85

116 bp

50

ITSEAR3 ACGACACGTCGTTTCAATTT 443 58.13 40

ITSEAP3 FAM-TGCTCTTTAACAATCCGGAACAAGCTG-TAMRA 415 68.93 44.4

Performance characteristics of the

real-time PCR assays.

Firstly, the specificity of the

designed TaqMan primers and probes was

assessed throughout amplifications of

genomic DNA templates extracted from

some bacterial accessions belonging to

Pseudomonas spp. strains. Then, in order

to determine the limit of detection of each

real-time PCR assay, a serial of dilutions

(10 fold) of E. amylovora standard culture

(Ea Std) in sterile water ranging from

1.109 to 1.10

5 cfu/ml (3

replicates/dilution) has been performed.

The slope (K) of the linear regression line

between logarithmic values of cell

numbers (X-axis) and Ct values (Y-axis)

were used to calculate the amplification

efficiency, E = (10[-1/k]

) - 1, where a value

of one corresponds to 100% amplification

efficiency (14).

RESULTS Conventional PCR detection of E.

amylovora.

Using 16S universal primers, a

signal of 1500 bp length amplicons has

been yielded from almost all collected

samples (Fig. 1). Nevertheless, DNA

extracted from pear samples FB-A

relative to pear leaves that have been

collected from Houma (LA, USA) was

rarely amplified, while the FB-C, from

New Orleans botanical garden resulted

negative. Regarding the DNA targets

from Pseudomonas sp. and E. amylovora

reference strain, used primers often

yielded some unspecific amplifications.

Consensus sequences from the

positive PCR products delivered from the

samples FB-B and D showed over than

98% of nucleotide identity with 16S

ribosomal RNA of E. amylovora bc206

strain deposited in the GenBank under the

accession number: AF140338.1.

Performance characteristics of the

fluorogenic TaqMan qPCR markers.

As illustrated in Table 5, using

55°C as a polymerization temperature

fairly to the three qPCR primer sets and

using DNA from known E. amylovora

(Ea Std) strain in addition to nucleic acid

from other bacteria species and water

control (WC), a better amplification

signals were highlighted from the primer

set ITSEA2 (E value was around 114%)

compared to both ITSEA1 and 3;

whereby obtained E values were around

132 and 124%, respectively (Fig. 2).

Therefore, too low amount of inocula up

to 5 cfu/ml have been detected by all of

the designed primers (Table 4).


Fig. 1. DNA fragments amplified upon 16S rDNA region from blighted blossoms using universal primers in 0.7% agarose gel electrophoresis. M: 1Kb plus DNA

Ladder; Lanes 1 to 4: Bacterial DNA isolated from samples FB-A, B, C and D,

respectively; Lanes 5 and 6: Genomic DNA extracted from Ea’01 and Ea’05 cultures; WC: water control; Lane 7: genomic DNA from Pseudomonas spp.; Lane

+C: DNA extracted from reference E. amylovora culture.

Table 4. Average of Ct values of different samples during standardization of designed ITSEA TaqMan primers

Sample ITSEA1 ITSEA2 ITSEA3

Ct average Result Ct average Result Ct average Result

Ea Std 109 CFU/ml 22.62 + 18.04 + 22.57 +

Ea Std 108 CFU/ml 24.60 + 20.17 + 24.47 +

Ea Std 107 CFU/ml 27.58 + 23.72 + 27.52 +

Ea Std 106 CFU/ml 30.70 + 27.15 + 30.86 +

Ea Std 105 CFU/ml 33.21 + 29.61 + 33.58 +

Pseudomonas sp. No signal - No signal - No signal -

WC No signal - No signal - No signal -

Table 5. Average of Ct values of samples during standardization of designed ITSEA TaqMan primer

sets

Sample ITSEA1 ITSEA2 ITSEA3

Ct average Result Ct average Result Ct average Result

Ea Std 109 CFU/ml 22.13 + 21.27 + 26.00 +

Ea Std 108 CFU/ml 25.37 + 23.02 + 26.03 +

Ea Std 107 CFU/ml 27.70 + 26.73 + 28.91 +

Ea Std 106 CFU/ml 31.56 + 30.53 + 31.84 +

Ea Std 105 CFU/ml 34.73 + 33.95 + 35.99 +

Pseudomonas sp. No signal - No signal - No signal -

WC No signal - No signal - No signal -

In order to optimize the reaction

conditions for the different designed

qPCR primers, similar experiments have

been performed by increasing the

polymerization and cleavage temperature

up to 60°C and maintaining the same

reaction conditions previously proceeded.

As a result, all of the real-time

assays were found to be efficient for

detection of E. amylovora, and these

results were in accordance with the

characteristics of the target regions.

Meanwhile, higher sensitivity has

been shown by the ITSEA2 designed set

of primers (1.8 × 105 cfu/ml), and as

expected no non-specific amplifications

have been yielded from bacteria other

than E. amylovora DNA, such as

Pseudomonas sp. used as a biocontrol

agent. ITSEA2 primer set showed the best

amplification efficiency values and an

average square regression coefficient R2

of 98% (Fig. 3). Then, Ct values were

below 35 at the detection limit for all the

tested samples (Table 5), suggesting that

using this qPCR primer set pathogen

titres even less than 5 cfu/ml may be

efficiently detected.

M 1 2 3 4 5 6 wc 7 +c


Fig. 2a. qPCR standard curves yielded from Erwinia amylovora DNA using ITSEA 1 markers at polymerization

temperature of 55°C (FAM: 6-carboxyfluorescein).

Fig. 2b. qPCR standard curves yielded from Erwinia amylovora DNA using ITSEA 2 markers at polymerization


Fig. 2c. qPCR standard curves yielded from Erwinia amylovora DNA using ITSEA 3 markers at polymerization



Fig. 3a. qPCR standard curves yielded from Erwinia amylovora DNA using ITSEA 1 markers at polymerization


Fig. 3b. qPCR standard curves yielded from Erwinia amylovora DNA using ITSEA 2 markers at

polymerization temperature of 60°C (FAM: 6-carboxyfluorescein).

Fig. 3c. qPCR standard curves yielded from Erwinia amylovora DNA using ITSEA 3 markers at polymerization temperature of 60°C (FAM: 6-carboxyfluorescein).


DISCUSSION E. amylovora is a plant pathogenic

bacterium whereby disease management

closely depends on rapid and specific

detection of the bacteria. Currently,

microbiological approaches developed for

fire blight detection such as culturing in

semi-selective media, ELISA,

immunofluorescence, etc..., are time

consuming and lucking either specificity

or sensitivity. Furthermore, almost

molecular diagnostic protocols were

targeting the pEA29: a 29 kb ubiquitous

plasmid that is able to increase the

bacteria fitness during colonization of

host species (1).

Nevertheless, the inartificial loss

of E. amylovora isolates to their plasmid

during host propagation or by successive

laboratory isolation assays, in addition to

the occurrence of plasmid-free bacteria in

nature (10) makes unreliable the

screening of all E. amylovora strains

using the classical PCR assays. From this

standpoint, application of real-time PCR

technology afforded several advantages

with respect to previously described

trials, relevant to inoculum quantization,

sensitivity and post PCR handling.

Therefore, the major output

afforded by this investigation is to give

better reliability of this bacterium

diagnosis even from symptomless

samples; through the development of

fluorogenic real-time molecular markers

flanking the chromosomal ITS fragments

and specific to E. amylovora isolates,

regardless to their plasmid profile.

Aiming to improve the robustness of the

assays, qPCR reaction mixtures and

cycling conditions have been accurately

standardized. Consequently, the ITSEA2

set of TaqMan DNA markers yielding

124 bp sized fragment was the most

reliable, since it showed the highest

specificity level with no cross-reactions

with other bacterial species tested. In

accordance with previous works dealing

with ITS-based markers, the 124 bp

sequence was amenable to greater

throughput sensitivity owing to its high

copy number within the studied region

(9).

Low bacterial titres up to 1.8 ×

105 cfu/ml have been detected showing

the consistent sensitivity of the described

qPCR markers making them suitable for

latent testing, when bacteria concentration

is below the detection limit of serological

methods (15), and/or it occurs in viable,

but not culturable state (VBNC) (12).

Moreover, this funding afforded

contribution to the trustworthy detection

of the fire blight causal agent with respect

to other routine diagnostic tools, such as

the conventional PCR method; by the use

of a third oligonucleotide in TaqMan

probe which potentially resulted in a

higher specificity. As any real-time PCR

assay, the present trial gave additional

advantages to routine detection tools

including quickness, quantization of the

inoculum amount and direct visualization

of the amplification signals.

ACKNOWLEDGMENTS

This research is dedicated with deepest thanks and

love in memory of Prof. Mohamed Chérif, the

former Director General of the Technical Center of

Citrus, for his enlightening knowledge and uncompromising passion; humble prayers to the

man and his life of devotion to all of us. As well,

thanks to all the collaborators from the United States Department of Agriculture Office (USDA), LSU

Department of Plant Pathology and Crop Physiology

which helped the authors to accomplish this project and allowed them to achieve this work.


_________________________________________________________________________

RESUME

Yahiaoui D., Chérif M. et Ham J.H. 2016. Développement de marqueurs moléculaires

TaqMan de la PCR en temps réel ciblant l’ADN chromosomique d'Erwinia amylovora.

Tunisian Journal of Plant Protection 11: 25-35.

Depuis toujours, Erwinia amylovora, agent causal de la maladie du feu bactérien, a été considéré

comme un ravageur envahissant ayant anéanti certaines variétés locales de pomacées partout dans le

monde et perturbé l’économie internationale. Dans cette étude, des amorces et des sondes fluorescentes

du type TaqMan de la PCR en temps réel ont été conçues à partir de la région de l’espaceur

intergénique transcrit (ITS) de l’ADN ribosomal 16S-23S rARN. Des essais de validation ont permis

d’optimiser les paramètres cruciaux de la réaction. Comme résultat, la meilleure amplification du

pathogène en matière d’expression génomique a été envisagée par l’ensemble des amorces et sonde

ITSEA2. Par ailleurs, les marqueurs moléculaires développés au terme de ce travail ont apporté plus de

spécificité, une sensibilité plus élevée allant jusqu’à 105 cfu/ml et une quantification des cibles

amplifiées par comparaison à la PCR conventionnelle.

Mots clés: Diagnostic moléculaire, Erwinia amylovora, ITS, PCR en temps réel TaqMan

__________________________________________________________________________

ملخص التضخيم البوليمرازي جزيئية لتقنية . تصميم علامات2016هيان هام. غ اليحياوي، درصاف ومحمد الشريف وجون

Erwiniaعلى أساس الحمض النووي الكروموزومي للبكتيريا في الوقت الحقيقي TaqManالتسلسلي

amylovora.Tunisian Journal of Plant Protection 11: 25-35.

المسببة لمرض اللفحة النارية كآفة غازية لطالما تسببت في استئصال كثير من Erwinia amylovoraصُنفت البكتيريا

الأصناف المحلية من التفاحيات وإحداث خسائر اقتصادية هامة بعديد الدول. اهتم هذا العمل بتصميم علامات جزيئية

من الحمض النووي الكروموزومي للكشف الدقيق عن ITS -23S16Sعلى أساس المنطقة TaqManمشعّة من نوع

عديد من التجارب قصد ضبط مختلف معايير البكتيريا بتقنية التفاعل البوليمرازي المتسلسل في الوقت الحقيقي. تم إجراء ال

الاختبار من حيث التضخيم الجيني للبكتيريا. وبالمقارنة مع طرق ITSEA2علاماتالتفاعل. كما أثبتت النتائج نجاعة ال

حيث تم الكشف بنجاح عن تركيزات تعدّ ضئيلة جدّا الجزيئي التقليدي، أضفت هذه التقنية المطوّرة دقة وحساسية عاليتين

10من الخلايا البكتيرية إلى حدود 5 القياس الكمّي للأجسام.مع إمكانية لمستعمرة/مل وحدة مشكلة

ITS، Erwiniaفي الوقت الحقيقي، TaqManبوليمرازي متسلسل تفاعل تشخيص جزيئي، كلمات مفتاتحية:

amylovora

__________________________________________________________________________

LITERATURE CITED

1. Bereswill, S., Pahl, A., Bellemann, P., Zeller, W., and Geider, K. 1992. Sensitive and

species-specific detection of Erwinia

amylovora by PCR-analysis. Appl. Environ. Microbiol. 58: 3522-3526.

2. Bonn, W.G. and Van der Zwet, T. 2000.

Distribution and economic importance of fire blight. Pages 37-53. In: Vanneste JL, (Ed),

Fire Blight. The Disease and its Causative

Agent, Erwinia amylovora. CABI Publishing,

Wallingford, UK .

3. De Bellis, P., Schena, L., and Cariddi, C. 2007.

Real-time Scorpion-PCR detection and quantification of Erwinia amylovora on pear

leaves and flowers. Eur. J. Plant Pathol. 118: 11-22.

4. Dreo, T., Gruden, K., Manceau, C., Janse, J.D.,

and Ravnikar, M. 2007. Development of a real-time PCR-based method for detection of

Xylophilus ampelinus. Plant Pathol. 56: 9-16.

5. EPPO, 2013. European and Mediterranean Plant Protection Organization. Diagnostic protocols

for regulated pests PM 7/20, Erwinia

amylovora. EPPO Bull. 34: 159-171.

6. EPPO, 1983. Data sheets on quarantine

organisms N°52, Erwinia amylovora. EPPO

Bull. 13(1): 6 pp.


7. Evans, I.R. 1996. Fire blight of raspberries in Alberta. Acta Hortic. 411: 69-72.

8. Llops, P., Donat, V., and Rodriguez, M. 2006.

An indigenous virulent strain of Erwinia amylovora lacking the ubiquitous plasmid

pEA29. Phytopathology 96: 900-907.

9. McGhee, G.C., Schnabel, E.L., and Maxson-Stein, K. 2002. Relatedness of chromosomal

and plasmid DNAs of Erwinia pyrifoliae and

Erwinia amylovora. Appl. Environ. Microbiol. 68: 6782-6192.

10. Mohammadi, M., Moltmann, E., Zeller, W., and

Geider, K. 2009. Characterisation of naturally occurring Erwinia amylovora stains lacking

the common plasmid pEA29 and their

detection with real-time PCR. Eur. J. Plant

Pathol. 124: 293-302.

11. Mohan, S.K. and Thomson, S.V. 1996. An outbreak of fire blight in plums. Acta Hortic.

411: 73-76.

12. Ordax, M., Marco-Noales, E., Lopez, M.M., and Biosca, E.G. 2006. Survival strategy of

Erwinia amylovora against copper: induction

of the viable-but-nonculturable state. Applied and Environmental Microbiology: 72, 3482-

3488.

13. Pearson, W. and Lipman, D. 1988. Improved tools for biological sequence comparison.

Proc. Nat. Acad. Sci., USA 85: 2444-2448.

14. Pfaffl, M.W. 2001. A new mathematical model for relative quantification in real-time RT-

PCR. Nucl. Acids Res 29: 2002-2007.

15. Pirc, M., Ravnikar, M., Tomlinson, J., and Dreo, T. 2009. Improved fire blight

diagnostics using quantitative real-time PCR

detection of Erwinia amylovora chromosomal DNA. Plant Pathol. 58: 872-881.

16. Rhouma, A., Helali, F., Chattaoui, M.,

Hajjouji, M., and Hajlaoui, M.R. 2014. First report of fire blight caused by Erwinia

amylovora on pear in Tunisia. Plant Dis. 98:

158. http://dx.doi.org/10.1094/PDIS-05-13-

0542-PDN.

17. Van der Zwet, T. and Beer, S. 1995. Fire blight: its nature, prevention and control. A practical

guide to integrated disease management,

USDA. Agricultural Information Bulletin N° 631, Washington DC, USA.

18. Weisburg, W.G., Barns S.M., Pelletier, D.A.,

and Lane, D.J. 1991. 16S Ribosomal DNA amplification for phylogenetic study. J.

Bacteriol. 173: 697-703.

---------------------

development of taqman real-time pcr markers targeting

Documents