Supporting Information for Zhou et al., J. Am. Chem. Soc. page S1

DNA-Catalyzed Amide Hydrolysis

Cong Zhou, Joshua L. Avins, Paul C. Klauser, Benjamin M. Brandsen, Yujeong Lee, and Scott K. Silverman*

Department of Chemistry, University of Illinois at Urbana-Champaign, 600 South Mathews Avenue, Urbana, Illinois 61801, United States

Table of Contents

Oligonucleotides and amide substrate ............................................................................................ page S2 2-Deoxynucleotide 5-triphosphates and 2-deoxynucleoside 3-phosphoramidites ..................... page S3 In vitro selection procedure ............................................................................................................ page S4 Selection progressions .................................................................................................................... page S7 Sequences of individual deoxyribozymes ...................................................................................... page S8 Procedure for preparing modified deoxyribozymes by primer extension ...................................... page S8 Single-turnover deoxyribozyme assay procedure .......................................................................... page S8 Mass spectrometry procedure ......................................................................................................... page S9 Assaying 3-binding arm of AmideAm1 for AmdU requirements ................................................... page S9 Assaying T34 and T38 of AmideAm1 for AmdU requirements ...................................................... page S10 Assaying catalysis by COOHdU deoxyribozymes AmideCa1 and AmideCa2 .................................. page S11 Assaying 3-binding arm of HOdU deoxyribozymes for HOdU requirement .................................... page S12 Assaying deoxyribozymes for divalent metal ion requirements .................................................... page S13 Organic synthesis procedures ......................................................................................................... page S13 References for Supporting Information .......................................................................................... page S16

Full versioE.; Zhang,Dumontier Full versioEaton, B. EGupta, S.; Keeney, T.W.; MehanOtis, M.; PStanton, MS.; Weiss, A Full versioWaugh, S. Jarvis, T. C Full versioM.; IshikawBiol. Chem Full versioS.; Ishikaw

OligonuclDNA

by solid-oligonucleTris and bmM Tris, The amidsubstrate i

Synthe200 nmolsupport wnext coutriethylamdissolved introducedwith mixinwith DMF

on of ref. 6b: M X.; Beking, , M.; DeRosa,

on of ref. 12b: E.; Fitzwater, Halladay, D.;

. R.; Kim, N.; n, M.; Mehler,Parker, T.; Pietr

M.; Sterkel, A.; A.; Wilcox, S.

on of ref. 12e:M.; Wolk, S.

C. Proc. Natl. A

on of ref. 12i: Gwa, Y.; Jarvis,

m. 2014, 289, 87

n of ref. 12j: Gwa, Y.; Hirota, M

leotides and aoligonucleoti

-phase syntheotides were boric acid andpH 8.0, 1 m

e substrate win our previou

esis of 3′-COl) was deprot

was rinsed witupling step mmonium salt

in 500 µL od into the DNng every 5 mF (3 5 mL)

Supporting

McKeague, M.M.; Francis, TM. C. J. Mol. E

Gold, L.; AyerT.; Flather, DHeil, J.; Heili

Koch, T. H.; K R.; Nelson, Srasiewicz, S.; RStewart, A.; SK.; Wolfson, A

: Davies, D. R K.; Mayfield

Acad. Sci. USA

Gupta, S.; Hiro, T. C.; Carter,706.

Gelinas, A. D.; M.; Nakaishi, Y

amide substratides were obt

hesis on an purified by 7d 2 mM EDT

mM EDTA, 30was synthesizeus report.2

O2H oligonucltected with Tth 2% (v/v) N

and dried (48 mg, 100

of dry DMF.NA synthesis

min for the firand CH2Cl2 (

g Information

; McConnell, ET.; GiamberardEvol. 2015, 81

rs, D.; Bertino.; Forbes, A.; ig, J.; Hicke, BKraemer, S.; KS. K.; Nelson, Resnicow, D. I

Stratford, S.; VA.; Wolk, S. K

R.; Gelinas, A, W. S.; Burgi

A 2012, 109, 19

ota, M.; Waugh, J. D.; Zhang,

Davies, D. R.;Y.; Jarvis, T. C

te tained from In

ABI 394 i7 M urea denaTA, pH 8.3), 00 mM NaCled using proc

eotide. 5′-DMTCA/CH2Cl2

NMM/CH2Cl2

under a sµmol), HATU. NMM (26 column via t

st 1 h and no(3 5 mL) an

for Zhou et al

E. M.; Cruz-Tdino, A.; Cab

1, 150.

, J.; Bock, C.; Foreman, T.;

B.; Husar, G.; Kroiss, L.; Le, N

M.; NieuwlanI.; Rohloff, J.;

Vaught, J. D.; VK.; Zhang, C.; Z

. D.; Zhang, Cin, A. B.; Edw

9971.

h, S. M.; Mura, C.; Gawande

; Edwards, T. EC.; Janjic, N. J.

ntegrated DNinstrument uaturing PAGEextracted fro), and precipcedures simil

MT-thymidine(3 1 mL)

2 and CH2Cl2

stream of nU (38 mg, 10µL, 230 µmtwo syringes.

o mixing for tnd dried unde

l., J. Am. Chem

Toledo, J.; Bernbecinha, A.; R

Bock, A.; BroFowler, C.; GJanjic, N.; Ja

N.; Levine, D.;ndt, D.; Nikrad

Sanders, G.; SVrkljan, M.; WZichi, D. PLoS

C.; Rohloff, Jwards, T. E.; S

akami, I.; Suzue, B.; Vrkljan,

E.; Rohloff, J. J. Biol. Chem. 2

NA Technologusing reagenE with runninom the polyacitated with etlar to those u

e-derivatized and washed (3 5 mL) t

nitrogen. O-00 µmol), and

mol) was adde. The couplinthe remaininger a stream of

m. Soc.

nard, E. D.; PaRuscito, A.; Ar

ody, E. N.; CarGawande, B.; Garvis, T.; Jenni; Lindsey, W.;

d, M.; OchsnerSattin, S.; Schn

Walker, J. J.; WS ONE 2010, 5,

. C.; Carter, JStewart, L. J.;

uki, T.; MuragM.; Janjic, N

C.; Carter, J. D2014, 289, 872

gies (Coralvilnts from Glng buffer 1 crylamide withanol as desused to prepa

CPG solid suwith CH2Cl

to improve th-(4,4′-Dimeth

d HOBt (14 med to this song step was pg 15 h. The cof nitrogen. Th

p

ach, A.; Mastroranda-Rodrigue

rter, J.; Dalby, Goss, M.; Gunings, S.; Katili Lollo, B.; Ma

r, U.; Ostroff, neider, D.; Sing

Watrobka, M.; W, e15004.

J. D.; O'ConneGold, L.; Janj

uchi, M.; Shib.; Schneider, D

D.; Zhang, C.; 0.

lle, IA) or prelen ResearchTBE (89 mMith TEN buffscribed previoare the ester-l

upport (40 µml2 (3 5 mL)he efficiency hoxytrityl)gly

mg, 100 mol)olution, whichperformed forolumn was whe remainder

age S2

onardi, ez, R.;

A. B.; nn, M.; ius, E.; ayfield, R. M.;

ger, B.; Waugh,

ell, D.; jic, N.;

bamori, D. J. J.

Gupta,

epared h. All

M each fer (10 ously.1 linked

mol/g; ). The of the

ycolate ) were h was r 16 h

washed of the

oligonucleoligonucleNaOH in 4precipitateammoniumMALDI-M

Syntheon the ABphosphoradeoxythym

SolutiA 45 µL soligonucleheating at CGCCATCTunpaired, The reactiM NaCl, 5sample wPAGE. M

2-DeoxynThe A

5-triphospphosphoraGlen ReseThe COOHduridine as

eotide was syeotide from t4:1 MeOH:Hed with ethanm hydroxide MS [M+H]+ cesis of 5′-amBI 394 instruamidite (Glemidine residu

ion-phase cousample contaieotide, and 5.95 °C for 3 mTCTTCATAATand the underion was initia50 mM EDC,

was incubatedMALDI-MS [M

nucleotide 5-mdU 5-triphophate (HOdUamidite was frearch (cat. nodU 5-triphosdescribed in

Supporting

ynthesized onthe CPG and

H2O for 24 h anol. The depfor 16 h at 55

calcd. 6239.1,ino-5′-deoxyt

ument using sen Researchue.

upling of 3′-Cining 4.0 nmo0 nmol of DNmin and cooliTAGTGAGTCGTrlined region

ated by bringi, 50 mM HOB

d at room temM+H]+ calcd.

-triphosphatesosphate (AmdU

UTP) was ffrom Berry & . 10-1035). Tsphate (COOHda subsequent

g Information

n the ABI 394 nucleobase

at room tempeprotection wa5 °C. The sam found 6237.7thymidine oligstandard proc), providing

CO2H oligonuol of 3′-CO2HNA splint wasing on ice forTATTATCCAAis included to

ing the samplBt, and 5% (vmperature for12113.0, fou

s and 2-deoxyUTP) was frofrom TriLinAssociates (c

The HOdU phodUTP) was st section of th

for Zhou et al

4 instrument deprotection erature. The sas completed

mple was dried7. gonucleotide.

cedures and Mg an oligon

cleotide and H oligonuclotis annealed in r 5 min. The sACAACAACAACo shift the splle to 50 µL vov/v) DMF, whr 24 h, preci

und 12113.8.

ynucleoside 3om TriLink Bnk BioTechncat. no. BA03

osphoramiditesynthesized fhis document.

l., J. Am. Chem

using standawere perform

sample was dd by treating d under vacuu

. OliogonucleMMT-protectnucleotide te

5′-amino-5′-dide, 6.0 nmol110 mM MO

sequence of tCAACAAC-3′, lint away fromolume containhich was requipitated with

3-phosphoramioTechnologinologies (ca311). The COO

e was from Glfrom (E)-5-(2

m. Soc.

ard proceduremed using 20

diluted to 600 the sample

um and purifi

eotide syntheted 5′-amino-erminating i

deoxythymidinl of 5′-amino-OPS, pH 7.0, athe DNA splin

where them the desired ning 100 mMuired to dissoethanol, and

midites ies (cat. no. Nat. no. N-0OHdU phospholen Research 2-carbometho

p

es. Cleavage 00 µL of 400µL with watewith concen

fied by 20% P

esis was perfo-5′-deoxythymin a 5′-ami

ne oligonucle-5′-deoxythymand 1.1 M Nant was 5′-CGAe boldface

product on PM MOPS, pH olve the HOBd purified by

N-0249). The0259). The oramidite was(cat. no. 10-1

oxyvinyl)-2-d

age S3

of the 0 mM er and

ntrated PAGE.

formed midine ino-5′-

eotide. midine aCl by AAGT-T is

PAGE. 7.0, 1

Bt. The y 20%

HOdU AmdU

s from 1093). deoxy-

In vitro seThe se

as describoverview steps withCATCTCTTincludes min the N40

phosphoraGGATCAGCwas especconvenienstandard (pool at itsligase. ThCACTAT-3at the 3-eused for liuntemplatamino capThermo F

Figure S1.step. See teis the HEGthe two PColigonucleoinitially ran

election proceelection procebed previouslof the key se

h nucleotide dTC-N40-ATAGTmodified nucl0 region withamidite. PrimCT-3, where cially long tonce, the same(AAC)4 tail cs 3-end with he ligation spl3, where the end of each PCigation of the ted A. Nucleopture oligonucisher. KOD X

. Nucleotide deext for details o

G spacer (Glen CR product strotide and the ndom region or

Supporting

edure edure, cloningy,2 with addilection and ca

details is showTGAGTCGTATleotides. Eachh one of AmdU

mers were 5-CX is the HE

o assure PAG tail length w

can be used ithe 5-end oflint sequenceunderlined TCR product binitially rand

otide sequenccleotide, and

XL polymeras

etails of the seof PCR and priSpacer 18) thaands. Note thacarboxyl groupr 3-binding arm

g Information

g, and initial itional steps tapture steps o

wn in Figure STTAAGCTGATCh random pooU, COOHdU, oCGAAGTCGCCAEG spacer to GE separatio

was used withinstead. In eaf the amide su was 5-ATAG is included t

by KOD XL pdom N40 pool,ces of the amthe capture s

se was from N

lection and capimer extension at stops extensat the capture sp of the hydrom do not react

for Zhou et al

screening of to enable incof each roundS1. The randoCCTGATGG-3ol was preparor HOdU usinATCTCTTC-3stop Taq pol

on of templath the HOdU anach round, thubstrate was pGTGAGTCGTATto account forpolymerase. T, which was p

mide substratesplint are showNovagen.

pture steps of iusing the forw

ion by DNA psplint enforcesolysis product,appreciably du

l., J. Am. Chem

individual clocorporation od is shown in om deoxyribo, where the

red by solid-png the corresp

(forward prilymerase (revte and AmdU-nd COOHdU m

he ligation steperformed usATTATCCTCCAr the untempl

This T nucleoprepared by soe, the deoxyrwn in Figure

in vitro selectiward and reverspolymerase ands proximity of , such that amuring the captu

m. Soc.

ones were perof the modifie

Figure 1C. Aozyme pool we initially raphase synthesponding 2-deimer) and 5-(verse primer)-modified pr

modifications, ep to attach tsing a DNA sATCAGGATCAlated A nucletide was omitolid-phase syribozyme binS1B. T4 DN

ion. (A) Selectise primers. In td leads to a sizf the 5-amino

mino or carboxyure step incuba

p

rformed essened nucleotide

A depiction ofwas 5-CGAAGTandom N40 ris, replacing eoxynucleosi(AAC)18XCCA. The (AAC)

roduct strandalthough the

the deoxyribosplint and T4 AGCTTAATACGeotide that is tted from the

ynthesis withonding arms, tNA ligase was

ion step. (B) Cthe reverse prim

ze difference begroup of the cyl groups with

ation time.

age S4

ntially es. An f these TCGC-region all dT de 3-ATCA-

18 tail s. For

e more ozyme

DNA GACT-added splint

out the the 5-s from

Capture mer, X etween capture hin the

Supporting Information for Zhou et al., J. Am. Chem. Soc. page S5

Procedure for ligation step in round 1. A 25 µL sample containing 600 pmol of modified DNA pool, 700 pmol of DNA splint, and 800 pmol of amide substrate was annealed in 5 mM Tris, pH 7.5, 15 mM NaCl, and 0.1 mM EDTA by heating at 95 °C for 3 min and cooling on ice for 5 min. To this solution was added 3 µL of 10 T4 DNA ligase buffer and 2 µL of 5 U/µL T4 DNA ligase. The sample was incubated at 37 °C for 12 h and purified by 8% PAGE.

Procedure for ligation step in subsequent rounds. A 16 µL sample containing the modified DNA pool

synthesized by primer extension (~5–10 pmol), 25 pmol of DNA splint, and 50 pmol of amide substrate was annealed in 5 mM Tris, pH 7.5, 15 mM NaCl, and 0.1 mM EDTA by heating at 95 °C for 3 min and cooling on ice for 5 min. To this solution was added 2 µL of 10 T4 DNA ligase buffer and 2 µL of 1 U/µL T4 DNA ligase. The sample was incubated at 37 °C for 12 h and purified by 8% PAGE.

Procedure for selection step in round 1. The selection experiment was initiated with 200 pmol of the

ligated N40 pool. A 20 µL sample containing 200 pmol of ligated N40 pool was annealed in 5 mM HEPES, pH 7.5, 15 mM NaCl, and 0.1 mM EDTA by heating at 95 °C for 3 min and cooling on ice for 5 min. The selection reaction was initiated by bringing the sample to 40 µL total volume containing 70 mM HEPES, pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, and 150 mM NaCl. The Zn2+ was added from a 10 stock solution containing 10 mM ZnCl2, 20 mM HNO3, and 200 mM HEPES at pH 7.5; this stock solution was freshly prepared from a 100 stock of 100 mM ZnCl2 in 200 mM HNO3. The metal ion stocks were added last to the final sample. The sample was incubated at 37 °C for 14 h and precipitated with ethanol.

Procedure for selection step in subsequent rounds. A 10 µL sample containing ligated pool was

annealed in 5 mM HEPES, pH 7.5, 15 mM NaCl, and 0.1 mM EDTA by heating at 95 °C for 3 min and cooling on ice for 5 min. The selection reaction was initiated by bringing the sample to 20 µL total volume containing 70 mM HEPES, pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, and 150 mM NaCl. The sample was incubated at 37 °C for 14 h and precipitated with ethanol.

Procedure for alkaline treatment in round 1 of HOdU selection. For the selection experiment that

included HOdU, a brief alkaline treatment was performed between the selection and capture steps. This treatment accommodated the possibility that a hydroxyl group from a HOdU nucleotide could serve in place of water as the nucleophile, thereby leading to a macrolactone intermediate that would require subsequent hydrolysis to complete the cleavage process. The precipitated selection sample was dissolved in 45 µL of water, to which was added 5 µL of 500 mM NaOH (50 mM final NaOH concentration). The sample was incubated at room temperature for 30 min and precipitated with ethanol.

Procedure for alkaline treatment in subsequent rounds of HOdU selection. The precipitated selection

sample was dissolved in 9 µL of water, to which was added 1 µL of 500 mM NaOH (50 mM final NaOH concentration). The sample was incubated at room temperature for 30 min and precipitated with ethanol.

Procedure for capture step in round 1. A 90 µL sample containing the selection product, 300 pmol of

capture splint, and 500 pmol of 5-amino capture oligonucleotide was annealed in 100 mM MOPS, pH 7.0, and 1 M NaCl by heating at 95 °C for 3 min and cooling on ice for 5 min. The capture reaction was initiated by bringing the sample to 100 µL total volume containing 100 mM MOPS, pH 7.0, 1 M NaCl, 100 mM EDC, and 100 mM HOBt. The sample was incubated at room temperature for 15 h, precipitated with ethanol, and separated by 8% PAGE.

Procedure for capture step in subsequent rounds. A 22.5 µL sample containing the selection product,

30 pmol of capture splint, and 50 pmol of 5-amino capture oligonucleotide was annealed in 100 mM MOPS, pH 7.0, and 1 M NaCl by heating at 95 °C for 3 min and cooling on ice for 5 min. The capture reaction was initiated by bringing the sample to 25 µL total volume containing 100 mM MOPS, pH 7.0, 1 M NaCl, 50 mM EDC, and 50 mM HOBt. The sample was incubated at room temperature for 15 h and

Supporting Information for Zhou et al., J. Am. Chem. Soc. page S6

loaded directly on 8% PAGE. In parallel, during each round a standard capture reaction was performed using the N40 pool ligated to the hydrolysis product. The yield is shown as “control” in Figure S2. The PAGE position of this standard capture product was used as a reference to excise the capture product for the selection sample.

Procedure for PCR. In each selection round, two PCR reactions were performed, 10-cycle PCR

followed by 30-cycle PCR. First, a 100 µL sample was prepared containing the PAGE-purified capture product, 50 pmol of forward primer, 200 pmol of reverse primer, 20 nmol of each dNTP, and 10 µL of 10 KOD XL polymerase buffer, and 2 µL of 2.5 U/µL KOD XL polymerase. This sample was primer-extended and then cycled 10 times according to the following PCR program: 94 °C for 2 min, 47 °C for 2 min, 72 °C for 30 min; then 94 °C for 2 min, 10 (94 °C for 1 min, 47 °C for 1 min, 72 °C for 1 min), 72 °C for 5 min. KOD XL polymerase was removed by phenol/chloroform extraction. Second, a 50 µL sample was prepared containing 1 µL of the 10-cycle PCR product, 25 pmol of forward primer, 100 pmol of reverse primer, 10 nmol of each dNTP, 20 µCi of -32P-dCTP (800 Ci/mmol), and 5 µL of 10 Taq polymerase buffer (no modified nucleotides are being incorporated). This sample was cycled 30 times according to the following PCR program: 94 °C for 2 min, 30 (94 °C for 30 s, 47 °C for 30 s, 72 °C for 30 s), 72 °C for 5 min. The sample was separated by 8% PAGE, and the reverse-complement single strand was isolated for subsequent primer extension. The forward and reverse single-stranded PCR products were separable because formation of the reverse product was initiated using the reverse primer, which contains a nonamplifiable spacer that stops Taq polymerase.

Procedure for primer extension. A 25 µL sample was prepared containing the reverse-complement

single strand (which contains a nonamplifiable spacer that stops KOD XL polymerase), 50 pmol of forward primer, 7.5 nmol each of dATP, dGTP, dCTP, and modified XdUTP (X = Am, COOH, HO), 20 µCi of -32P-dCTP (800 Ci/mmol), 2.5 µL of 10 KOD XL polymerase buffer, and 0.5 µL of 2.5 U/µL KOD XL polymerase. Primer extension was performed in a PCR thermocycler according to the following program: 94 °C for 2 min, 47 °C for 2 min, 72 °C for 1 h. The sample was separated by 8% PAGE to provide the modified DNA pool for the next selection round.

Procedure for cloning and initial screening. Using 1 µL of a 1:1000 dilution of the 10-cycle PCR

product from the relevant selection round, 30-cycle PCR was performed using the same procedure as described, omitting -32P-dCTP and using primers 5-CGAAGTCGCCATCTCTTC-3 (forward primer, 25 pmol) and 5-TAATTAATTAATTACCCATCAGGATCAGCT-3 (reverse primer, 25 pmol), where the extensions with TAA stop codons in each frame were included to suppress false negatives in blue-white screening.3 The PCR product was purified on 2% agarose and cloned using a TOPO TA cloning kit (Invitrogen). Miniprep DNA samples derived from individual E. coli colonies were assayed by digestion with EcoRI to ascertain the presence of the expected inserts. Using the miniprep DNA samples, PCR (same conditions as 30-cycle PCR during selection) was performed to synthesize the reverse-complement templates for the subsequent primer extension reactions. For primer extension, 25 µL samples were prepared, each containing a reverse-complement template, 100 pmol of forward primer, 5.0 nmol each of dATP, dGTP, dCTP, and modified XdUTP (X = Am, COOH, HO), 2 µCi of -32P-dCTP (800 Ci/mmol), 2.5 µL of 10 KOD XL polymerase buffer, and 0.5 µL of 2.5 U/µL KOD XL polymerase. Primer extension was performed in a PCR thermocycler according to the following program: 94 °C for 2 min, 4 (94 °C for 2 min, 47 °C for 2 min, 72 °C for 1 h), 72 °C for 1 h. The samples were separated by 8% PAGE to provide the modified deoxyribozymes. The concentration of each PAGE-purified deoxyribozyme strand was estimated from the radioactive intensity relative to suitable standards. Each screening assay used ~0.1 pmol of 5-32P-radiolabeled amide substrate and at least 10 pmol of deoxyribozyme in the single-turnover assay procedure described in a subsequent section of this document.

Selection

Figure S2.capture yieusing the (B) Selecti

progressions

. Progressions eld for the prod

deoxyribozymon with COOHdU

Supporting

of the in vitroduct that has a

me pool for tU. (C) Selectio

g Information

selection expea 3′-COOH grothat round. A

on with HOdU.

for Zhou et al

eriments. In eaoup, and “sele

Arrows mark

l., J. Am. Chem

ach round, “coction” refers tothe cloned r

m. Soc.

ontrol” refers too the EDC-pro

rounds. (A) Se

p

o the EDC-proomoted captureelection with

age S7

omoted e yield

AmdU.

Sequences

Figure S3(B) COOHdUCTTC-N40-as determinconservatiothe far rigdeoxyribozthe systema

ProcedureA 50

ACTCACTAthe 40 nt iincluded tforward pµL of 10was perfor2 min, 47 the modifi

Single-turThe a

sample coannealed icooling on20 µL tota150 mM

s of individua

. Sequences oU deoxyribozym-ATAGTGAGTCned through thon, i.e., the samght is shown zyme is listed watic alphabetic

e for preparingµL sample wAT-N40-GAAGinitially randoto allow PAG

primer, 15 nm KOD XL prmed in a PC°C for 2 min

fied deoxyribo

rnover deoxyramide substraontaining 0.2 in 5 mM HEPn ice for 5 mal volume conNaCl. The s

Supporting

al deoxyriboz

of the initiallymes. (C) HOdU CGTATTA-3, whe selection prme nucleotide a(in parenthese

with its internaal designation

g modified deas prepared cGAGATGGCGACom region in GE separatio

mol each of dAolymerase bu

CR thermocycn, 72 °C for 1 ozyme.

ribozyme assaate was 5-32P

pmol of 5-3

PES, pH 7.5,in. The DNAntaining 70 msample was i

g Information

ymes

y random regideoxyribozym

where N40 reprrocess. All aligas in the upperes) the numbe

al laboratory defor the particu

eoxyribozymecontaining 400CTTCGGAAAGthe deoxyribn of the primATP, dGTP, uffer, and 1.0ler accordingh), 72 °C for

ay procedureP-radiolabeled32P-radiolabel 15 mM NaC

A-catalyzed hymM HEPES, pincubated at

for Zhou et al

ons of the nemes. All deoxyrresents the specgnments show rmost sequenceer of times thesignation suchular selection, a

es by primer e0 pmol of theGAGCAATAGTAbozyme; the umer extensiondCTP, and m µL of 2.5 U

g to the followr 1 h. The sam

d using -32Pled amide sub

Cl, and 0.1 mMydrolysis reacpH 7.5, 1 mM37 °C. At ap

l., J. Am. Chem

ew deoxyribozribozymes wercific 40 nucleoonly the initia

e. Next to eachhat sequence h as 8JV105, wand 05 is the cl

extension e reverse-comAA-3 (the bo

underlined nun product fromodified XdU

U/µL KOD XLwing programmple was sepa

P-ATP and pbstrate and 2M EDTA by ction was initM ZnCl2, 20 mppropriate tim

m. Soc.

zymes. (A) Amdre used as 5-Cotides of the inially random reh sequence lenwas found du

where 8 is the rlone number.

mplement tempoldface N40 is

ucleotides are om the templ

UTP (X = AmL polymerase

m: 94 °C for 2 arated by 12%

olynucleotide20 pmol of d

heating at 95tiated by brinmM MnCl2, 4me points, 2

p

dU deoxyribozGAAGTCGCCAitially random egion. A dot dgth in nucleotiuring cloning.

round number,

plate 5-TAATs complement

arbitrary seqlate), 800 pm

m, COOH, HOe. Primer extemin, 4 (94

% PAGE to pr

e kinase. A 1eoxyribozym5 °C for 3 minging the sam40 mM MgCl µL aliquots

age S8

zymes. ATCT-region

denotes ides on . Each JV1 is

TACG-tary to quence mol of O), 5.0 ension °C for rovide

10 µL me was

in and mple to l2, and s were

quenched EDTA, pHseparated the yield vfinal yieldnumber of

Mass specTo pr

amide suband 0.1 mhydrolysispH 7.5, 1.37 °C for spectromematrix 3-hSpectrome

Assaying To as

used splin5-segmenthe forwarTGCGTAGTcompleme5-bindingincluded t5-AGAGTGACTCACTAmodificatipmol of 395 °C for buffer and12% PAG

Figure S4version of (with only included or

with 5 µL stH 8.3], 50 mby 20% PAG

versus time dad. Each kobs vf independent

ctrometry prorepare the clebstrate and 12mM EDTA bys reaction was.0 mM ZnCl2

48 h, precipitetry. Data wehydroxypicoletry Laborato

3-binding armsess function

nt ligation to pnt (i.e., 5-bindrd primer fromTCCCGCTCTGentary to the g arm (bindinto allow PAGGAGTCGTATTATCCACGTACions, a 26 µL-segment wa3 min and c

d 1 µL of 5 UGE.

. Assaying 3-AmideAm1 (wpositions 34

r not included w

Supporting

op solution (8mM EDTA, GE and quantata directly to

value is report determinatio

cedure eavage produc20 pmol of dey heating at s initiated by 2, 20 mM Mntated with ethere acquired linic acid in ory (instrumen

m of AmideAnal contributioprepare a versding arm + inm Figure S1 aGAAGAGATGGCinitially rand

ng site for forGE separationTA-3 was prepCTAGCGATTCGL sample contas annealed incooling on iceU/µL T4 DNA

-binding arm with all six Amdand 38 of the within the 3-b

g Information

80% formam0.025% bromtified with a

o first-order krted with erroons.

cts using a deoxyribozym95 °C for 3 bringing the

nCl2, 40 mM hanol, desalte

on a Brukerpositive ion

nt purchased w

Am1 for AmdUons of AmdU nsion of this d

nitially randomand reverse cCGACTTCGGAom 40 nucleorward primern of the primpared by soliGCG-3. To taining 200 pmn 5 mM Tris,e for 5 min.

A ligase. The

of the AmidedU nucleotidesinitially rando

binding arm.

for Zhou et al

mide, 1 TBE mophenol bluPhosphorIma

kinetics; i.e., yor calculated a

deoxyribozymme was anneal

min and coosample to 50MgCl2, and 1d by Milliporr UltrafleXtrmode at the with support

U requirementnucleotides w

deoxyribozymm 40 nucleotiomplement teAAAGAGCAATAotides, the star), and the un

mer extension d-phase synthprepare the

mol of the 5, pH 7.5, 15 mTo this solutsample was i

Am1 deoxyribs marked in Fiom N40 region

l., J. Am. Chem

[89 mM eachue, 0.025% ager. Values yield = Y•(1 –as the standa

me, a 25 µL sled in 5 mM oling on ice f0 µL total volu150 mM NaCre C18 ZipTipreme MALDI

UIUC Schofrom NIH S1

ts within the 3-b

me without 3-ides) was prepemplate 5-CCAGTAA-3, whandard nucleonderlined nucproduct from

hesis. The spl deoxyriboz-segment, 30mM NaCl, antion was addeincubated at 3

bozyme for Am

igure 2A) and n as AmdU) we

m. Soc.

h Tris and boxylene cyanof kobs were

– e–kt), where kard deviation

sample contaHEPES, pH for 5 min. Tume containin

Cl. The sampl, and analyzeI-TOF mass

ool of Chemi10RR027109A

binding arm -binding arm pared by primCACGTACTAGhere the boldfotides are comcleotides are m the templatlint sequence

zyme withou00 pmol of DNnd 0.1 mM Eed 3 µL of 1037 °C for 12

mdU requiremethe mutant ve

ere assayed wh

p

oric acid and ol). Samplesobtained by k = kobs and Yfrom the ind

aining 100 pm7.5, 15 mM

The DNA-catang 70 mM HEle was incubaed by MALDI

spectrometercal Sciences A).

of AmideAmmodification

mer extensionGCGATTCGCGTface nucleotidmplementary arbitrary seqte. The 3-seg

e was 5-TAATut 3-bindingNA splint, anDTA by heat0 T4 DNA h and separat

ent. Both the ersion of Amidhen AmdU was

age S9

2 mM were fitting

Y is the dicated

mol of NaCl, alyzed EPES, ated at I mass r with Mass

m1, we s. The

n using TGAC-des are

to the quence gment TACG-g arm nd 400 ting at ligase ted by

parent

deAm1 s either

Assaying

Figure S5.eight variarespectivelregion and at positionphylogeny were each with unmoamino-modby primer detectable nucleobase

T34 and T38

. Assaying T34ants of Amidey, each prepar3-binding arm

ns T11, T18, in Figure S3Aprepared by s

odified dT. Vardified dT at onextension (althactivity. Comp

es at positions 3

Supporting

of AmideAm

4 and T38 of teAm1. Varianred by primer m include the pT27, and T31

A), because primolid-phase synriant 3 include

nly positions 34hough variant 6parison of the r34 and 38 are i

g Information

m1 for AmdU r

the AmideAm1nts 1 and 2 a

extension (“Pprimary amino 1 required mumer extension

nthesis (“SPS”es amino-modi4 or 38, respec6 could equallresults with vaimportant for c

for Zhou et al

requirements

1 deoxyribozymare the parentE”). Thereforemodification,

utation to dC/ddoes not allow

”), which allowified dT at onlctively (kobs ~0ly well be prepariants 4 and 5catalysis.

l., J. Am. Chem

me for AmdU rt and mutant e, all dT nucleand removing dA (with chow site-specific ws individual rly positions 340.02 h–1). Variapared by solid-to those with

m. Soc.

requirements. Sdeoxyribozym

eotides in the the four N40 p

oice of nucleoreplacements.

replacement of4 and 38. Variants 6, 7, and 8-phase synthesvariants 7 and

pa

Shown are assames from Figinitially randorimary amino tide dictated b Variants 3, 4,

f amino-modifiants 4 and 5 i8 were each prsis), and each h 8 indicate tha

ge S10

ays for gure 2, om N40 groups by the , and 5 fied dT include repared had no

at the T

Assaying

Figure S6regions of The COOHdUmarked. (CAmideCa1 0.39, 0.45;

catalysis by C

. COOHdU-modAmideCa1 andU modificationC) Kinetic plot

N40 + and 3-aAmideCa2 N4

Supporting

COOHdU deoxy

dified deoxyribd AmideCa2. Ens were either ts. Shown are arm + 0.27, 0.

40 + and 3-arm

g Information

yribozymes A

bozymes for aEach blue T ispresent (+) or results from

36; AmideCa1m – 0.26, 0.34. (

for Zhou et al

AmideCa1 and

amide hydrolys COOHdU in thabsent (–) in tduplicate exp

1 N40 + and 3-(D) Mass spect

l., J. Am. Chem

d AmideCa2

ysis. (A) Sequehe deoxyribozythe initially raneriments perfo-arm – 0.24, 0.trometry analy

m. Soc.

ence of the inyme. (B) PAGEndom region aormed on diff.29; AmideCa2

ysis of products

pa

nitially randomE assay (t = 0,

and 3-binding ferent days. ko

2 N40 + and 3-s.

ge S11

m (N40) 48 h).

arm as bs, h–1: -arm +

Assaying

Figure S7.the 3-bindthree deoxdeoxyribozcomplemensplint ligati

3-binding arm

. Assays of Amding arm. The rxyribozymes. Izyme with HOdnt template. Eaion as describe

Supporting

m of HOdU de

mideHy1, Amidresults reveal thndeed, for AmU modificationach deoxyribozed in Figure S4

g Information

eoxyribozyme

deHy2, and Amhat HOdU modimideHy3 the yns in the 3-binzyme without

4.

for Zhou et al

es for HOdU re

mideHy3, eachifications are nyield was highnding arm wasHOdU modific

l., J. Am. Chem

equirement

h prepared withnot required in her without 3s synthesized bcations in the 3

m. Soc.

h or without HO

the 3-binding-binding arm

by primer exte3-binding arm

pa

OdU modificatig arm for any o

modificationsension from a rm was synthesiz

ge S12

ions in of these . Each reverse zed by

Assaying

Figure S8.70 mM HENaCl at 37including tamide hydr

Organic sy

Reagepyridine wsilica gel column chVarian UnDSS (0 pApparent m (multipMass specLaborator

Synthemmol; Al(1.21 g, 3solution, wadded to q(100 mL)organic lawas purifi(v/v) Et3N

deoxyribozym

. Divalent metEPES, pH 7.5, 7 °C. All deoxyhe 3-binding arolysis (<0.5%

ynthesis procents were cowas obtained

plates pre-cohromatographnity instrumenppm) and refe

multiplicitiesplet and overlctrometry daty using a Waesis of O-(4,lfa Aesar) wa.6 mmol; Sigmwhich was stiquench any u) and washedayer was driedied by silica

N to yield the

Supporting

mes for divale

al ion requiremcombinations oyribozymes wearm. For each ).

edures ommercial gr

from Acros Aoated with fluhy was perfornt. The chemerenced to ths of 1H NMR lapping spin ta were obta

aters Quattro I,4′-dimethoxyas dissolved ma) and a catirred overnigh

unreacted 4,4′d with 80% (d over anhydrgel column cdesired comp

g Information

ent metal ion

ments of the amof 1 mM ZnClere prepared byof the eight de

ade and useAcroseal bottuorescent ind

rmed with siliical shifts in

he residual prpeaks are repsystems), alo

ained at the UII instrument ytrityl)glycolain dry pyridtalytic amounht at room te′-dimethoxytr(w/v) aqueourous MgSO4

chromatograppound as a col

for Zhou et al

requirements

mide-hydrolyzl2, 20 mM MnCy primer extenseoxyribozymes

d without pules. Thin-layedicator, with ica gel (230-4parts per millroton signal ported as s (song with valuUIUC School(LR-ESI).

ate triethylamdine (25 mL)nt of DMAP (mperature. A

rityl chloride.us NaHCO3 (and concentrhy, eluting wlorless oil (90

l., J. Am. Chem

s

zing deoxyribozCl2, and 40 mMsion with mods, omitting all t

urification uner chromatogvisualization

400 mesh). Nlion (δ) are refor CDCl3 (7

singlet), d (doues for apparl of Chemica

mmonium salunder argon

(35 mg, 0.3 mA portion of C. The solution(30 mL) andrated on a rotawith 0–3% CH06 mg, 63%).

m. Soc.

zymes. IncubaM MgCl2 as inddifications throuthree metal ion

nless otherwgraphy (TLC)n by UV ligh

NMR spectra weported down7.26 ppm) oroublet), t (triprent couplingal Sciences M

lt. Glycolic an. 4,4′-Dimetmmol; Sigma)CH3OH (1.5 mn was diluted

d saturated Nary evaporatoH3OH in CH2

pa

ation conditiondicated, and 15ughout the seqns led to no ob

wise indicated) was performht (254 nm). were recordednfield from TMr to DSS (0 plet), q (quartg constants (JMass Spectro

acid (228 mgthoxytrityl ch) were added mL, 36 mmod with ethyl a

NaCl (30 mL)or. The oily re2Cl2 containin

ge S13

ns were 50 mM quence, bserved

d. Dry med on

Flash d on a MS or ppm).

tet), or J, Hz). ometry

g, 3.0 hloride

to the l) was

acetate ). The esidue ng 2%

TLC: Rf =1H NMR: 2H), 7.15 6H), 1.22 13C NMR55.1, 45.1ESI-MS: m

= 0.19 [1% CH(500 MHz, C(tt, J = 7.3, <(t, J = 7.3 Hz: (125 MHz, , 8.6 ppm m/z for carbox

Supporting

H3OH in CH2

CDCl3) δ 7.54<2 Hz, 1H), 6z, 9H) ppm. CDCl3) δ 175

xylic acid cal

g Information

Cl2 with 2% (4 (dd, J = 8.3,6.78 (d, J = 8.

5.4, 158.2, 14

lcd. for C23H2

for Zhou et al

(v/v) Et3N]. 1.3 Hz, 2H),8 Hz, 4H), 3.

45.1, 136.4, 1

21O5 [M–H]– 3

l., J. Am. Chem

, 7.42 (d, J = .76 (s, 6H), 3

130.1, 128.2,

377.4; found

m. Soc.

8.8 Hz, 4H), 3.58 (s, 2H), 2

127.6, 126.4

377.4.

pa

7.24 (t, J = 72.98 (q, J = 7

, 112.9, 86.0,

ge S14

.9 Hz,

.3 Hz,

, 64.0,

Supporting Information for Zhou et al., J. Am. Chem. Soc. page S15

Synthesis of COOHdU 5-triphosphate (COOHdUTP). The COOHdUTP was synthesized from (E)-5-(2-carbomethoxyvinyl)-2-deoxyuridine (Berry & Associates, cat. no. PY7170). The triphosphorylation procedure was modified from the procedure reported by Huang and co-workers.4 2-Chloro-1,3,2-benzodioxaphosphorin-4-one (TCI, cat. no. C1210) was portioned into a dried vial in a glove box. 2-Deoxyuridine and tributylammonium pyrophosphate (Sigma, cat. no. P8533) were dried under vacuum. Tributylamine was dried over 4 Å molecular sieves. Tributylamine (0.65 mL, 2.74 mmol) was added to a solution of tributylammonium pyrophosphate (188 mg, 0.34 mmol) dissolved in 1 mL of anhydrous DMF under argon. This solution was added into a stirred solution of 2-chloro-1,3,2-benzodioxaphosphorin-4-one (50 mg, 0.25 mmol) in 1 mL of anhydrous DMF under argon. The resulting solution was stirred at room temperature for 1 h and then added dropwise over 5 min to a solution of 2-deoxyuridine (50 mg, 0.16 mmol) in 1 mL of anhydrous DMF under argon, cooled in an ice-salt bath at 0 to –10 °C. The solution was stirred for 5 h and raised to room temperature for 30 min. A solution of 0.02 M iodine in THF/pyridine/water (Glen Research, 8 mL) was added until a permanent brown color was maintained. The brown solution was stirred at room temperature for 30 min. Two sample volumes of water were added. The two-layer mixture was stirred vigorously at room temperature for 1.5 h, followed by addition of 0.1 volumes of 3 M NaCl and 3 volumes of ethanol. The thoroughly mixed sample was precipitated at –80 °C overnight and centrifuged for 30 min at 10,000 g and 4 °C. The precipitated sample of COOMedUTP was dried, dissolved in water, and purified by HPLC [Shimdazu Prominence instrument; Phenomenex Gemini-NX C18 column, 5 µm, 10 250 mm; gradient of 0.5% solvent A (20 mM triethylammonium acetate in 50% acetonitrile/50% water, pH 7.0) and 99.5% solvent B (20 mM triethylammonium acetate in water, pH 7.0) at 0 min to 25% solvent A and 75% solvent B at 45 min with flow rate of 3.5 mL/min]. To a solution of the COOMedUTP in 50 µL of water was added 50 µL of 0.2 M NaOH, forming COOHdUTP. The sample was incubated at room temperature for 2 h, neutralized with 10 µL of 2.5 M NaOAc buffer, pH 5.2, and purified by HPLC (same gradient as before). The COOHdUTP was isolated as its triethylammonium salt [12 mg, 8% from (E)-5-(2-carbomethoxyvinyl)-2-deoxyuridine]. 1H NMR: (500 MHz, D2O with 0.01 mg/mL DSS) δ 8.05 (s, 1H), 7.17 (d, J = 16.0 Hz, 1H), 6.81 (d, J = 16.0 Hz, 1H), 6.29 (dd, J = 7.6, 6.3 Hz, 1H), 4.81 (D2O), 4.64 (m, 1H), 4.21 (m, 3H), 3.19 (q, J = 7.3 Hz, 24H), 2.46 (m, 1H), 2.39 (ddd, J = 14.2, 6.4, 3.4 Hz, 1H), 1.27 (t, J = 7.3 Hz, 36H) ppm. From the integrations, x 4 triethylamine molecules were present for each COOHdUTP molecule. ESI-MS: m/z calcd. for C12H17N2O16P3 [M–H]– 537.0; found 537.1.

Reference(1) (a) Fly

C.; Si2003,

(2) Brand2013,

(3) Langn(4) Caton

1.30.1

es for Supportynn-Charlebolverman, S. K42, 15252.

dsen, B. M.; H135, 16014.

ner, J.; Klussmn-Williams, J.1.

Supporting

ting Informatiois, A.; WangK. J. Am. Che

Hesser, A. R.;

mann, S. BioT; Hoxhaj, R.;

g Information

ion g, Y.; Prior, Tm. Soc. 2003

Castner, M.

Techniques 20Fiaz, B.; Hua

for Zhou et al

. K.; Rashid, , 125, 2444. (

A.; Chandra,

003, 34, 950.ang, Z. Curr.

l., J. Am. Chem

I.; Hoadley, K(b) Wang, Y.;

M.; Silverma

Protoc. Nucl

m. Soc.

K. A.; Coppin; Silverman, S

an, S. K. J. Am

leic Acid Che

pa

ns, R. L.; WoS. K. Biochem

m. Chem. Soc

em. 2013, 52,

ge S16

lf, A. mistry

c.