Transcript

Eukaryotic Gene Expression

The expression of genes found in DNA

The genes expressed in a particular cell determines its function

DNA > RNA > Protein > Trait Includes the processes of transcription and

translation

Terminology

Intron – DNA sequence included in the pre mRNA sequence but will be removed from the mature RNA

Exon – DNA sequence included in the pre mRNA that include the protein coding region and will remain as the mature RNA

RNA splicing – removal of the intron from the pre MRNA

TATA box – promoter site on the RNA

Prokaryotic Gene Expression

In prokaryotes, regulatory proteins are often controlled by nutrient availability. This allows organisms such as bacteria to rapidly adjust their transcription patterns in response to environmental conditions.

Recall Lac operon and Trp operonLac - inducible system of gene expression. Its default state

is to be inactive. Only when the right catalyst is added to the system, in this case the sugar lactose, is the process activated, allowing the genes in question to be expressed.

Trp - repressible system, meaning that the operon is automatically turned on unless a repressor becomes active and turns it off.

Eukaryotic Gene Regulation

Transcription Regulation Control of binding sites

Post Transcription Regulation

Degrade mRNA or not protect the mRNA

Translational Regulation Less used by cell but used by toxins and

antibiotics

Protein degradation Protein is destroyed after translation

Remove the introns to form a Chuck Norris fact, a protein.

Mostuuuucccaaaggapeopleuacgacuacahaveaccccccacacacacagggaccacauuuuuacagaca23uacagacgacagiuaugacachromosomesacgacagcauuacgacacaguagacachuckuacacacacacagggggcacacacacnorrisuuuuuuuuucaacaacaacaaggacccaaacaacaahasacacacacagggagagcauuaccaggga72caacaacaacaagaagaauuuuuucaaaandacacacgguuuauauauauagagacacactheyaccaccaccaccgccgccuccuucggacaareaaaaaaaaaaaaaaccccalluauauagagacagacagacgacgauapoisonousuauauagagacagacagauuuuuugacgacgacuuua.

Rearrange the exons to form a Chuck Norris fact, a

protein.

Once chin descendants known Chuck round-house horse kicked Norris a it’s as giraffe the in the are

Assignment

Choose any of the 4 gene regulation methods and investigate further

Must include at least the following Title Active players Action of the players Description of process How does this process assist eukaryotic

organisms in survival


Top Related