eukaryotic gene expression. the expression of genes found in dna the expression of genes found in...
TRANSCRIPT
The expression of genes found in DNA
The genes expressed in a particular cell determines its function
DNA > RNA > Protein > Trait Includes the processes of transcription and
translation
Terminology
Intron – DNA sequence included in the pre mRNA sequence but will be removed from the mature RNA
Exon – DNA sequence included in the pre mRNA that include the protein coding region and will remain as the mature RNA
RNA splicing – removal of the intron from the pre MRNA
TATA box – promoter site on the RNA
Gene or RNA splicing animations
http://www.youtube.com/watch?feature=endscreen&NR=1&v=FVuAwBGw_pQ
http://www.gdbdp.com/upload_2_0/winpops/k12_step_exons_introns.html
Prokaryotic Gene Expression
In prokaryotes, regulatory proteins are often controlled by nutrient availability. This allows organisms such as bacteria to rapidly adjust their transcription patterns in response to environmental conditions.
Recall Lac operon and Trp operonLac - inducible system of gene expression. Its default state
is to be inactive. Only when the right catalyst is added to the system, in this case the sugar lactose, is the process activated, allowing the genes in question to be expressed.
Trp - repressible system, meaning that the operon is automatically turned on unless a repressor becomes active and turns it off.
Eukaryotic Gene Regulation
Transcription Regulation Control of binding sites
Post Transcription Regulation
Degrade mRNA or not protect the mRNA
Translational Regulation Less used by cell but used by toxins and
antibiotics
Protein degradation Protein is destroyed after translation
Review and Quiz
http://www.youtube.com/watch?v=3S3ZOmleAj0
http://highered.mcgraw-hill.com/sites/9834092339/student_view0/chapter16/control_of_gene_expression_in_eukaryotes.html
Remove the introns to form a Chuck Norris fact, a protein.
Mostuuuucccaaaggapeopleuacgacuacahaveaccccccacacacacagggaccacauuuuuacagaca23uacagacgacagiuaugacachromosomesacgacagcauuacgacacaguagacachuckuacacacacacagggggcacacacacnorrisuuuuuuuuucaacaacaacaaggacccaaacaacaahasacacacacagggagagcauuaccaggga72caacaacaacaagaagaauuuuuucaaaandacacacgguuuauauauauagagacacactheyaccaccaccaccgccgccuccuucggacaareaaaaaaaaaaaaaaccccalluauauagagacagacagacgacgauapoisonousuauauagagacagacagauuuuuugacgacgacuuua.
Rearrange the exons to form a Chuck Norris fact, a
protein.
Once chin descendants known Chuck round-house horse kicked Norris a it’s as giraffe the in the are