D-BIOL
PRACTICAL: SS 2013
FUNDAMENTALS OF BIOLOGY II (551-0104-01)
PLANT PHYSIOLOGY PART
Department of Biology
Professorships of Plant Biotechnology (Prof. W. Gruissem)
RNA Biology (Prof. O. Voinnet)
Plant Biochemistry (Prof. S. Zeeman)
Course Rooms: LFW C4 and C31
2
1. DAY: PLANT SIGNALING: PHYTOHORMONES AND
SMALL RNAS
A) Introduction
The growth of plants has to be adapted to (external) environmental influences as well
as to (internal) developmental stages. Environmental influences include light,
temperature, water, d ifferent biotic and abiotic stresses and soil fertility. Plant
hormones and small RNA molecules p lay an important role in adaptation of plant
growth to the environmental and developmental conditions. In the experiments
during this course we will examine various aspects of growth regulation in plants.
Signal molecules: phytohormones and small RNAs
Many processes within a plant are triggered and coordinated by messenger
molecules. Different messenger molecules include small proteins, small RN As and
several d ifferent classes of chemical molecules. Six d ifferent classes of molecules
constitute the most prominent phytohormones: Auxins, Gibberellins, Cytokinins,
Ethylen, Abscisic Acid , and Brassinosteroides. In today’s experiments, several
specific activities of some of these hormones will be demonstrated . In addition, we
will explore how local production of a specific kind of RNA can generate a signal
that will systemically spread through the plant and cause effects on gene expression
elsewhere.
Phytohormones
Figure 1 shows the structure of the most common natural auxin Indole Acetic Acid
(IAA). IAA is produced in the tip of the plant and d istributed basipetally (from top to
bottom) throughout the plant. Distribution occurs according to the chem iosmotic
model (Taiz & Zeiger, pp. 433-437) by combined passive (d iffusion of the
undissociated form) and active (polar efflux of the anion across the basal cell
membrane) transport. When a plant is cu t in two halves, the basipetal active
transport leads to accumulation of auxins at the lower end of the upper half. Higher
concentrations of auxin lead to reduced growth of primary roots but stimulate the
development of side- and adventitious roots (Taiz & Zeiger, p . 450).
3
Figure 1: Structure of Indole Acetic Acid (IAA).
Gibberellins are modified diterpenes, which are synthesized by combination of two
isoprenoid units (Taiz & Zeiger, pp.466-468). Figure 2 shows the chemical structure
of gibberellic acid GA3. The most visible effect of gibberellins is the in creased growth
of the shoot axis, which can be readily observed in dwarf mutants and rosette plants.
The increased growth is caused by a combination of increased cell expansion and
enhanced cell d ivision (Taiz & Zeiger, pp. 477-480).
Figure 2: Structure of Gibberellic acid (GA3)
Gibberelllins also promote germination. Abscisic Acid ABA has exactly opposite
effect: it inhibits premature germination of plant seeds (e.g. when seeds are still
associated with the mother plant). ABA is a sesquiterpene (“one and a half” terpene),
i.e. a C15 molecule (Figure 3). The particular relation between ABA and gibberellins
is crucial for proper (timely) germination of plant seeds: a high ABA concentration
with a concomitant low gibberellin concentration leads to dormancy, while high
gibberellin and low ABA concentration leads to germination of plant seeds (Taiz &
Zeiger, pp. 543-546). (The experiment with relation to the text marked in grey will
not be performed this year).
Figure 3: Structure of Abscisic Acid (ABA)
Gibberellinsäure
4
Small RNA molecules
RNA silencing or RNA interference (RNAi) is a process in which small RNA
molecules (short interfering RNAs (siRNA) or micro RNAs (miRNA)) influence gene
expression at the transcriptional or post-transcriptional level. The process is
conserved between most eukaryotes and is important for, among others,
maintenance of genome stability or the expression of many developmental factors.
The small RNA molecules influence either the chromatinstructure or the stability and
use of mRNA. In plants, RN A silencing is an important part of the plant’s antiviral
defense.
The effectors are small (21 to 24 bases) double-stranded RNA molecules, which are
processed from long precursors. One of the two strands of the short molecule d irects
a silencing complex to the sequence homologous target RNA or DNA. The
precursors are generated by simultaneous expression of sense- and antisense RNA or
by expression of an RNA which has the potential to form double strands by
intramolecular base pairing (hairpin RNA). In many cases, new siRNA is generated
during degradation of the target RNA. This initiates a self-enhanced and self-
maintained mechanism. siRNAs can be mobile between cells and within a plant and
lead to systemic effects.
Environmental influences: Light
The experiment on photosynthetic generation of starch illustrates the light
requirement for this process. The light reaction generates reduced NADPH and ATP
which are used in the dark reaction to fix CO2 and generate Glyceraldehyde-3-
Phosphate, which serves as su bstrate for the formation of starch in the chloroplast
and sucrose in the cytosol. In plants, carbohydrates are mainly transported as
sucrose. Starch is immobile and has to be cleaved to generate carbohydrates that can
be transported to other parts of the plant (Taiz & Zeiger, pp. 162 – 168).
5
B) Experiments
B1) in C4:
1. Polar regeneration of auxin induced adventitious roots
2. Regeneration of Linum usitat issimum seedlings
3. Comparison of internodal growth
4. Distribution of the articles for the Journal Clubs on the 4th day
B2) in C31:
1. Systemic gene silencing
2. Photosynthetic starch
6
B1) in C4:
1. Polar regeneration of auxin induced adventitious roots in hypocotyls of beans
fill one 50 ml Falcon tube with 30 ml of either d istilled water or auxin solution
(0.1 mM IAA) and label the tubes
cut in the middle of the hypocotyl of 10 seven day old , etiolated bean seedlings
place the halves of 5 seedlings each with the cut surface for 2 hours into the
water or the auxin solution (approximately 1 cm deep)
label 2 times 2 Petri d ishes (control, auxin), place 5 layers of filter paper and wet
well
place the seedling halves on the wet filter paper
seal the Petri d ishes with Parafilm, wrap them in Aluminum foil and place
them in grey boxes
wrap the grey boxes in black cloth
2. Regeneration of Linum usitat issimum seedlings
!!Filters and cotton should be moist but not too wet!!
place 3 layers of filter paper into 5 Petri d ishes and wet well
label the Petri d ishes (according to the length of the fragments)
cut 10 seedlings for each length (0 mm, 5 mm, 10 mm, 15 mm und 20 mm
measured from the cotyledons downwards) on millimetre paper, cover the
hypocotyl with wet cotton wool to avoid dessication
place the upper seedling fragments (with the cotyledons) of the same length on
the wet filter paper in the Petri d ish
seal the Petri d ishes and place them near the window
3. Comparison of internodal growth of dwarfed and normal pea
observe the d ifferences of 11 day old pea seedlings (varieties „früher Zwerg“
and „Konservenkönigin“); measure all (at least 3; later one has to find out,
which internodes react most) internodes of 5 plants per treatment
7
spray for each variety one tray with control solution (1 % Tween 20), label the
tray and take it out of the room before spraying with the GA3 solution
spray the other trays with gibberellin solution (0.1 mM GA3 in 1 % Tween 20)
and label the trays
labelling: normal/ dwarf; control/ GA; date; name of the group
Distribution of the articles for the Jounal Club of the 4th day
6 articles to choose from
two groups of 2 to 3 students choose one article and prepare a presentation
on the 4th day one group per article will be elected by chance to present a
Jounal Club power point presentation):
- Introduction: embed the problem in a general context
- Methods and Results: how did the authors arrive to which results?
What do these results mean?
- Summary: point out the important, take home message
Discussion and questions: the other group makes comments, all students ask
questions and d iscuss
8
B2) in C31:
1. Systemic gene silencing in Nicot iana benthamiana plants
To generate siRNA locally, plants are incoculated locally with Agrobacterium
tumefaciens. These soil bacteria transfer naturally a piece of a plasmid (the so
called T-DNA) into plant cells. The T-DNA of the strains Agro-TRV-PDS and
Agro-gffg used in the experiment contains genes that lead to generation of siRNA
against the plant’s own Phytoene Desaturase Gene (PDS) or against a GFP gene.
The siRNA against the GFP gene is generated by production of a self-
complementary (“inverted repeat”) RNA covering parts of the GFP sequence,
TRV-PDS generates in transfected cells by a virus-like replication process a
double-stranded RNA that contains PDS sequences. Phytoene Desaturase is
required for Cartenoid Biosynthesis. A lack of PDS leads to photobleaching due
to chlorophyll photooxidation . GFP is a protein that is expressed from a transgene
in the plants used in this experiment, which is green fluorescing when it is
irrad iated with UV light.
Experiment:
Agrobacterium suspensions of the d ifferent strains in LB medium have been grown
over night and will be provided .
The bacterial strains and the plants used in this experiment are transgenic
organisms and have to be discarded accordingly! All plants, bacterial solutions,
and used materials have to be collected and sterilised by autoclaving or adequate
procedures.
Centrifuge 25 ml of each culture for 10 min at room temperature at 5000g
Discard the supernatant into a beaker containing Bleach (Bleach is corrosive ;
handle with caution!).
Resuspend the pellet by pipetting in 10 ml 10mM MgCl2
Dilute 100l to 1 ml in a cuvette and measure the optical density at 600 nm
Dilute the remaining culture with 10mM MgCl2 to OD
600nm=1.5
Mix in 50 ml Falcon tubes the following suspensions:
5ml Agro-TRV-PDS + 5 ml 10mM MgCl2
5ml Agro-gffg + 5 ml 10mM MgCl2
Add to each mix 10 l 100 mM Acetosyringone and incubate 1 h at RT
9
Infiltrate 2 to 3 leaves of a Nicotiana benthamiana p lant, i.e. take up bacterial
suspensions in a syringe (without needle) and press into leaf surface
(together with an assistant). Use one plant for every mix and label them
accordingly. You will observe these plants during the next weeks.
2. Photosynthetic starch in leaves of geranium (Pelargonium zonale)
Important: Keep the geraniums in the dark until the experiment begins
cut out a figure from aluminum foil with a razor blade
wrap a geranium leaf into the aluminum foil with the figure opening to the
upper (smooth) side of the leaf
(the lower side of the leaf has to be completely covered by aluminum)
illuminate the wrapped leaves behind a filled watercontainer (to d issipate the
heat) for 2 hours with a strong light source
remove the aluminum foil after illumination
place the leaves into hot (70 °C) methanol (do not inhale the vapour) until they
have completely lost the green colour
transfer the leaves subsequently to hot (70 °C) water (to soften them)
place the leaves into Iodine-potassium (Lugol) solution until the starch is visible
compare the starch synthesis in illuminated and dark adapted parts of the leaves
10
2. DAY: PLANTS AND LIGHT
A) Introduction
Light is the most important energy source for plants which convert sunlight into
chemical energy in the chloroplasts. This conversion is called photosynthesis. But
light also constitute an important environmental factor, which influences the
development of plants in various ways. The experiments of the second course day
address both of these functions of light.
Photosynthesis
Plants, algae and some bacteria can use the energy of sunlight to produce glucose
from water and CO2 and therefore can live as photoautotrophs. Photosynthesis can
be roughly d ivided in two phases: In the first phase (the so called light reaction)
water is oxid ized to molecular oxygen. The released electrons migrate through the
electron transport chain until they finally reduce NADP+. As a consequence of the
electron transport, a proton gradient is generated across the thylakoid membrane,
which is used to phosphorylate ADP, i.e. to generate ATP (Taiz & Zeiger, pp. 124-
135).
The second phase of photosynthesis is not d irectly dependent on light -energy and is
therefore also called dark reaction. In this second phase the reduced NADPH and
the generated ATP from the light reaction is used to reduced CO2 to an aldehyde in
reaction steps that can be summarized in the reductive pentosephosphate cycle (also
named Calvin Cycle after its d iscoverer) (Taiz & Zeiger, pp. 145-150).
Photosynthesis pigments, which absorb light, enable photoautotrophic orga nisms to
use the energy from sunlight. Three d ifferent classes of photosynthesis pigments can
be d iscriminated (Taiz & Zeiger, pp. 114-115).
Chlorophylls constitu te the first group. They consist of a porphyrin ring (four
pyrrols which are connected by C-bridges), which encloses a magnesium ion and is
esterified with phytol, a hydrophobic alcohol (Figure 4). Chlorophylls absorb blue
and red light and are therefore responsible for the green colour of chloroplasts and
leaves. The most important pigment of this class is chlorophyll a, which is present in
all oxygen-producing, photosynthetic organisms. Chlorophyll b is present in
Euglenophytes, green algae and all higher plants, whereas chlorophyll c can be
found in brown algae and d iatoms.
11
Figure 4: Biosynthesis and Structure of Chlorophyll a.
The second class of pigments are the carotenoids. These lipophilic pigments are
yellow, orange or red . Their main function, besides extending the range of the
absorption spectrum, is the protection of the photosynthesis apparatus against
photooxidative damage. Carotenoides are subdivided into two subgroups, based on
the chemical composition. Carotines are pure hydrocarbons with -carotine as the
most prominent member. Xanthophylles are oxygen containing derivatives of
carotines; lutein is the most abundant xanthophyll.
The third pigment class are the phycobilines, which are present in red - and blue
algae but not in higher plants.
Light-influenced plant development (Photomorphogenesis)
Most plant seeds germinate in the soil. The (subterranean) growth of the seedlings is
supported by nutrition reserves in the seed until the plantlets reach the surface and
build their photosynthesis apparatus. In the dark, most energy is invested in the
growth of the shoot axis, which is bent at the top (plumule hook or apical hook). In
this way, the developing plant can penetrate through the soil most efficiently and
12
without damage to the sensitive leaflets. This growth is called Skotomorphogenesis
or Etiolation. In contrast, the development when the seedlings reached the light is
called Photomorphogenesis and is characterized by opening of the plumula hook,
slower growth of the shoot axis and leaves unfold (Taiz & Zeiger, p . 375-376).
Germination of many seeds depends not only on a critical water content but also on
the amount of light irrad iation. Only seeds that have perceived a sufficient quantity
of light will begin to germinate. Germination is an irreversible process, which cannot
be reverted (e.g. by putting seeds back to darkness).
The transition of plants to growth in light does not only consist of the changes in
growth described above, but also involves intracellular (e.g. the development of
chloroplasts from etioplasts) and molecular changes. This includes (in Angiosperms)
the biosynthesis of chlorophylls: the conversion of protochlorophyllid a, which
accumulates in etioplasts on the dark, to chlorophyllid a is the only step in the
biosynthesis pathway of chlorophylls that requires light (Figure 4). The
photoreduction of protochlorophyllid a to chlorophyllid can be followed
spectroscopically in a photometer, because changes in the system of conjugated
double-bonds cause a shift in the absorption spectru m of the pigment.
Chlorophyllid a is subsequently transformed to chlorophyll a by addition of phytol
to the porphyrinring (Taiz & Zeiger, p . 139-140).
Germination of seeds and subsequent development of seedlings is ad justed to the
environment and is controlled by light receptors. Plants have receptors for blue and
for red light. Red light receptors are responsible for the control of
photomorphogenesis and are called Phytochromes. Phytochrome d irected transitions
in plants are basically dependent on alterations of gene expression programs. An
environmental change which was detected by a photoreceptor will be transmitted
through a signal transduction chain to the nucleus of a plant cell and cause there the
up- or down-regulation of various genes by causing changes of transcription, RNA
processing or other steps in the expression pathway (Taiz & Zeiger, pp. 393).
The expression of individual genes can be monitored with so called reporter genes,
which encode enzymes, whose expression can be easily detected (e.g. by monitoring
the conversion of a colourless substrate into a coloured product).
13
B) Experiments
B1) in C4:
1. Analysis of LHCP-gene promoter activity by means of the GUS reporter gene
2. (Polar regeneration of auxin induced adventitious roots)
3. (Regeneration of Linum usitat issimum seedlings
4. (Comparison of internodal growth)
5. (Systemic gene silencing)
6. Comparison of development in light and darkness
B2) in C31:
1. Hill-Reaction in isolated thylacoids
2. Chromatographical separation of pigments of the chloroplasts
(in parentheses: continuation and/ or analysis of last week’s experiments)
14
B1) in C4:
1. Analysis of LHCP-gene and PORA-gene promoter activity by means of the
GUS reporter gene in light-grown and etiolated transgenic Arabidopsis thaliana
seedlings
The uidA gene from Escherichia coli codes for -Glucuronidase (GUS), which is
used intensively in plants to study the expression of genes via promoter fusions
(Jefferson et al., 1987). The substrate for subsequent histochemical analysis is
X-Gluc (5-Brom-4-chlor-3-indolyl--D-glucuronid). The GUS-enzyme cleaves
off glucuronic acid before an indigo blue colorant is formed in an additional
step (Taiz & Zeiger, pp. 491 - 492)..
Here, the GUS-fusion approach is used to study the regulation of a LHCP gene
(light harvesting complex protein, cab3) and a PORA gene (NADPH -
Protochlorophyllid Oxidoreductase) in transgenic Arabidopsis lines with cab3 or
PORA promoter-uidA fusions, which were grown with and without light
(etiolated).
GUS-staining solution:
- 50 mM Phosphate buffer pH 7
- 10 mM EDTA
- 0.1 % Triton X-100
- 1 mM X-Gluc
- 5 mM K3 (CN)
6
- 5 mM K4 Fe (CN)
6
each group uses 6 wells of a microtiterplate: write down the coordinates
pipet in each well 750 µl staining solution
place in each well 3 six day old seedlings of either light-grown or etiolated
cab3::GUS, PORA::GUS or wild type
make sure the seedlings are totally submerged in the solution
place the microtiterplate in a desiccator
vacuum-infiltrate the seedlings for 4 min
as soon as bubbles emerge in a regular fashion, aerate the dessicator carefully
incubate the microtiterplate at 37 °C
after 2 hours remove the staining solution carefully with a pipet te and replace it
with 70 % ethanol
(which removes the Chlorophyll and thereby enhances the contrast)
compare the staining pattern under the binocular in the next course day
15
2. Polar regeneration of auxin induced adventitious roots in bean hypocotyls
Petri d ishes from last week:
take note of the position, length and number of adventitious roots on the hypocotyls
and explain the observations
3. Regeneration of Linum usitat issimum seedlings
Petri d ishes from last week:
count the number of roots per Petri dish (i.e. per hypocotyl segment length)
observe the length of the adventitious roots
(does the number of roots correlate with maximal length?)
explain the observations
4. Comparison of internodal growth
Trays from last week:
measure the length of the individual internodes of 12 plants of each tray („früher
Zwerg“ GA -treated, control; „Konservenkönigin“ GA -treated, control)
calculate the average for each internode (do not take into account the highest and the
lowest value)
compare the average lengths of the internodes and explain
5. Systemic gene silencing
Nicotiana benthamiana p lants of last week
Observe the plants at normal and at UV light and describe what you see.
For observation in UV light, plants are moved to the dark room and irrad iated with a
UV lamp.
Protect your eyes with a face shield and/or safety glasses and keep exposure of
skin to UV light at a minimum.
16
6. Comparison of development in light and dark in
- hypogeic (pea) d icotyledonous seedlings
- epigeic (mustard) d icotyledonous seedlings
- monocotyledonous (barley) seedlings
!!This experiment is only started today; evaluation is next week; it is
important to overlay the peas with enough vermiculit!!
extract a typical seedling including the roots of each tray
observe, draw and describe the different photomorphoses
measure the lengths of (pea and barley) seedlings and draw a distribution curve (with
10 size classes)
17
B2) in C31:
1. Hill-Reaction in isolated thylacoids of peas
This reaction was d iscovered by Hill 1937. The electrons are transferred from
water to photosystem II and some additional steps of the electron transport
chain to an artificial electron acceptor. In addition, oxygen is released .
2 H2O + 2 A 2 AH
2 + O
2
light
Here, the reduction of the artificial electron acceptor is followed by measuring
photometrically the transformation of the oxid ised blue dye 2,6-
Dichlorophenolindophenol (DCPIP) into its colourless reduced form.
The electron transport chain can be interrupted by blocking reagents. Here the
two herbicides Dichlorphenyld imethylurea (DCMU) and Atrazin are used to
illustrate this aspect.
Medium A: Medium B:
- 0.33 M Sorbitol
- 30 mM KCl - 30 mM KCl
- 5 mM NaCl - 5 mM NaCl
- 25 mM Hepes-KOH pH 7.6 - 25 mM Hepes-KOH pH 7.6
- 2 mM EDTA - 2 mM EDTA
- 1 mM MgCl2 - 1 mM MgCl
2
- 1 mM MnCl2 - 1 mM MnCl
2
- 0.5 mM KH2PO
4
- 5 mM Ascorbat (add freshly)
- 4 mM Cystein
important: proceed on ice for the isolation of chloroplasts and use precooled
glassware
weigh 5 to 10 g fresh pea leaves
homogenise with 120 ml cold medium A in the mixer: blend twice for 3 sec
prepare 4 layers of cloth in a funnel and prewet the cloth with medium A
filtrate the homogenised pea leaves through the cloth
distribute the chloroplast suspension to 50 ml centrifuge tubes
equilibrate the weight of the centrifuge tubes
18
spin 5 min in the precooled centrifuge at 2000 g (4000 rpm; SS34 Rotor)
discard the supernatant
resuspend the chloroplasts in 20 ml med ium B
leave 4 min on ice
(the thylacoids are set free, why?)
spin 5 min at 3000 rpm
discard the supernatant
resuspend the thylacoids in 5 ml Medium B and leave on ice in the dark
Dilute a portion of the thylacoids with medium B to an extinction of 1.0
(measured at 600 nm against medium B); final volume up to 10 ml (This d iluted
solution will be used further on)
prepare the following reactions by pipetting the correct amount of solutions
(in ml) to glass test tubes:
Reaction-
Nr.
1 2 3 4 5-8 9-12
Zero Light Dark heat
inactivated
DCMU Atrazin
Thylacoids - 0.5 0.5 0.5 0.5 0.5
Medium B 3.5 3.0 3.0 3.0 3.0 3.0
DCMU - - - 0.2 -
Atrazin - - - - 0.2
DCPIP* 0.2 0.2 0.2 0.2 0.2 0.2
H20 0.3 0.3 0.3 0.3 0.1 0.1
* add DCPIP only at the end to all the test tubes
Notes:
Reaction-Nr. 3: wrap the test tube with aluminum foil (also on top)
Reaction -Nr. 4: place the test-tube containing the thylacoids and medium B
into a heated (60 °C) water bath for 5 to 10 min
Reaction -Nr. 5-8: concentration series DCMU (in 10 % Ethanol), Make DCMU
solutions of 5 x 10-5, 5 x 10
-6, 5 x 10
-7 und 5 x 10
-8 M;
add 0.2 ml to reaction
Reaction -Nr. 9-12: concentration series Atrazin (in 100 % Ethanol), as for
DCMU
seal with parafilm and mix the reactions by shaking the test tubes
19
place the test tubes in front of a strong light source beh ind a filled water
container (to d issipate the heat)
pipet 1 ml of each reaction into an Eppendorf tube
spin the Eppendorf tubes 2 min at 5000 rpm on the benchtop centrifuge
transfer the supernatant to plastic cuvettes
measure the extinction at 600 nm against a cuvette filled with medium B
set the d ifference (2-1) between reaction-nr. 2 (in the light) and reaction-nr. 1 (no
thylacoids) as 100 % (of DCPIP reduction)
give the results of the other reactions in % of maximal DCPIP reduction
2. Chromatographical separation of pigments of the chloroplasts
Extraction:
weigh 2 g of pea leaves
place in a mortar and add a little bit of CaCO3 (to neutralise the acid ity of the
acid ic cell sap)
while grinding the leaf tissue, add50 ml Aceton and 5 ml Benzin in small
portions without letting the plant material getting dry
filtrate with the vacuum-bottle through a filter paper
transfer the cleared solution into a separating funnel (Scheidetrichter)
add 30 ml Aceton and 50 ml 10 % NaCl
mix carefully and let the phases separate (the pigments move to the upper
benzin phase)
discard the lower Aceton-/ Water phase (aerate the separating funnel)
wash the remaining benzin phase twice with d istilled water
transfer the benzin phase into an Erlenmeyer flask and dry it by adding a little
bit of Na2SO
4
Thin-layer-chromatography (DC):
fill the DC Tank 0.5 cm to 1 cm with 100 ml Petrolether and 50 ml Aceton
place filterpaper imbibed with the solution in the tank on the walls and close
the lid (to saturate the atmosphere of the tank)
20
define on a DC-silica gel plate a starting line 2 cm above the lower end
apply the pigment mixture on the starting line with a pipet until the band is
intensely green ( not wider than 1 cm)
let the solvent evaporate
place the plate in the tank and leave it in until the migration front has reached a
d istance of 16 cm to 18 cm
mark the migration front and let the plate dry
document the position of the pigment bands
calculate the Rf values and explain the relative mobility of the pigments
Spectroscopy:
scratch off the most visible pigment bands from the plate with the best
separation
elute the carotin band with Hexan
elute the chlorophyll bands with Diethylether (warning: Ether boils at 35oC and
can become explosive; avoid heat; work under the hood)
elute the Lutein- (Xanthophyll-) band with ethanol
transfer immediately after elution 1 ml into glass cuvettes and register the absorption
spectra between 300 nm and 800 nm
(since the pigments degrade in the light)
21
3. DAY: MOLECULAR BIOLOGY AND
HERBICIDES
A) Introduction
The capability to generate transgenic plants has widened the research possibilities in
plant biochemistry, physiology, genetics and development enormously. It also led to
biotechnological applications. The most important method to introduce new genes
into plants relies on gene transfer by Agrobacterium tumefaciens, similar as was
performed in the experiment in the first week. For the current experiment, DNA
needed to be transferred into plant cells only for transient expression. If a transgenic
plant should be generated , cells from the inoculated tissue have to be regenerated to
a complete plant, which then contains the transgene stably integrated in the nuclear
genome of all its cells. In this way, the Nicotiana benthamiana p lants expressing GFP or
the Arabidopsis p lants containing light-regulated GUS reporter genes, which are used
in the course, have been generated . Today we will analyse a transgenic plant with
molecular methods to detect a transgene and its expression. The identification of
transgenes is an experiment that in this or similar form is performed in many
laboratories to test if food or feed contains genetically modified plant(material).
One important application of genetechnology with plants is the generation of
herbicide resistant plants for agriculture. Weed control is a necessary part of any
agriculture and herbicides provide the most effective means of control. Herbicide
resistant crop plants allow a more efficient and environmentally safe application of
herbicides.
Herbicides inhibit plant specific molecular processes. Today, we will analyse some
aspects of the function of the herbicide Norflurazone. Norflurazone inhibits the
enzyme phytoene desaturase (PDS), which catalyses the conversion of phytoene to
phytofluene, which will finally be converted to – carotene. PDS therefore is
essential for the biosynthesis of carotenoides (the photopigments that have been
analysed in the first week). In this experiment we will analyse the photooxidative
protection by carotenoids (which is also seen in the experiment with silencing of
PDS).
22
B) Experiments
B1) in C4:
1. Analysis of Norflurazon effect on plant growth
2. (Analysis of the promoter-GUS-plants)
3. (Evaluation of experiment on dark/light seedling development)
4. (Observation of Nicot iana benthamiana from first day)
B2) in C31:
1. Molecular Analysis of transgenic Nicot ioana benthamiana plants from first
week
(in parentheses: continuation and/ or analysis of last week’s experiments)
23
B1) in C4:
1. Analysis of Norflurazon effect on plant growth
label 4 black trays
(lowlight, lowlight + Norflurazon; strong light, strong light + Norflurazon)
fill these 4 trays plus an additional one with vermiculite and place in green
trays
irrigate the trays with water (to soak the vermiculite)
place ca. 20 mustard seed s per tray and cover them with 1 cm of vermiculite
(from the additional tray)
irrigate the trays labelled with „+ Norflurazon“ thoroughly with 2 µM
Norflurazon
irrigate the other 2 trays with d istilled water
wrap the “Lowlight” trays with 3 layers of household paper and place them
under the strong light source (together with the “strong light” trays)
2. Analysis of LHCP and PORA-gene promoter activity by means of the GUS
reporter gene in light-grown and etiolated transgenic Arabidopsis thaliana
seedlings
compare the staining pattern under the binocular
3. (Evaluation of experiment on dark/light seedling development)
See day two
4. (Observation of Nicot iana Benthamiana from first day)
See day two
24
B2) in C31:
1. Molecular analysis of transgenic Nicot iana benthamiana plants after systemic
gene silencing
The plants used in this experiment contain GFP as a transgene. This gene can be
detected by the Polymerase chain reaction (PCR). In a PCR reaction, a DNA
substrate (in this case genomic DNA from Nicotiana plants) is in cubated a DNA
Polymerase in a buffer with synthetic short DNA sequences which are
complementary to regions of the substrate (so called Primers). The mixture is then
cycled through a number of temperature changes (Figure 5). In the first phase, the
mixture is heated to 94 °C, which denatures the DNA by breaking the hydrogen
bonds that keep the two strands of the DNA double helix together. In th e second
phase, the temperature is reduced to allow basepairing of the denatured DNA. Since
the primers are present in excess, most suitable regions of the substrate will pair with
primers. The primers in this experiment are complementary to regions of the GFP
gene and flank an about 400 basepair long fragment. In the third (and last) phase, the
mixture is heated to 72 °C, because the heat stable DNA polymerase which is used in
PCR elongates strands partially double-stranded DNA at this temperature with
highest efficiency. This cycle of denaturation, renaturation with primers and DNA
elongation is repeated multiple times and finally leads to an exponential
amplification of the DNA piece between the two primers.
Gene expression can be measured with the same method, provided that the mRNA is
first copied into a complementary cDNA by the enzyme Reverse transriptase. The
DNA can then be further amplified by PCR. When the PCR reaction is stopped
during the exponential amplification phase (i.e. before saturation effects set in), the
signal (amount of obtained DNA fragment) is proportional to the amount of initial
mRNA and can be used as an approximate readout for the initial expression
strength, particularly when it can be compared to the signal derived from a second,
presumably constant mRNA species. In our experiment, expression of an TCTP gene
serves as an internal standard .
Biosafety: All plant material has to be collected in specific autoclave bags for
proper sterilization and disposal.
25
26
Raw DNA extract out of leaf tissue:
Solutions/Buffers:
- Extractionbuffer: 100 mM Tris/ HCl, pH 8
700 mM NaCl
50 mM EDTA, pH 8
- Chloroform (work under the fume hood!)
- 100 % Isopropanol
- 70 % Ethanol
Every group extracts DNA from two Nicotiana benthamiana p lants. Label two
1.5ml Eppendorf-tubes respectively. For simplicity and economy, we start
with non-transgenic plants.
Cool a mortar with some liquid nitrogen (Attention: wear protective glasses!!).
Add one piece of leaf to liquid nitrogen in the mortar and grind it to a fine
powder.
Transfer the powder w ith a cold spatula to one of the two Eppendorf tubes
and add 650 µl Extractionbuffer.
Mix vigourously by shaking and inversion. Incubate for about 10-15 min at
65°C (invert occasionally during this time).
Inbetween repeat the procedure with one leaf from the genetically modified
Nicotiana p lant using the same mortar and pestle. Why is the order of the
procdeedings important in this case?
Cool the leaf extract for about 1 min and add 325 µl Chloroform (in the fume
hood!). Shake gently for 3 min at room temperature (RT).
Centrifuge extracts for 2 min at 13200 rpm at RT. Prepare two new 1.5ml-
Eppendorf-tubes.
Carefully transfer the upper, aqueous phase to a respectively labeled
Eppendorf-tube (avoid to transfer cell debris).
Add 350 µl Isopropanol, mix well but gently (genomic DNA easily breaks to
pieces due to mechanic forces), incubate for 2 min at RT. DNA precipitates
and can be separated from molecular impurities..
Dry DNA Pellet after precipitation. DNA is
stained blue here. In our experiment the pellet should be clear or white.
27
Centrifuge the samples at 13200 rpm for 10 min, RT and remove the liquid
carefully.
Add 0.5 ml 70 % Ethanol to the DNA Pellett, shake and centrifuge again for 5
min at 13200 rpm, RT.
Remove liquid carefully and dry DNA pellet by letting the open tube sit at RT
for a few minutes
Dissolve DNA in 100 µl of water.
RNA extraction and Reverse transcription
RNA extraction can be done similarly. However, RNA is significantly less stable
than DNA and therefore, RNA isolation requires particular safety measures and
denaturation steps during the work. Wearing gloves and the use of RNAse free
solutions and material are essential. Since the isolation of undegraded RNA
appears very d ifficult under the working conditions of the course, RNA and
incubation solutions will be provided . In the experiment, we will measure the
expression of the phytoene desaturase gene with and without induced systemic
gene silencing. The RNA has been isolated from plant material showing (or not)
symptoms of gene silencing in an experiment that was performed in parallel to
the course.
Reverse t ranscript ion
All RNA species are copied into a complementary DNA strand . A DNA primer
binding to the polyA tail of the mRNA serves as a start point for DNA synthesis
by the enzyme reverse transcriptase.
Experiment
Mix in two 200 l Eppendorf tubes 5 l (1g) RNA from either Agro-TRV-PDS
or Agro-gffg plants with 15 l reaction mix
Centrifuge briefly and incubate for 1 h at 42°C.
Subsequently, heat the mix for 5 min at 70°C to inactivate the reverse
transcriptase and d ilute 5 fold with water.
The reaction mix contains:
28
1mM dNTPs, 10M oligo dT; 20U Ribolock RNase Inhibitor; 200U Reverse
Transcriptase and Buffer (50 mM Tris-HCl pH 8.3, 50 mM KCl, 4 mM
MgCl2, 10 mM DTT)
.
PCR:
To detect the GFP transgene you will use the DNA that you have isolated , for
quantification of PDS mRNA you use the generated cDNA.
Reagents:
- 5x Buffer (containing MgCl2)
- 2.5 mM dNTPs (dATP, dTTP, dCTP, dGTP)
- forward and reverse p rimer for the GFP gene
- Taq-Polymerase
Label six 0.2 ml-PCR-tubes
Add 5 µl of the respective DNA in the respective PCR tube and add 45 µl PCR
Mix to every sample.
The PCR Mix consists of::
5x Buffer
(containing
MgCl2)
10 µl
2.5 mM dNTPs 5 µl
2 µM Primer FW
5 µl
2 µM Primer RV
5 µl
Taq-Polymerase
(5U/ µl)
0.5 µl
H2O 19.5µl
5 µl Plant DNA 45 µl PCR Mix
29
Always use a new pipette tip. Minute amounts of DNA can be sufficient for a
wrong result
Load all samples into the PCR machine and start the following program:
95°C for 3 min
95°C for 20 sec
55°C for 30 sec
72°C for 40 sec
72°C for 5min
20 °C for ever
TCTP
Forward primer : GAGCTTCTGTCTGACTCTTTCCC
Reverse primer : GTTGAACCCTCCTTGTAGTAAGC
PDS
Forward primer : CTGAAGAACACATATGATCACC
Reverse primer : ATGATACTGTTGCCTCCGAC
GFP
Forward primer : AGTAAAGGAGAAGAACTTTTCACT
Reverse primer: TTCCGTCCTCCTTGAAATCGA
Repeat 27 x
30
4. DAY: PLANT WATER RELATIONS
A) Introduction
Today’s experiments deal with the crucial importance of water for plants and
visualize important concepts of water balance.
The waterpotential (W) measures the d ifference per unit volume between the free
energy of water (a thermodynamic parameter) in a particular state and a defined
standard state (pure water in an open volume, i.e. under atmospheric pressure).
Three main components contribute to the waterpotential, which therefore can be
described by the following equation:
w =
s +
p +
g
The first of these three components is the potential of solutes in the water (solute
potential, s), which reduce the free energy of water . This component is also termed
osmotic potential () of a solution and is described by van't Hoff’s law :
s = - RTc
s
In this equation, the osmotic potential is related to the universal gas constant (R =
8.314 J mol-1 K
-1), the absolute temperature (in Kelvin, 273.15 units larger than °C) and
the molal (mol l-1) concentration (c
s) of all osmotically active solutes (Taiz & Zeiger,
pp. 39-43).
The second component is the hydrostatic pressure (p) exerted on the water. In
turgescent, i.e. fully swollen, plant cells the rigid cell wall exerts a pressure that
hinders cells to take up more water. The third component is the gravity (g), which is
negligible in comparison to the other complonents for d istances below five meters
and will therefore not be considered in the current experiments.
The waterpotential of a tissue equals the potential of a solution, w hen no water
transport can be detected when the tissue is immersed in this solution in an open
volume. I.e., when the tissue neither takes up water nor loses water, its osmotic
potential equals that of the solution.
The turgor, i.e. the hydrostatic pressu re exerted by the cell on the cell wall, is of
crucial importance for extension of the cell wall and therefore for plant growth. This
principle is valid for all plant cells, but nevertheless not all plant cells in a plant
contribute equally to the restriction of plant growth. Particularly cells of the outer
most cell layer – the so called epidermis – are charaterised by thick cell walls and
contribute to the generation of a turgor within the plant, which confers strength and
stability to the plant even without additional strengthening elements.
31
B) Experiments
B1) in C4:
1. (Analysis of Norflurazon effect on plant growth)
2. Journal Club
B2) in C31:
1. Water potential measurement
2. Tissue tension
3. (Molecular characterization of Nicot iana benthamiana plants)
(in parentheses: continuation and/ or analysis of last week’s experiments)
32
B1) in C4:
1. Analysis of Norflurazon effect on plant growth
Trays from last week:
compare the seedlings in each tray and explain the observations
2. Journal Club
for each article:
- Introduction 5 to 10 min
- Methods, Results 10 to 15 min
- Summary, conclusions 5 to 10 min
Not more than 25 min alltogether
- Questions, discussion
33
B2) in C31:
1. Water potential measurement of potato parenchyma
dilute 1 M Sucrose solution with d istilled w ater into 0.5 M, 0.4 M, 0.3 M, 0.2 M
and 0.1 M solutions (10 ml for each concentration)
label 6 glass test tubes (0, 0.1, 0.2, 0.3, 0.4, 0.5) and fill with 10 ml d istilled water
or the corresponding sucrose solutions
cut cylinders out of potatoes with a drilling instrument (Korkbohrer)
cut the cylinders subsequently into small slices (about 3 mm thick) and place
these slices on wet filter paper
form 6 portions of ca. 2 g (write down the exact weight of every portion)
dip the portions into the sucrose solutions
mix regularly during the equilibration time of 2 hours
take out the tissue slices, d ry them (without applying pressure) and weigh the
portions again
calculate the % of weight difference ((End weight – Initial weight)/ Initial weight *100)
and plot in a diagram
- x-axis: Molarity of sucrose
– y-axis: weight difference
define by interpolation the concentration (K0) at which no weight difference would be
observed
set the waterpotential of the potato parenchyma approximatively equal to the potential
of the sucrose solution at a concentration of K0 and calculate the value
2. Tissue tension in sunflower hypocotyls
Stretching of the epidermis:
isolate 1 cm long fragments from the elongation zone of the hypocotyl (just
below the cotyledons) of 10 seven day old sunflower seedlings
incubate these fragments for 2 hours in d istilled water
peel off a strip of 1 to 2 mm width of the epidermis with flat tweezers
34
measure the length of the hypocotyl fragments and off the peeled epidermis strips,
calculate the averages and explain the difference in length
Compression of the inner tissues:
isolate 2 cm long fragments from the elongation zone just below the cotyledons
of 20 sunflower seedlings
peel off the epidermis of 10 of these fragments with a pair of flat tweezers
cut all the fragments (peeled and unpeeled) to 1.5 cm
incubate the fragments for 2 hours in d istilled water
measure the length of the peeled and unpeeled hypocotyl fragments, calculate the
averages and explain the difference in length
3. Molecular characterization of Nicot iana benthamiana plants
Running buffer (1 x TAE): Loading buffer:
- 40 mM Tris-Acetate pH 7.6 - 40 % Sucrose
- 1 mM EDTA - 0.25 % Bromophenolblue
- 0.25 % Xylene Cyanol
Gel electrophoresis:
weigh 1.5 g Agarose in a 250 ml Erlenmeyer flask
add 80 ml running buffer (1 x TAE)
heat in microwave until agarose melts
mix well (be careful: boiling retardation is possible) and add TAE to 150ml
cool the solution to about 60 ° C
prepare the gel chamber: seal the lower and the upper end with a tape
add 5 µl ethid ium bromide into the cooled agarose solution
Attention: Ethid iumbromide is carcinogenic, work with gloves!
swirl the Erlenmeyer flask to mix and pour the solution into the sealed gel
chamber
place 1 comb at the top
let the gel set for 30 min
35
take the PCR reactions from last week out of the fridge
add 5 µl of blue loading buffer into each PCR tube
remove the sealing tape after the gel has set
place the gel chamber into the electrophoresis tank
fill the electrophoresis tank with running buffer
load 20 µl of the PCR Reactions into individual gel slots
load one gel slot on the top and in the middle of the gel with each 10 µl DNA
ladder
close the lid and connect the electrodes (DNA is negatively charged at this pH –
why? – and thus migrates to the positive electrode)
run the electrophoresis at 70 V, until the blue color has migrated through half of
the gel (ca. 30 min)
observe the gel under UV-light (protect your eyes with safety glasses)
take a picture of the gel (assistant)
the expected fragments are around 500 base pairs
Interpretation
Compare your results according to plant genotype and treatment with d ifferent
Agrobacterium strains. Compare the signal for the TCPT gene with that for the PDS
gene under the d ifferent conditions.